ID: 915394314

View in Genome Browser
Species Human (GRCh38)
Location 1:155570994-155571016
Sequence TTTGCTAGAAATAATGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915394314_915394317 6 Left 915394314 1:155570994-155571016 CCACATGCATTATTTCTAGCAAA No data
Right 915394317 1:155571023-155571045 TATAGCTACAAGACTGAGGTTGG No data
915394314_915394315 2 Left 915394314 1:155570994-155571016 CCACATGCATTATTTCTAGCAAA No data
Right 915394315 1:155571019-155571041 CACCTATAGCTACAAGACTGAGG No data
915394314_915394318 10 Left 915394314 1:155570994-155571016 CCACATGCATTATTTCTAGCAAA No data
Right 915394318 1:155571027-155571049 GCTACAAGACTGAGGTTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915394314 Original CRISPR TTTGCTAGAAATAATGCATG TGG (reversed) Intