ID: 915393625

View in Genome Browser
Species Human (GRCh38)
Location 1:155565138-155565160
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 2, 1: 0, 2: 32, 3: 165, 4: 512}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915393625_915393631 16 Left 915393625 1:155565138-155565160 CCAAAAAAAATCAGGTGGGCATG 0: 2
1: 0
2: 32
3: 165
4: 512
Right 915393631 1:155565177-155565199 TCCACCTACTTGGTAGGCTGAGG 0: 1
1: 125
2: 7942
3: 114167
4: 224142
915393625_915393630 10 Left 915393625 1:155565138-155565160 CCAAAAAAAATCAGGTGGGCATG 0: 2
1: 0
2: 32
3: 165
4: 512
Right 915393630 1:155565171-155565193 TGTAGTTCCACCTACTTGGTAGG 0: 1
1: 74
2: 3339
3: 57613
4: 179697
915393625_915393634 20 Left 915393625 1:155565138-155565160 CCAAAAAAAATCAGGTGGGCATG 0: 2
1: 0
2: 32
3: 165
4: 512
Right 915393634 1:155565181-155565203 CCTACTTGGTAGGCTGAGGCAGG 0: 10
1: 1420
2: 83823
3: 187627
4: 224634
915393625_915393628 6 Left 915393625 1:155565138-155565160 CCAAAAAAAATCAGGTGGGCATG 0: 2
1: 0
2: 32
3: 165
4: 512
Right 915393628 1:155565167-155565189 CGCCTGTAGTTCCACCTACTTGG 0: 15
1: 1513
2: 50230
3: 121552
4: 182741

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915393625 Original CRISPR CATGCCCACCTGATTTTTTT TGG (reversed) Intergenic
900588896 1:3450298-3450320 CATGCCCAGCTGATCCTTTGGGG + Intergenic
900653495 1:3743052-3743074 GATGCCCACCTGCTCTCTTTAGG + Intergenic
901299733 1:8190891-8190913 CATGCCCAGCTATTTTTTTTTGG + Intergenic
901414507 1:9107336-9107358 GATGAACACGTGATTTTTTTTGG + Intronic
901515577 1:9743702-9743724 CATGCCCAGCTAATTTTCGTGGG + Intronic
902029893 1:13414613-13414635 CACGCCCAGCTAATTTTTGTGGG + Intronic
902564446 1:17301691-17301713 CATGCCCCCCTTCTCTTTTTTGG - Intergenic
903389025 1:22951160-22951182 CATGCCTGGCTAATTTTTTTTGG - Intergenic
903424183 1:23241090-23241112 CATGCCCAGCTAATTTTTGTGGG - Intergenic
903783005 1:25834458-25834480 CACGCCCAGCTAATTTTTTTTGG - Exonic
904711199 1:32431829-32431851 CATGCCCAGCTAATTTTTACAGG + Intergenic
905556837 1:38892470-38892492 CATGCCTACGTGATGTATTTTGG - Intronic
905776635 1:40671917-40671939 CATGCCCAGCTAATTATTTTTGG + Intergenic
906173324 1:43746917-43746939 CATGCCTGACTAATTTTTTTTGG + Intronic
906261114 1:44391005-44391027 GATGCCCAGCTAATTTTTTTTGG + Intergenic
906283994 1:44573959-44573981 CACGCCCAGCTCATATTTTTTGG - Intronic
906359070 1:45137218-45137240 CATGCCCAGCTAATTTTTTTAGG + Intronic
906420006 1:45657694-45657716 CATGCCCAGCTAACTTTTTTGGG - Intronic
906812540 1:48843466-48843488 CATGACCACCTGTTTTTGTATGG + Intronic
907206454 1:52776060-52776082 CACGCCCGGCTAATTTTTTTGGG - Intronic
907272999 1:53301572-53301594 CATGCCCAGCTAATTTTTTTTGG - Intronic
907411874 1:54288861-54288883 CACACCCAGCTGATTTTTTTTGG - Intronic
907463882 1:54622580-54622602 CATACCCAGCTAATTTTTTGTGG - Intronic
907497821 1:54856442-54856464 CACGCCCGGCTAATTTTTTTTGG - Intronic
908469578 1:64430624-64430646 CATGCCCAGCTAATTTTTGTGGG + Intergenic
908955495 1:69621199-69621221 CATGCCCGGCTAATTTTTTATGG + Intronic
909710342 1:78642423-78642445 CATACCCAGCTAATTTTTGTGGG - Exonic
910006793 1:82407064-82407086 CATGCCCAGCTAATATTTTTTGG - Intergenic
910448510 1:87324016-87324038 CACGCCCAGCTAATTTTTTTTGG - Intergenic
910862256 1:91753231-91753253 CATGACCAGCTGATTTTTTTTGG - Intronic
911186696 1:94911610-94911632 CATGCCCAGCTAATTTTTGTGGG - Intronic
911442444 1:97944207-97944229 CACGCCCAGCTAATTTTTGTGGG + Intergenic
912398187 1:109365377-109365399 CATGCCCAGCTAATTTTGTGAGG + Intronic
912455706 1:109795583-109795605 CACGCCCGGCTAATTTTTTTTGG + Intergenic
912886975 1:113484879-113484901 CACGCCCAGCTAATTTTTTTTGG + Intronic
913017165 1:114750340-114750362 CATGCTCATCTGATGTTATTTGG + Intronic
913193823 1:116436241-116436263 TATGCCAAACTGATTTCTTTTGG - Intergenic
914687041 1:149989581-149989603 CATGCCCAGCTAATTTTTGTGGG - Intronic
914949457 1:152099794-152099816 CATGCCCAGGTAATTTTTTTTGG + Intergenic
915043679 1:152992050-152992072 CATGACCACCTGATCCTTTTAGG + Intergenic
915261715 1:154681620-154681642 CACGCCCGCCTAATTTTTTTTGG - Intergenic
915353529 1:155241373-155241395 CATGCCCTCCAGAGTTTTATAGG - Intronic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
915477885 1:156163873-156163895 CAGGCCCAGCTCATTTTTTTTGG - Intronic
916518417 1:165541557-165541579 CATGCCCAGCTAATTTTTTTTGG - Intergenic
917530934 1:175834328-175834350 CAGGCCCAGCTGATTTATTTTGG - Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918599544 1:186339786-186339808 AATGCATACTTGATTTTTTTAGG + Intronic
918777662 1:188655858-188655880 CAGGCCCAGCTAATTTTTGTGGG + Intergenic
919696783 1:200584841-200584863 CTTGCCCAGCTGGTTTTGTTAGG - Intronic
919963034 1:202491438-202491460 CATGCCCAGCCTGTTTTTTTTGG + Intronic
920148039 1:203879755-203879777 CATGCCCGGCTAATTTTTTACGG - Intergenic
920655883 1:207874446-207874468 CACGCCCAGCTAATTTTTTGTGG - Intergenic
920982397 1:210850352-210850374 CACGCCCAGCTACTTTTTTTTGG - Intronic
921203958 1:212832173-212832195 CATGCCCAGCTAATTTTTGTGGG + Intronic
921328592 1:214012920-214012942 CTTGCCCCCCTCCTTTTTTTCGG + Intronic
922320961 1:224486260-224486282 CATGCCCAGCTAATTTTTGTGGG + Intronic
922498302 1:226077970-226077992 CACGCCCAGCTAATTTTTGTGGG + Intergenic
922523515 1:226279002-226279024 CATGCCCTGCTAATTTTTTGTGG - Intronic
922708116 1:227802109-227802131 CACGCCCAGCTAACTTTTTTGGG + Intergenic
922782818 1:228267061-228267083 CATGCCTAGCTAATTTTTTAAGG + Intronic
922952245 1:229568880-229568902 CATGCCCGGCTGACTTTTGTGGG + Intergenic
923137735 1:231133337-231133359 CATGCTCACCTGGTTGTTGTGGG - Intergenic
923372149 1:233325517-233325539 CACGCCCAGCTAATTTTTTTTGG - Intergenic
923870622 1:237989695-237989717 CAAGCACAACTGATTTATTTGGG - Intergenic
923928547 1:238664724-238664746 CATACCCAGCTAATATTTTTTGG - Intergenic
924077497 1:240355559-240355581 CATGCCCAACTGATTGGTTTGGG + Intronic
924635621 1:245785004-245785026 CGTGCCCAGCTAATTGTTTTGGG + Intronic
924642479 1:245847537-245847559 CAGGCCCACCTGATTTCTTTTGG + Intronic
924651330 1:245930116-245930138 CTTAACCACCTGATGTTTTTAGG - Intronic
924736870 1:246765446-246765468 AATTCCCACCTGACTTTTTAAGG + Intronic
1062865348 10:847681-847703 CAGGCCCAGCTAATTTTTTTTGG + Intronic
1063672668 10:8112061-8112083 CATGCCCAGCTAATTTTTGTGGG + Intergenic
1063751738 10:8956907-8956929 CATGACCACATGATATTTCTGGG + Intergenic
1064034077 10:11901389-11901411 CATGCCCCCCTGCTGTTTCTGGG - Intergenic
1064039523 10:11947628-11947650 CATGCCCAGCTAATTATTTTGGG - Intronic
1064053498 10:12078453-12078475 CATGCCCGGCTAATTTTTGTGGG - Intronic
1064661538 10:17612763-17612785 CACGCCCGGCTAATTTTTTTTGG - Intronic
1064714841 10:18166410-18166432 CATGTCCAGCTAATTTTTGTTGG + Intronic
1064746326 10:18482044-18482066 CATGCCCTACTAATTTTTGTGGG + Intronic
1064998820 10:21319007-21319029 CAAACCCACCTGTTGTTTTTTGG + Intergenic
1065069529 10:22008180-22008202 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1065545485 10:26815752-26815774 CATACCCAGCTAATTTTTTTGGG - Intronic
1065559571 10:26948836-26948858 CACGCCCAGCTAATTTTTTTGGG - Intergenic
1065798050 10:29325006-29325028 CATGCCTAGCTAATTTTTTTTGG - Intergenic
1066642598 10:37571192-37571214 CATGCCCACCTGAATTTCCATGG - Intergenic
1067153408 10:43754269-43754291 CATGCCTGACTAATTTTTTTTGG + Intergenic
1067379337 10:45758762-45758784 CATGCCCGGCTAATTTTTTGTGG + Intronic
1067887037 10:50099424-50099446 CATGCCCGGCTAATTTTTTGTGG + Intronic
1068512841 10:57987669-57987691 AATGCCAACCAGATTATTTTAGG + Intergenic
1070019202 10:72567185-72567207 CATGCTTGGCTGATTTTTTTTGG - Intronic
1070134511 10:73680572-73680594 TATGCCCAGATAATTTTTTTTGG + Intronic
1070324800 10:75381377-75381399 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1070620406 10:78005320-78005342 CATGCCCGGCTAATTTTTTAAGG - Intronic
1070741564 10:78906754-78906776 CATACACACCTGTTTTTTCTTGG - Intergenic
1070995396 10:80774650-80774672 CATGCCCAGTTAATTTTTGTGGG - Intergenic
1071612763 10:87046618-87046640 CTTGCCCACCTGCTAATTTTTGG + Intergenic
1072115077 10:92363021-92363043 CATGTCCAGCTAATTTTTTTTGG - Intergenic
1072162852 10:92784471-92784493 CATGCCCAACTAATTTTTGTGGG + Intergenic
1072315779 10:94201630-94201652 CAAGCCCGGCTAATTTTTTTTGG + Intronic
1072744968 10:97933453-97933475 CATGCCCACCTGTTCTTCCTGGG + Intronic
1072867904 10:99083934-99083956 CATTCCCATATGGTTTTTTTGGG - Intronic
1072952725 10:99861938-99861960 TATGCCCAGCTAATTTTTGTGGG + Intergenic
1073252649 10:102130889-102130911 CATGCCCAGCTAATTTTTTGGGG - Intergenic
1073668068 10:105555889-105555911 CATGAACACATGATTTTTTATGG - Intergenic
1073756350 10:106585065-106585087 CATGCCTGGCTAATTTTTTTTGG - Intronic
1073922792 10:108478899-108478921 CATGACATCCTGATTCTTTTGGG - Intergenic
1074111338 10:110424800-110424822 CATGCCCAGTTGATTTTTATAGG + Intergenic
1074666829 10:115737278-115737300 CATGCCCAGCCTTTTTTTTTGGG - Intronic
1074770094 10:116727912-116727934 CATGCCCGACTAATTTTTTTGGG + Intronic
1076042706 10:127264815-127264837 CGTGCCCAGCTAATTTTTTGTGG + Intronic
1076169095 10:128305368-128305390 TATGCCCAACTAATTTTTGTTGG + Intergenic
1076867057 10:133172646-133172668 CAGGGCCACCTGTTTTCTTTAGG + Intronic
1079051460 11:17164193-17164215 CACACCCAGCTAATTTTTTTGGG - Intronic
1081116094 11:39203395-39203417 CATGCCCAGCTAATTTTTAGTGG - Intergenic
1081162249 11:39763656-39763678 CACGCCCGGCTTATTTTTTTTGG - Intergenic
1081163725 11:39784391-39784413 CACGCCCTGCTAATTTTTTTTGG + Intergenic
1081170911 11:39869159-39869181 CATGCCCAGCTAAGTTTTGTGGG - Intergenic
1081443632 11:43107981-43108003 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1081486671 11:43536036-43536058 CACGTCCAGCTAATTTTTTTTGG + Intergenic
1081895809 11:46585374-46585396 CATGCCCAGCGTTTTTTTTTTGG - Intronic
1083145281 11:60753557-60753579 CATGGCCACGTGACTTGTTTTGG - Intergenic
1083825235 11:65198814-65198836 CATGCCCAGATAATTTTTTTTGG + Intronic
1083907224 11:65680975-65680997 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1083916869 11:65752066-65752088 CATACCCAGCTAATTTTTTTTGG + Intergenic
1083942461 11:65903841-65903863 TACGCCCAGCTAATTTTTTTTGG + Intergenic
1084156537 11:67316251-67316273 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1084777303 11:71385982-71386004 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1084842965 11:71872569-71872591 CACGCCCAGCTATTTTTTTTTGG - Intronic
1084991657 11:72931249-72931271 CATGCACAACTAATTTTTGTGGG + Intronic
1085288116 11:75377375-75377397 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1085927909 11:81044046-81044068 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1086065615 11:82740788-82740810 CATTCACACCTTATTTTTTAAGG - Intergenic
1086083585 11:82931506-82931528 CATGCCCAGCTAATTTTTGTGGG + Intronic
1087717205 11:101622117-101622139 CATGCCCAGATAATTTTTTTTGG - Intronic
1088467946 11:110161975-110161997 TATGCCCAGCTAATTTTTTTTGG - Intronic
1088870073 11:113883243-113883265 CATACCCAGCTGATTTCTGTAGG - Intergenic
1089020095 11:115204834-115204856 CAGGCCCACATTATTATTTTTGG - Intronic
1089028403 11:115296105-115296127 CATGCCCAGCTAATATTTTTTGG + Intronic
1090958064 11:131531293-131531315 CATGCTCTGCTAATTTTTTTTGG + Intronic
1091079011 11:132648656-132648678 CATGCCCAGCTAATTTTTTCTGG + Intronic
1092124966 12:6068624-6068646 CATGCCCAGCTAATTTCTGTGGG + Intronic
1092233558 12:6791723-6791745 CATGCCCAGCTAACTTTTGTGGG - Intronic
1092492021 12:8954059-8954081 CATGTCCATATGATTTTTTGAGG + Intronic
1092520792 12:9270493-9270515 CATGGCCACCTTATTGTTATAGG - Intergenic
1092782425 12:11999470-11999492 CATGTCCAGCTAATTTTTGTAGG + Intergenic
1093454989 12:19356360-19356382 CATGCCTGGCTAATTTTTTTTGG - Intronic
1094106691 12:26819912-26819934 CATGCCCAGCTAATTTTTTTGGG - Intronic
1094538750 12:31345307-31345329 CACGCCCAGCTAATTTTTCTGGG + Intergenic
1094644948 12:32313822-32313844 CGTGCCCAGCTAATTTTTTCTGG - Intronic
1095156162 12:38857737-38857759 CATGCCCGGCTATTTTTTTTGGG - Intronic
1095207086 12:39450663-39450685 CATGCCCAGCTAATTTTTTAAGG + Intergenic
1095456908 12:42396881-42396903 CATGCCCAGCTAATTTTTTGTGG - Intronic
1096246989 12:49996478-49996500 CATGCCCGGCTAATTTTTTTTGG - Intronic
1096308497 12:50499888-50499910 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1097056103 12:56250346-56250368 TGTGCCTACCTGATTTTTGTGGG + Intronic
1097477028 12:60070773-60070795 CATGCACACCTGACATATTTAGG + Intergenic
1097690868 12:62733409-62733431 CATACCCAGCTGATTTTTTTTGG + Intronic
1097827462 12:64188699-64188721 CCTGACCACAAGATTTTTTTTGG - Intronic
1098275206 12:68805707-68805729 CATTCCCTCCAGACTTTTTTTGG + Intergenic
1098414785 12:70220542-70220564 CATGCCCAGCTAATTTTTGTTGG + Intergenic
1098543951 12:71690304-71690326 CATGCCCAGCTAATTTTTTCTGG + Intronic
1098761396 12:74429429-74429451 CATGGCCACTTGACTTATTTTGG + Intergenic
1100069474 12:90694548-90694570 CATGCCCGGCTAATTTTTTTTGG + Intergenic
1100267268 12:92989703-92989725 CATGCTTGGCTGATTTTTTTTGG - Intergenic
1100302217 12:93318342-93318364 CATGCCTGGCTAATTTTTTTGGG - Intergenic
1100534351 12:95492719-95492741 AACGCCCAGCTAATTTTTTTTGG + Intronic
1100662023 12:96709875-96709897 CACGCCCAGCTAATTTTTTGTGG + Intronic
1101844737 12:108353774-108353796 CATGCCCAGTTAATTTTTTATGG + Intergenic
1101969503 12:109303128-109303150 CATGCACACATGTGTTTTTTAGG + Intronic
1102450067 12:113035292-113035314 CATGCCTAGCTAATTTTTGTAGG - Intergenic
1102979255 12:117228513-117228535 CACCCCAACCTGATTTTTCTGGG - Intronic
1103501271 12:121404541-121404563 CACACCCAGCTAATTTTTTTTGG + Intronic
1104068318 12:125323919-125323941 AATGCTCACATGATTTTTCTGGG - Intronic
1105009974 12:132749150-132749172 CACGCCCAGCTGATTTTTTTGGG + Intronic
1105288614 13:19029939-19029961 CATGCCCGGCTAATTTTTGTGGG - Intergenic
1105438596 13:20397771-20397793 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1106151945 13:27113076-27113098 CATGCTCAGCTAATTTTTTAAGG - Intronic
1107479762 13:40776368-40776390 CATACCCAGCTAACTTTTTTTGG - Intergenic
1107484127 13:40810313-40810335 CATGTCCAGCTAATTTTTTTTGG + Intergenic
1107934497 13:45334082-45334104 GATGCCCAATTAATTTTTTTAGG + Exonic
1108042992 13:46356860-46356882 CATGCCCAGCTAGCTTTTTTTGG + Intronic
1108415695 13:50196260-50196282 CATGCCGGGCTAATTTTTTTTGG + Intronic
1109226170 13:59698791-59698813 CATGCCATCCTAATTCTTTTAGG - Intronic
1109408854 13:61938181-61938203 CATGCCCAGCTAATTTTTGGGGG + Intergenic
1109427166 13:62179926-62179948 TATGCCAACCTGATTTTCTAAGG + Intergenic
1109991129 13:70059312-70059334 TATGCCCAGCTAATTGTTTTTGG + Intronic
1110461437 13:75749823-75749845 CACCCCCACCTTTTTTTTTTTGG + Intronic
1111468289 13:88645231-88645253 AATTCCCACCTGATATATTTTGG - Intergenic
1112340664 13:98550371-98550393 CATGCCCAACTATTTTTTGTAGG - Intronic
1112556266 13:100471531-100471553 CAGGCCTACCTCATTTTATTAGG - Intronic
1112748163 13:102551583-102551605 CAAGCCCGGCTAATTTTTTTTGG - Intergenic
1113566292 13:111321635-111321657 CACGCCCATCCGATTTTCTTGGG - Intronic
1113840726 13:113359426-113359448 CATGCCCAGCTAATTTTTAAGGG - Intronic
1114034026 14:18604479-18604501 AATACCGACCTGATTTCTTTGGG - Intergenic
1114078822 14:19183653-19183675 AATACCGACCTGATTTCTTTGGG - Intergenic
1114124619 14:19710531-19710553 AATACCGACCTGATTTCTTTGGG + Intergenic
1114203926 14:20550001-20550023 CATGCCCACTTGTTAATTTTTGG - Intergenic
1114541469 14:23463285-23463307 CACGCCCAACTAATTTTTGTGGG - Intergenic
1114667426 14:24387652-24387674 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1115004392 14:28464351-28464373 CATTCCTACCTCATTCTTTTAGG + Intergenic
1116742227 14:48770954-48770976 CATGCCCAGCTAATTTTTGTAGG - Intergenic
1117151481 14:52892609-52892631 CACGTCCAGCTAATTTTTTTTGG + Intronic
1117781043 14:59232434-59232456 CTTGCCCCTCTGATTTTTTAGGG - Intronic
1118123464 14:62872534-62872556 CACGCCCAGCTAATTTTTTTTGG - Intronic
1118387263 14:65266230-65266252 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1118432094 14:65729180-65729202 CATGCCCAGCTAATTTTTTATGG + Intronic
1118569806 14:67183000-67183022 CATGCCCAGCTGATGCTATTGGG + Intergenic
1118574683 14:67230413-67230435 CATACCCAGCTTATTTTTTGTGG - Intergenic
1118611549 14:67544661-67544683 CAAGTCTACCTGATCTTTTTAGG - Intronic
1118851882 14:69590363-69590385 CATGCCCAGCTAAATTTTGTGGG + Intergenic
1119452048 14:74719983-74720005 CACGCCCGGCTAATTTTTTTTGG - Intronic
1119896207 14:78221869-78221891 CATGGCCACATGATTTGCTTTGG - Intergenic
1121202278 14:92128324-92128346 CACGCCCAGCTAATTCTTTTTGG - Intronic
1123457588 15:20439882-20439904 CAAGCCCGGCTCATTTTTTTTGG + Intergenic
1123583204 15:21735138-21735160 CATGCACAAATGAGTTTTTTTGG + Intergenic
1123619854 15:22177735-22177757 CATGCACAAATGAGTTTTTTTGG + Intergenic
1123660483 15:22560540-22560562 CAAGCCCGGCTCATTTTTTTTGG - Intergenic
1123714886 15:23020427-23020449 CATGCCCGGCTAATTTTTTGGGG - Intronic
1124076210 15:26446974-26446996 CATTCTCTCCAGATTTTTTTTGG - Intergenic
1124158079 15:27245714-27245736 CATGCCCAGCTAATTTTTTGTGG - Intronic
1124314337 15:28655025-28655047 CAAGCCCGGCTCATTTTTTTTGG - Intergenic
1125192566 15:37010537-37010559 CATGCCTTCCTAATTTTTTTTGG + Intronic
1127464124 15:59227165-59227187 CCTGCCCACCTGAATTCCTTTGG + Intronic
1127696011 15:61448571-61448593 CATGCCCAACTAATTTTTGTAGG + Intergenic
1128628272 15:69234592-69234614 CTTCACCACCTTATTTTTTTAGG + Intronic
1128744561 15:70104264-70104286 CATGCCCACCTGAGACTTTGTGG + Intergenic
1129083257 15:73060801-73060823 CATGCCCAGCTAATTTTTTTGGG + Intronic
1130605482 15:85312799-85312821 CTTGCTCACCTGATTTTGTGGGG + Intergenic
1131104604 15:89724043-89724065 CACGCCCAGCTATTTTTTTTTGG - Intronic
1131295119 15:91141156-91141178 CATTCCCACAGGATTTTCTTCGG + Intronic
1131677586 15:94686256-94686278 CATGCACTCATGAGTTTTTTCGG + Intergenic
1132824186 16:1894927-1894949 CACGCCCAGCTAATTGTTTTTGG + Intergenic
1132827099 16:1910566-1910588 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1133093965 16:3428221-3428243 CATGCCCAGCTAATTTTGTGGGG - Intronic
1133122983 16:3623050-3623072 CATGCCCAGCTAATTTTTTTGGG - Intronic
1133157793 16:3887978-3888000 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1134297037 16:12955516-12955538 CATGCTCACATTTTTTTTTTTGG - Intronic
1134396677 16:13871464-13871486 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1134440595 16:14297514-14297536 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1134491212 16:14696831-14696853 CATGCCCAGCTAATTTTTTGTGG - Intergenic
1134496593 16:14735949-14735971 CATGCCCAGCTAATTTTTTGTGG - Intronic
1136430016 16:30191608-30191630 CATGCCCAGCTAATTTTTGGGGG - Intergenic
1137246758 16:46712145-46712167 AATGCCCAACTAATTTTTTTTGG + Intronic
1137416125 16:48282252-48282274 CATGCCCAGCTAATTTTTGTGGG - Intronic
1137967910 16:52955133-52955155 CATGCCTAATTTATTTTTTTTGG - Intergenic
1138034141 16:53585870-53585892 CAGGCCCAGATGATTTTTTAGGG - Intergenic
1139575496 16:67839401-67839423 CACACCCAGCTAATTTTTTTTGG - Intronic
1139697684 16:68686809-68686831 CACACCCAGCTTATTTTTTTTGG - Intronic
1139735004 16:68979998-68980020 CATGCCCGGCTAATTTTTTTTGG + Intronic
1139806710 16:69571914-69571936 CACGCCCGGCTAATTTTTTTTGG + Intronic
1139821448 16:69724543-69724565 CACACCCAGCTAATTTTTTTTGG - Intronic
1139823637 16:69740095-69740117 CATGCCCATCAAATTTTATTTGG - Intergenic
1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG + Intronic
1140913141 16:79471518-79471540 CATGCCCAACTAATTTTTGTGGG - Intergenic
1141106389 16:81237219-81237241 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1141417729 16:83889514-83889536 CATGCCCAGCTAATTTTTATGGG + Intergenic
1141440774 16:84028426-84028448 CATGCCTGGCTAATTTTTTTTGG - Intronic
1142474745 17:182072-182094 CATGCGCACATGGTTGTTTTAGG + Intergenic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1142905424 17:3038080-3038102 CCTGCCCAGCTAATTTTTTAGGG - Intergenic
1143634698 17:8157776-8157798 CATGCCCGGCTAATTTTTGTAGG - Intronic
1144526397 17:15994103-15994125 CATGCCCAGCTAATTTTTTTTGG + Intronic
1144865599 17:18333620-18333642 CATGTCCAGCTAATTTTTGTTGG + Intronic
1145237550 17:21219461-21219483 CATGCCCAGCTAACTTTTTTTGG - Intergenic
1145716509 17:27028220-27028242 CATACCCAGCTAATTTTTGTGGG - Intergenic
1145915164 17:28569311-28569333 CACACCCAGCTGATTTGTTTTGG - Intronic
1146206502 17:30909483-30909505 TATGCCCAGCTAATTTTTTTTGG - Intronic
1147499465 17:40948848-40948870 CATGCCCAGCTAATTTTTGTGGG - Intergenic
1149587703 17:57803890-57803912 CACGCCCAGCTAATTTTTTTGGG + Intergenic
1149676794 17:58472008-58472030 CATGCCTGGCTAATTTTTTTTGG + Intronic
1149748010 17:59118107-59118129 AATGCCCAGCTAATTTTTTGTGG - Intronic
1149790770 17:59474917-59474939 CATGCCCAGCTAATTTTTCTGGG + Intergenic
1150555676 17:66252095-66252117 CATGCCCAGCTAATTTTTGTAGG - Intronic
1150743006 17:67794763-67794785 CCCGCCCAGCTGATTTTTTTTGG - Intergenic
1151230433 17:72681097-72681119 CATGCCCAGGTAATTTTTTTGGG + Intronic
1151278915 17:73057105-73057127 CATGCCCAGTTAATTTTTTGTGG + Intronic
1151447149 17:74174645-74174667 CACGCCCAGATGATTTTTTTTGG - Intergenic
1152156967 17:78640767-78640789 CATGCCAAGCTAATTTTTTTTGG - Intergenic
1152513689 17:80808131-80808153 CATGCCTAACTTTTTTTTTTTGG - Intronic
1152764853 17:82130793-82130815 CACGCCCAGCTCCTTTTTTTTGG + Intronic
1153671838 18:7419180-7419202 CATGCCCAGCTAATTTCTTTTGG + Intergenic
1153763544 18:8354054-8354076 CACGCCCAGCTAATTTTTTGTGG - Intronic
1154117100 18:11620703-11620725 CATGCCCAACTGACTTCTTGAGG - Intergenic
1154118538 18:11633069-11633091 CAGGCCCAACTAATCTTTTTTGG + Intergenic
1155142357 18:23054755-23054777 CACGCCCAGCTAATTTTTATGGG + Intergenic
1155318285 18:24593847-24593869 CAAGCCCACCTGCTTTATCTTGG + Intergenic
1156243352 18:35274170-35274192 CATGCCCAGCTAATTTTTGGGGG + Intronic
1156294664 18:35778649-35778671 TCTGCCTACCAGATTTTTTTGGG + Intergenic
1156727456 18:40146798-40146820 CATGCCTGGCTAATTTTTTTAGG + Intergenic
1157498978 18:48176968-48176990 CATGCCCACCTCATGGTCTTGGG + Intronic
1157569208 18:48701159-48701181 CATGCCCAGGTGGTTTTTTCAGG + Intronic
1158690334 18:59654633-59654655 CATGCCCGGCTAATTTTGTTTGG - Intronic
1158800941 18:60908016-60908038 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1159347425 18:67225249-67225271 CATGCCCAGCTAATTTTTGTGGG + Intergenic
1159623322 18:70665063-70665085 CATAGCTACCTGCTTTTTTTTGG + Intergenic
1160882732 19:1329196-1329218 CATGCCCAGCTAATTTTTCTAGG - Intergenic
1160973022 19:1778253-1778275 CATGCCCATTTAATTTTTTAAGG + Exonic
1161477541 19:4494759-4494781 CACGCCCAGCTAATTTTTTAAGG - Intronic
1161742227 19:6028920-6028942 CACACCCACCTAATTTTTTTTGG - Intronic
1161798322 19:6400705-6400727 CATGCCGGCCTGTTTTTTTTGGG + Intergenic
1162460943 19:10813667-10813689 CATGCCCAGCTAATTTTTTTTGG - Intronic
1162653226 19:12107618-12107640 CATGCCCAGCTAATTTTTGTGGG - Intronic
1162662528 19:12181627-12181649 CACGCCCAGCTAATTTTTTTTGG + Intronic
1163156693 19:15443505-15443527 CAAGCCCACCTAACTCTTTTGGG + Intronic
1163573285 19:18096069-18096091 CATGCCTGGCTAATTTTTTTGGG - Intronic
1164231017 19:23288909-23288931 TATGCCCACATGAGGTTTTTGGG - Intergenic
1164256016 19:23528909-23528931 CAAGCCCAGCTAATTTTTTTAGG - Intronic
1165640536 19:37382058-37382080 CATGCCCCCATGCATTTTTTGGG + Intronic
1165812787 19:38622060-38622082 CATGCCCAGCTAATTTTACTTGG + Intronic
1165822946 19:38688412-38688434 CATGTCCAGCTAATTTTTGTGGG - Intronic
1168045412 19:53790767-53790789 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1168550901 19:57292671-57292693 CATCCCCTCCTTATTTTATTTGG + Exonic
1168624067 19:57902815-57902837 CATGCCCGGCTAATTTTTTGTGG + Intronic
1202655574 1_KI270708v1_random:17492-17514 CATACCCGGCTGATTTTTGTGGG + Intergenic
925536769 2:4926541-4926563 CATGCCCGGCTAATGTTTTTTGG + Intergenic
927034177 2:19155801-19155823 CAGGCCCAGCTAATTTTTCTAGG - Intergenic
927503274 2:23596294-23596316 CATGCCCACCTCATTTTGCAAGG + Intronic
927733959 2:25501534-25501556 CATGCCCAGCTAATTTTTGTTGG + Intronic
927941828 2:27108937-27108959 CATGCCCAGCTTTTTTTTTTTGG + Intronic
928019432 2:27690641-27690663 AATGCCCAGCTAATTTTTGTGGG + Intronic
928989174 2:37213566-37213588 CATGCCCAGCTCATTTTTTGGGG + Intronic
929512074 2:42572420-42572442 CATGCCCGGCTATTTTTTTTTGG - Intronic
930179374 2:48337453-48337475 CATGCCCCACTAATTTTTGTGGG + Intronic
930780443 2:55219895-55219917 CCTGCCCACCTTTTCTTTTTTGG + Intronic
931270006 2:60693275-60693297 CACGCCCGGCTAATTTTTTTTGG - Intergenic
931672889 2:64664823-64664845 CATGCCCAGCTAATTTTTATGGG + Intronic
931766590 2:65462241-65462263 CATGCCCAGCTAGGTTTTTTTGG - Intergenic
932278237 2:70467641-70467663 CTTGCCCACTTAGTTTTTTTGGG + Intronic
932597078 2:73100765-73100787 CATTCCCAACAGGTTTTTTTTGG + Intronic
932915553 2:75854657-75854679 CTTGCCCATCTGATATGTTTTGG + Intergenic
933119936 2:78523835-78523857 CATGCCAAGCTAATTTTTTTGGG - Intergenic
933169994 2:79114527-79114549 CATGCCCAGCTAATTTTTGACGG + Intergenic
933712831 2:85340181-85340203 CATGCCCAGCTAATTTTTCTGGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934924999 2:98376114-98376136 TATGCGCAATTGATTTTTTTTGG - Intronic
935159195 2:100514589-100514611 CATGCCTAGCTAATTTTTTGGGG + Intergenic
935858624 2:107302659-107302681 CACACCCAGCTAATTTTTTTTGG - Intergenic
935969436 2:108516099-108516121 CACGCCCGTCTAATTTTTTTGGG + Intergenic
936329766 2:111537543-111537565 CATGACCACCAGACTTTTGTGGG + Intergenic
937108012 2:119337209-119337231 CATGCCCAGCTAGTTTTTTGGGG + Intronic
937386687 2:121440533-121440555 CATGCCCTGCTAATTTTTTGTGG - Intronic
937972630 2:127562451-127562473 CACGCCCAGCTAATTTTTGTGGG + Intronic
938272289 2:129983720-129983742 CACGCCCAGCTAATTTTTGTAGG - Intergenic
938290798 2:130149147-130149169 CATGCCCATCTGAGGTTTTTGGG + Intergenic
938465751 2:131523806-131523828 CATGCCCATCTGAGGTTTTCGGG - Intergenic
938909255 2:135870902-135870924 CATGCCCAGCTAATTTTTGTGGG + Intronic
939924712 2:148158874-148158896 CATGCCTGGCTAATTTTTTTTGG + Intronic
940807106 2:158200079-158200101 CTTGTGCAGCTGATTTTTTTTGG - Intronic
940882728 2:158962638-158962660 CACGCCCAGCTAATTTTTATTGG - Intergenic
942135527 2:172921251-172921273 CATGCCCAGCTAGTTTTTTGTGG + Intronic
942234966 2:173895137-173895159 CATGCCCAGCTAATTTCTTGGGG + Intergenic
942647410 2:178128160-178128182 CATGCCCAGGTAATTTTTTTTGG + Intronic
944406196 2:199386393-199386415 CATACCTACCTGAATTATTTCGG - Intronic
944544953 2:200790071-200790093 CATGCCTGGCTAATTTTTTTGGG - Intergenic
945266782 2:207898599-207898621 CATGCCCAGCTAATTTTTGTGGG - Intronic
945777978 2:214131210-214131232 TATGCCCAGCTACTTTTTTTTGG - Intronic
945958408 2:216107470-216107492 CAAGCCCAGCTAATTTTTGTGGG - Exonic
946288575 2:218725374-218725396 CATGCCTAGCTAATTTTTTATGG + Intronic
946499781 2:220235424-220235446 CAAGCCCTCTTGATCTTTTTAGG - Intergenic
946854637 2:223940797-223940819 CATGCCCAGCTAATTTTTGTGGG + Intronic
946906609 2:224422846-224422868 CATGCCCAGCTAATTTTTTGGGG - Intergenic
948013896 2:234672241-234672263 CGCACCCAGCTGATTTTTTTAGG + Intergenic
948438631 2:237970863-237970885 CATGCCGAGCTAATTTTTTTTGG + Intronic
948734153 2:239988582-239988604 CATTCCCACCTGAGCTTGTTCGG - Intronic
948900109 2:240952188-240952210 CATGCCCGGCTAATTTTTTGTGG - Intronic
1169067504 20:2702269-2702291 CATGCCCAGCTAATTAATTTTGG - Intronic
1169071400 20:2734250-2734272 CATGCCCAGCTAATTTTTGTAGG - Intronic
1169181753 20:3575118-3575140 TATGCCCAGCTAATTTTTCTAGG + Intronic
1169223582 20:3841726-3841748 CATGCCCGGCTAATTTTTGTGGG - Intergenic
1169396301 20:5233030-5233052 CACACCCAGCTTATTTTTTTTGG - Intergenic
1172043603 20:32063407-32063429 CATGCCTGGCTAATTTTTTTGGG + Intronic
1172248147 20:33460227-33460249 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1172609946 20:36243012-36243034 CACGCCCAGCTAATTATTTTTGG + Intronic
1172697092 20:36830409-36830431 CATGCCAAGCTAACTTTTTTGGG - Intronic
1172966169 20:38836817-38836839 CTTGCCCAGCTGTATTTTTTTGG + Intronic
1173203557 20:40972417-40972439 CATGCCCAGCTTATTTTTTAAGG + Intergenic
1173380394 20:42534477-42534499 CATGCCCGGCTAAATTTTTTTGG - Intronic
1173482983 20:43417502-43417524 CATGCCCAGCTAATTTTTGCTGG + Intergenic
1173516925 20:43671123-43671145 CATGCCCAGCTAATTTTTGTGGG + Intronic
1173614647 20:44394825-44394847 CATGCCCAGTTAATTTTTTAAGG + Intronic
1173781183 20:45758733-45758755 CAAGCCCAGCTAATTTTTGTGGG + Intronic
1174009987 20:47442003-47442025 CATGCCCAGCTAACTTTTTTAGG + Intergenic
1174016333 20:47491334-47491356 CATGCCCGGCTAATTTTTGTAGG + Intergenic
1174214266 20:48904079-48904101 CATGCCCAACTAATTTTTTTTGG - Intergenic
1174304946 20:49608463-49608485 GAAGCCCACCTGATTTTTCAGGG - Intergenic
1174486981 20:50867501-50867523 CATGCCCAGCTAATTTTTTTGGG + Intronic
1174596162 20:51685403-51685425 CACGCCCAGCTAACTTTTTTTGG - Intronic
1174641365 20:52047282-52047304 CATGCCCAGCTAATTTTTGGTGG + Intergenic
1174841895 20:53908914-53908936 CATGCCCAGCATATTTTTTGTGG - Intergenic
1174890142 20:54383116-54383138 CTTGCCCACCTTATATTTCTCGG - Intergenic
1175058099 20:56216509-56216531 CATGCCCAGCTAATTGTTTGGGG - Intergenic
1176519560 21:7814363-7814385 CATGCCCAGGTAATTTTTTCTGG - Intergenic
1177371088 21:20204721-20204743 CTTGCCTACTTTATTTTTTTTGG - Intergenic
1177961516 21:27672514-27672536 CATGCCCACCTTCTTAATTTTGG - Intergenic
1177965105 21:27718006-27718028 CACGCCCGACTAATTTTTTTTGG + Intergenic
1178362798 21:31963651-31963673 CATGCCCAGCTAATTTTTTTTGG + Intronic
1178418150 21:32420540-32420562 CAGGCCTAGCTAATTTTTTTTGG + Intronic
1178653588 21:34444376-34444398 CATGCCCAGGTAATTTTTTCTGG - Intergenic
1178883887 21:36470066-36470088 TATGTCCACCTGGGTTTTTTGGG - Intronic
1179788452 21:43742334-43742356 CATGCCCAGCTAACTTTTTGTGG + Intronic
1180379175 22:12122844-12122866 CATGACCACATATTTTTTTTTGG + Intergenic
1180458145 22:15531522-15531544 AATACCGACCTGATTTCTTTGGG - Intergenic
1180687116 22:17677887-17677909 CATGCCCAGCTAATTTTTGTGGG - Intronic
1180689463 22:17699768-17699790 TCTGCACAACTGATTTTTTTTGG - Intronic
1181274390 22:21679306-21679328 GGTGCCCAGCTGTTTTTTTTTGG - Intronic
1181347750 22:22232444-22232466 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1181536082 22:23546159-23546181 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1182386974 22:29952043-29952065 CACGCCCAGCTAATTTTTGTGGG + Intronic
1182427355 22:30281743-30281765 CATGCCCAGCTAATTATTTTTGG + Intergenic
1182772203 22:32803676-32803698 CATTCCCACCTGATTAGTGTGGG + Intronic
1182861369 22:33562279-33562301 CATGCCCACCCTAATTTTTCTGG - Intronic
1183132681 22:35854428-35854450 CATACCCAGCTAATTTTTTTGGG - Intronic
1183851491 22:40592643-40592665 CATGCCTGGCTAATTTTTTTTGG + Intronic
949238133 3:1836118-1836140 CATGCTCAGCTAACTTTTTTTGG + Intergenic
950971890 3:17197531-17197553 CAAGCCCAGCTAATTTTTTTTGG + Intronic
953163332 3:40442454-40442476 CATGCCTGGCTAATTTTTTTGGG - Intergenic
953775241 3:45811061-45811083 CATGCCCAGCTAATTTTTACAGG - Intergenic
953832096 3:46308075-46308097 CATGCCCGGCTGATTTTTGTGGG + Intergenic
954241997 3:49301094-49301116 CATGCCTGGCTAATTTTTTTAGG + Intronic
954737093 3:52715541-52715563 CAGGCCCAGCTAATTTTTTTTGG + Intronic
955672038 3:61412171-61412193 CATGCCCAGCTAATTTTTTTTGG - Intergenic
956462847 3:69488734-69488756 CATGCCCAGCTAATTTTTAGTGG - Intronic
957131528 3:76228853-76228875 CATGCCCCACTAATTTTTTAAGG - Intronic
957685368 3:83498739-83498761 CATTGCCACCTGATATTTTCTGG + Intergenic
959364997 3:105446476-105446498 CATACCAACCTAATTTTCTTTGG - Intronic
959538382 3:107512705-107512727 CACGCCCAGCCAATTTTTTTTGG - Intergenic
959748670 3:109807696-109807718 CACACCCAGCTAATTTTTTTTGG - Intergenic
960287236 3:115843399-115843421 CATGTCCACTTGACTTTGTTAGG + Intronic
960635181 3:119777900-119777922 CATGCCCAGCTATTTTTTTCTGG - Intergenic
960823217 3:121756495-121756517 CATGCCCAGCTAATTTTTGTGGG + Intergenic
960985168 3:123274378-123274400 CACGCCCAGCTTATTTTTTTTGG - Intergenic
961041340 3:123680504-123680526 CATTCTCACCAGATTTTTCTTGG + Intronic
961117669 3:124345399-124345421 TATACTCTCCTGATTTTTTTTGG + Intronic
961568792 3:127783776-127783798 CCTGCCCACCTGATATTTCTGGG + Intronic
961845881 3:129762623-129762645 CAAGCCCAGCTAATTTTTTTTGG - Intronic
962573596 3:136735767-136735789 CACGCCCAGCTAATTTTTTCTGG + Intronic
962578724 3:136778083-136778105 CATGCCCAGCTAATTTTTTGTGG - Intergenic
962607704 3:137046063-137046085 CATGCCCAGCTAATTTTTGCAGG - Intergenic
962771698 3:138616529-138616551 CACACCCAGCTAATTTTTTTTGG + Intronic
963129705 3:141846991-141847013 CATGCCCGGCTAATTTTTGTGGG + Intergenic
963302620 3:143616035-143616057 CACGCCCAGCTAATTTTTTTTGG + Intronic
963356728 3:144217473-144217495 CAACCCCATCTGATTTATTTAGG - Intergenic
963400673 3:144793436-144793458 AATGCCAACCTGATTATTTAAGG - Intergenic
964099718 3:152974282-152974304 CATCCCCAACTGTTGTTTTTTGG + Intergenic
964341760 3:155715767-155715789 CATGCCCAGCTAATTTTTTGTGG + Intronic
964721575 3:159772308-159772330 CATGCCCAACTAACTTTTTAGGG + Intronic
966178484 3:177165931-177165953 CATGTCCAGCTAATTTTTTGTGG - Intronic
966408301 3:179622122-179622144 CATGCCCAACTAATTGTTTAGGG + Intronic
967960934 3:194923435-194923457 CATGACCAGCTAATTTTTTGTGG + Intergenic
968053146 3:195670008-195670030 CATGCCCAGCTAATTTTTGAGGG + Intergenic
968102667 3:195978353-195978375 CATGCCCAGCTAATTTTTGAGGG - Intergenic
969071912 4:4546547-4546569 CATGCCCAGCTAATTTTTTGGGG + Intergenic
970501857 4:16685893-16685915 CATGCCCAACTACTTTTTTTTGG - Intronic
970774502 4:19656718-19656740 CATGCCCGGCTAATTTTTTTTGG - Intergenic
970885976 4:20987842-20987864 CACGCCCGGCTAATTTTTTTTGG - Intronic
971360746 4:25936349-25936371 CATGCCCAGCTAACTTTTTTTGG - Intergenic
972436889 4:39044003-39044025 AATGCCCACGTGCTTTCTTTTGG - Intergenic
972441622 4:39099129-39099151 CATGCCTGGCTAATTTTTTTTGG - Intronic
972463499 4:39329337-39329359 CCTCCCCAGCTAATTTTTTTTGG - Intronic
973875718 4:55216645-55216667 CATGCCTGGCTGTTTTTTTTGGG + Intergenic
973952524 4:56030986-56031008 CATGCCTGGCTCATTTTTTTTGG - Intronic
975464118 4:74689983-74690005 CAAGCCCAGCTAATTTATTTTGG + Intergenic
975540052 4:75499982-75500004 CATGCCCAGCTAATTTTTTGTGG - Intronic
976068862 4:81219062-81219084 CATGCCAATCTTATTTTCTTGGG + Intergenic
976779973 4:88748044-88748066 CACGCCCGGCTAATTTTTTTTGG + Intronic
977196447 4:94067065-94067087 CATGCCCAGCTAATTTTTGTGGG + Intergenic
977639471 4:99340255-99340277 TGTGCCCAGCTAATTTTTTTGGG - Intronic
978419110 4:108511293-108511315 CATGCCCACCTGATTCCTTCTGG - Intergenic
978528157 4:109687200-109687222 CATGCCCACCTAATATTTTTTGG - Intronic
978830918 4:113083641-113083663 AATGCCCACATGATTTTGATTGG - Intronic
980690388 4:136289426-136289448 CAAGCCCGGCTTATTTTTTTTGG - Intergenic
980758206 4:137192687-137192709 CATGCCTAATTAATTTTTTTTGG - Intergenic
981002223 4:139838997-139839019 TTAGCCCACCTGAATTTTTTAGG - Intronic
981601334 4:146492061-146492083 CACGCCCAGCTAATTTTTTTTGG - Intronic
983304151 4:165964778-165964800 CATGCCCAGCTAATTGTTGTTGG - Intronic
983467668 4:168115041-168115063 CATGCCCAGCTAATTTTGTATGG + Intronic
983474543 4:168197616-168197638 CATGCCCAGCTAATTTTTTTTGG - Intergenic
984285498 4:177723419-177723441 CCTGCCCACCTGCTTGCTTTTGG + Intergenic
984329734 4:178299020-178299042 CATGCCCAGCTAATTTTTGTGGG - Intergenic
984731357 4:183070721-183070743 CATGCCCAGCTGATATGGTTTGG - Intergenic
984769926 4:183428441-183428463 CATGCCCAGCTAATTTTTCTGGG - Intergenic
985028323 4:185761975-185761997 CATGCAAAGCTGATTTATTTTGG + Intronic
986477700 5:8152679-8152701 CACCCCCACCTCCTTTTTTTTGG - Intergenic
987939989 5:24521448-24521470 CATGCCCACCTAATTTTGTAAGG - Intronic
988078380 5:26382555-26382577 CATGCCCTCATGATTTTGCTTGG - Intergenic
988654781 5:33197884-33197906 CATGCCCAGCTGATTTTGTGAGG - Intergenic
989109485 5:37893429-37893451 CCTGCCCATCAGATTGTTTTGGG + Intergenic
990380587 5:55218876-55218898 CATGACAAGCTGATTGTTTTGGG + Intergenic
991454624 5:66789214-66789236 CATACACACATGATTTTTTGAGG + Intronic
991457480 5:66819928-66819950 CATACCCAGCTAATTTTTGTGGG + Intronic
991481221 5:67082303-67082325 CACGCCCAGCTAATTTTTGTTGG + Intronic
992081418 5:73236872-73236894 CATGCCCGGCTAATTTTTGTGGG - Intergenic
992666786 5:79018202-79018224 CATGCCCGGCTAATTTTTTGTGG + Intronic
992693379 5:79260535-79260557 CATACCCAGCTGATTTTTGTGGG + Intronic
992740221 5:79766253-79766275 CAAGCCCCGCTAATTTTTTTGGG + Intronic
993173498 5:84451981-84452003 CATGCCCGGCTAATTTCTTTTGG - Intergenic
993535243 5:89076188-89076210 CATTCCCACCTGTATTATTTAGG + Intergenic
994152805 5:96468395-96468417 ATTGCACACCTGAATTTTTTTGG - Intergenic
994433761 5:99702227-99702249 CATGCCCAGATAATTTTTTTTGG + Intergenic
994697615 5:103092171-103092193 CATGCCCGGCTAATTTTTGTAGG + Intronic
995517180 5:112965905-112965927 CATGCCTAGCTAATCTTTTTGGG + Intergenic
995680841 5:114717792-114717814 CAGGCCCAGCTACTTTTTTTTGG - Intergenic
996638697 5:125727742-125727764 CATGCCCAGCAAATTTTTTGTGG + Intergenic
996847074 5:127911862-127911884 CATGCCCAGATAATTGTTTTTGG + Intergenic
997329015 5:133045655-133045677 CATGCCCAGCTAATTTTTTTGGG - Intergenic
997971020 5:138402083-138402105 CGTGCCCAGCTAATTTTTTTTGG + Intronic
997971323 5:138404879-138404901 CATGCCCTGCTAATTTTTGTGGG + Intronic
998087174 5:139336041-139336063 CATGCCCAGCTAATTTTTGTAGG + Intergenic
998518116 5:142774024-142774046 GATGCCAACCTGCTTTGTTTAGG + Intronic
998785602 5:145705345-145705367 TATGCCCAGCTAATTTTTGTGGG + Intronic
998830862 5:146157295-146157317 CATGTACACCTCATTTTTTAAGG + Intronic
999061329 5:148638888-148638910 CACGCCCATCTAATTTTTTGTGG - Intronic
999754883 5:154656940-154656962 CACACCCAGCTAATTTTTTTTGG - Intergenic
999831100 5:155320998-155321020 CATGCCCAGCTAATTTTTTGTGG + Intergenic
1000092426 5:157941244-157941266 CACGCCCAGCTAATTTTTGTGGG + Intergenic
1000170101 5:158693987-158694009 CACGCCCAGCTAATTTTTTTTGG + Intergenic
1000564150 5:162827203-162827225 CATGGCCTCATGATTTCTTTTGG - Intergenic
1000613768 5:163405469-163405491 CATGCCCACCTAATTATTTTTGG + Intergenic
1000652410 5:163833408-163833430 CATGTCCGGCTAATTTTTTTTGG - Intergenic
1000896200 5:166858452-166858474 CAGGCCCAGCTATTTTTTTTGGG - Intergenic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1002220717 5:177678533-177678555 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1002392240 5:178924214-178924236 CATGCCCGGCTAATTTTTTGTGG - Intronic
1002678631 5:180940934-180940956 CAAGCCCAGCTAATTTTTATGGG - Intronic
1004313663 6:14567513-14567535 CACGCCCAGCTAATTTTTTTCGG - Intergenic
1004896243 6:20150718-20150740 TACGCCCAGCTAATTTTTTTTGG + Intronic
1005267554 6:24127542-24127564 CATGGGCACCTGCTTTTCTTAGG + Intronic
1005326781 6:24709748-24709770 CATGCCCAACAGATATTTTGTGG - Intronic
1005477553 6:26222658-26222680 CATGCCCGGCTTATTTTTTTGGG - Intergenic
1005731949 6:28706250-28706272 CATGCCCAGCTAATTAATTTTGG + Intergenic
1007040404 6:38716113-38716135 CACGCCCGGCTAATTTTTTTTGG + Intronic
1007573396 6:42909428-42909450 CGTGCCCAGCTAATTTTTTTTGG + Intergenic
1007646326 6:43384377-43384399 CATGCCTGGCTAATTTTTTTGGG + Intergenic
1007654227 6:43442571-43442593 CAAGCCCAGCTAAATTTTTTTGG - Intronic
1007883390 6:45193557-45193579 CATGCCCAGCTAATTTTTTGAGG - Intronic
1008881763 6:56387453-56387475 ATTGCTTACCTGATTTTTTTTGG - Intronic
1009469984 6:64020627-64020649 CATCCCCACTTGATTATTTTGGG + Intronic
1010355988 6:74934020-74934042 CTTGCCTACTTGACTTTTTTTGG - Intergenic
1011098359 6:83692911-83692933 CATGACCATATGATTGTTTTGGG - Intronic
1011433756 6:87315637-87315659 TATGCCCTGCTAATTTTTTTTGG - Intronic
1011605077 6:89095367-89095389 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1013090903 6:106900106-106900128 CATGCCCAGCTAATTTCTGTAGG + Intergenic
1013159638 6:107529578-107529600 AATGCCCTACTGATTTTCTTTGG + Intronic
1014156755 6:118119658-118119680 CATGCCCAGCTAATTTCTGTAGG + Intronic
1014189965 6:118484157-118484179 CACGCCCAGCTAATTTTTTTGGG - Intronic
1014737075 6:125105956-125105978 CAACCCCAACTAATTTTTTTAGG + Intergenic
1016332464 6:142967984-142968006 CATGTCTGCCTAATTTTTTTTGG - Intergenic
1016720903 6:147296062-147296084 CAGGACCATCTGTTTTTTTTTGG - Intronic
1016946744 6:149541855-149541877 CATGCCTGGCTAATTTTTTTTGG - Intronic
1016961993 6:149682566-149682588 CATGCCCAGCTAATTTTTTTTGG + Intronic
1017421353 6:154276025-154276047 CATGGCCAGCTAAATTTTTTTGG - Intronic
1017546085 6:155451779-155451801 CACGCCCAGCTAATATTTTTTGG + Intronic
1017934445 6:158992434-158992456 CATGCCCAGCTAATTTTTGTGGG + Intronic
1018206278 6:161440105-161440127 CACGCCCGGCTAATTTTTTTTGG + Intronic
1018306780 6:162466101-162466123 CATGCCCAGCTTATTATTTCTGG + Intronic
1019423051 7:960101-960123 CATGCCCAGCTAAGTTTTGTGGG + Intronic
1019584492 7:1790483-1790505 CACGCCCAGCTCATTTTTTGGGG - Intergenic
1019646788 7:2134795-2134817 CATGCCCACCTGATTTCTGGTGG - Intronic
1019923797 7:4179509-4179531 CAAGCCCAGCGGATTTTTTCCGG + Intronic
1020059602 7:5142605-5142627 ACTGCCCAGCTAATTTTTTTGGG + Intergenic
1020134644 7:5580252-5580274 CATGCCCAGCTAATATTTGTGGG - Intergenic
1020816621 7:12913490-12913512 CATCCACACCTCACTTTTTTCGG - Intergenic
1021684492 7:23170055-23170077 CACGCCCGGCTAATTTTTTTTGG - Intronic
1021958411 7:25849838-25849860 CAGGCCCACATGATGTTTGTTGG + Intergenic
1022682847 7:32566331-32566353 CACGCCCAGCTAATTTTTTGTGG + Intronic
1023106897 7:36771491-36771513 CATGCCCACCTGATTAAGTCTGG - Intergenic
1023500081 7:40839397-40839419 CCTGCCCAGCTAATTTTTATTGG + Intronic
1023906235 7:44523572-44523594 CATGCCCAGCTGATATTTGGTGG - Intronic
1024568054 7:50699980-50700002 CACGCCCGGCTAATTTTTTTTGG - Intronic
1024747701 7:52427395-52427417 CACGCCCAGCTAATTTTTGTTGG + Intergenic
1025871168 7:65435505-65435527 CATGCCCGGCTAATTGTTTTTGG - Intergenic
1025922788 7:65929254-65929276 CACACCCAGCTAATTTTTTTTGG - Intronic
1025974070 7:66355746-66355768 CACACCCAGCTAATTTTTTTTGG - Intronic
1026182041 7:68050085-68050107 CATGCCCACTTAATTTTTTGGGG - Intergenic
1026550085 7:71360779-71360801 CATACCCAGCTAATTTTTGTGGG - Intronic
1026656911 7:72264656-72264678 CACACCCAGCTGATTTTTTGTGG + Intronic
1026689024 7:72536421-72536443 CATGCCCAGCTAACTTTTGTAGG - Intergenic
1026945088 7:74310866-74310888 CATGCCCTGCTAATTGTTTTTGG + Intronic
1026996501 7:74620212-74620234 CATGCCTGGCTAATTTTTTTGGG - Intergenic
1027234949 7:76292579-76292601 CATGCCCGGCTAATTTTTGTAGG + Intergenic
1027787586 7:82599500-82599522 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1029000875 7:97152804-97152826 CATGCCCAGCAAATTTTTGTAGG + Intronic
1029030154 7:97458622-97458644 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1029481361 7:100815164-100815186 CATGCCCAGCTAATTTTTTTTGG - Intronic
1029589941 7:101500662-101500684 CACGCCCAGCTAATTTTTGTGGG - Intronic
1029715435 7:102322898-102322920 CACGCCTAGCTAATTTTTTTTGG + Intergenic
1030071654 7:105703145-105703167 CACGCCCAGCTAATTTTTTGGGG - Intronic
1030090467 7:105853605-105853627 CACGCCCAGCTCATTTTTGTGGG - Intronic
1030224845 7:107138838-107138860 CATGCCCAGCTTATTTTTTTTGG + Intronic
1031114178 7:117649908-117649930 CATGGCCAACTGCTTTCTTTAGG - Intronic
1032182717 7:129694519-129694541 CATGCCTGGCTAATTTTTTTTGG + Intronic
1032234632 7:130109377-130109399 CATGCCTGGCTAATTTTTTTTGG + Intronic
1032300204 7:130679664-130679686 CCTGTCCAGCTGATTTTTGTGGG + Intronic
1032376822 7:131428012-131428034 CATGCCCAGCTAACTTTTTTTGG - Intronic
1033263285 7:139861926-139861948 CATCCCCACCTCATTTACTTTGG - Intronic
1033432099 7:141298953-141298975 CATGCACACCTGAGTTTGGTAGG + Intronic
1034052912 7:148001918-148001940 CATGCTCACCTTATATTTTATGG + Intronic
1034458206 7:151183243-151183265 CATTCCCAGCTAATTTTTTGTGG - Intronic
1034614014 7:152398981-152399003 CAAGCCCAGCTAATTTTTGTGGG + Intronic
1035450138 7:158972682-158972704 CACGCCCAGCTAATTTTTTGTGG + Intergenic
1035848639 8:2891777-2891799 CACGCCCAGCTAATTTTTGTAGG + Intergenic
1036008562 8:4694510-4694532 CATGCCAGGCTAATTTTTTTTGG + Intronic
1037647945 8:20810731-20810753 CATGCCCGGCTAATTTTTGTGGG - Intergenic
1038272376 8:26085804-26085826 CATGCCCAGCTAATTTTTGTGGG - Intergenic
1038812231 8:30860276-30860298 CGTGCCCAGCTAATTTTTGTAGG + Intronic
1039853400 8:41391780-41391802 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1039865419 8:41496962-41496984 CATGCCCGGCTAATTTTTTTTGG + Intronic
1040030154 8:42816467-42816489 CATGCCTAGCTAATTTTTTTGGG - Intergenic
1040428121 8:47309880-47309902 CATGTCCGGCTAATTTTTTTTGG - Intronic
1040458229 8:47621376-47621398 CATGCCCAGATGATTCATTTGGG - Intronic
1040472336 8:47744720-47744742 CATCCCCAGCTAATTTTCTTTGG - Intergenic
1040789628 8:51211091-51211113 CATGCCCGGCTACTTTTTTTTGG - Intergenic
1040917734 8:52580701-52580723 CATGCCCAGCTAATTTTTAGTGG - Intergenic
1041492250 8:58446951-58446973 CATGCCCAGCTAATTTTTTCTGG + Intronic
1041874810 8:62675755-62675777 CATGTCCACCTGCTTTTATAAGG - Intronic
1042532384 8:69829519-69829541 CGTGCCCAGCTAATTTTTTGTGG - Intronic
1042905194 8:73765501-73765523 CATGCCCAGCTAATTTTTGTGGG + Intronic
1042914772 8:73864731-73864753 CATGTCCAGCAAATTTTTTTGGG + Intronic
1043388506 8:79769518-79769540 CATGCTCAGCTAATTGTTTTTGG + Intergenic
1043835288 8:85038308-85038330 CTTGCCCCGCTGCTTTTTTTTGG - Intergenic
1043913880 8:85897736-85897758 CATGCTCAACTGAATTTTTAAGG - Intergenic
1044321858 8:90811102-90811124 CATGCCCGGCTAATTTTTTGGGG + Intronic
1045195106 8:99922792-99922814 CATGCCCACAGATTTTTTTTGGG + Intergenic
1045205650 8:100037139-100037161 CATGCCCAACTTTATTTTTTTGG - Intronic
1045698776 8:104841518-104841540 TATGCTCAGCTGATTTGTTTTGG + Intronic
1046477456 8:114765400-114765422 CATGCCCAGCTAATTATTTTTGG - Intergenic
1046534285 8:115488516-115488538 CACGCCCAGCTAATTTTTTGGGG - Intronic
1046755644 8:117970457-117970479 CATGCCTGGCTAATTTTTTTTGG + Intronic
1047791622 8:128209519-128209541 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1048566044 8:135598546-135598568 CATGCCCAGTTGTTTATTTTAGG - Intronic
1048731339 8:137444198-137444220 CATGCCCACGTGATGATATTAGG + Intergenic
1048777540 8:137963965-137963987 CACGCCCAGCTAATTTTTTGTGG - Intergenic
1049285757 8:141774352-141774374 CATGCCCACCTGACTGTTGAGGG + Intergenic
1049430507 8:142560994-142561016 CCTGCCCAACTAATTTTTTAAGG + Intergenic
1051495526 9:17718569-17718591 CATGCCCAGCTAATTTTTGTGGG - Intronic
1051627661 9:19113728-19113750 CATGCCCAGCTAATTTTTGTGGG + Intronic
1051880823 9:21838036-21838058 CAAGCCCACATGATTTATTCTGG - Intronic
1051887355 9:21907399-21907421 CATGCCCAGCTAATTTTTGTAGG - Intronic
1051948571 9:22602406-22602428 CATGACCGGCTAATTTTTTTTGG - Intergenic
1052313092 9:27089845-27089867 CAAGACAACCAGATTTTTTTAGG - Intergenic
1052531438 9:29689503-29689525 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1052728011 9:32253251-32253273 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053797113 9:41736648-41736670 CATACCCGGCTAATTTTTTTTGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054148084 9:61578220-61578242 CATACCCGGCTAATTTTTTTTGG - Intergenic
1054185527 9:61948729-61948751 CATACCCGGCTAATTTTTTTTGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054467824 9:65509314-65509336 CATACCCGGCTAATTTTTTTTGG - Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054556308 9:66660773-66660795 CACACCCAGCTAATTTTTTTAGG - Intergenic
1054781163 9:69167082-69167104 CACGCCCAGCTAATTTTTCTGGG - Intronic
1055219499 9:73911196-73911218 CATGCCAAGCTAATTTTTTGGGG - Intergenic
1056597396 9:88019072-88019094 CATTTCCACCTGGTTTTCTTGGG + Intergenic
1056632748 9:88307185-88307207 CATGGCCATCTGATCTTGTTGGG + Intergenic
1057402083 9:94732658-94732680 CATACGGACCTGATTTGTTTTGG + Intronic
1057596887 9:96422199-96422221 CATGCCCAGCTAATTGTTTTTGG - Intergenic
1058092379 9:100819400-100819422 GCTGCCCACCTGATTGTTGTTGG - Intergenic
1058138434 9:101333621-101333643 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1059521680 9:114948471-114948493 CATGCCCGGCAGATTTTTTTTGG - Intergenic
1059550199 9:115221320-115221342 CATGCCTGGCTGATTTTTTTTGG - Intronic
1059569870 9:115423195-115423217 CATGGCCACGTGAATTTGTTGGG - Intergenic
1060227264 9:121800644-121800666 CATGTCCAGCTAATTTTTCTGGG + Intergenic
1061096852 9:128462754-128462776 CATGCCCGGCTAATTTTTTATGG + Intronic
1061616942 9:131786620-131786642 CATGCCTAGCTAATTTTTTGTGG + Intergenic
1203531646 Un_GL000213v1:149031-149053 AATGCATACCTGTTTTTTTTGGG - Intergenic
1203541563 Un_KI270743v1:93210-93232 CATGACCACATATTTTTTTTTGG + Intergenic
1185573848 X:1154743-1154765 CACGCCCGGCTGATGTTTTTAGG + Intergenic
1187057820 X:15757549-15757571 CATGCCCGGCTAATTTTTGTGGG - Intronic
1187138263 X:16569442-16569464 CATGCTCAGCTAATTTTTTAAGG - Intergenic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1188142227 X:26565708-26565730 CATGCCCAGATGACTTGTTTTGG - Intergenic
1188506616 X:30890419-30890441 CATGCCCGGCTGATTAGTTTTGG + Intronic
1188568055 X:31549065-31549087 CATACCCTCCTCATTTTTATGGG - Intronic
1189151302 X:38710122-38710144 CATGCCTAGCTAATTTTTGTGGG + Intergenic
1189275476 X:39782130-39782152 CAAGCCCAGCTAATGTTTTTTGG + Intergenic
1189349429 X:40265888-40265910 CACGCCCAGCTAAATTTTTTTGG - Intergenic
1189376178 X:40467801-40467823 CATACCCGGCTAATTTTTTTTGG + Intergenic
1189597264 X:42582633-42582655 CATGGCCTCCTGATGTTTCTCGG - Intergenic
1189717539 X:43881753-43881775 CAGGCCCTCCTGATTCTTTGAGG - Intronic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1190170632 X:48109184-48109206 CACCCCCAGCTAATTTTTTTTGG + Intergenic
1190196991 X:48328405-48328427 CACGCCCCGCTGATTTTTTTAGG + Intergenic
1190204693 X:48393741-48393763 CATGACCCACTGATTTTTTTAGG + Intergenic
1190205843 X:48401662-48401684 CATGACCCACTGATTTTTTTAGG - Intergenic
1190663724 X:52678784-52678806 CACGCCCCACTGATTTTTTTAGG + Intronic
1190675699 X:52779638-52779660 CACGCCCCACTGATTTTTTTAGG - Intronic
1190789940 X:53689220-53689242 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1191862026 X:65673609-65673631 CATGCCCAGCTAATTTTGTATGG + Intronic
1193730563 X:85097492-85097514 CATGCCCAGCTAATTTTTTAAGG + Intronic
1193913861 X:87341380-87341402 CATGCCCAGCTAATATTTTTGGG - Intergenic
1194277413 X:91902422-91902444 TATTCCCTTCTGATTTTTTTTGG + Intronic
1195091494 X:101463908-101463930 CATGCCCGGCTAATTTTTTTTGG + Intronic
1195132585 X:101868455-101868477 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1195196401 X:102501535-102501557 CATACCCAGCTAATTTTTTGTGG + Intergenic
1198751460 X:139940260-139940282 CATGCCCGGCTAATTTTTGTAGG - Intronic
1199225000 X:145363058-145363080 CACGCCCAACTAATTTTTTGTGG + Intergenic
1199255126 X:145710708-145710730 CACACCCAGCTGAATTTTTTTGG - Intergenic
1199756278 X:150867923-150867945 CACGCCCAGCTAATTTTTGTAGG - Intronic
1200594756 Y:5124519-5124541 TATTCCCTTCTGATTTTTTTTGG + Intronic
1200960848 Y:8994496-8994518 CTTGCCCCCCTGATATTTTTAGG + Intergenic
1200981293 Y:9265407-9265429 CTTGCCCCTCTGATATTTTTAGG - Intergenic
1201055488 Y:9985979-9986001 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1201587924 Y:15581786-15581808 CATGCCCAGCTAATTTTTTTAGG + Intergenic
1201904545 Y:19076332-19076354 CATGCCTAGCTAAATTTTTTTGG - Intergenic
1202129127 Y:21594327-21594349 CTTGCCCCTCTGATATTTTTAGG + Intergenic
1202298689 Y:23387318-23387340 CATGCCCAGCCTGTTTTTTTTGG + Intergenic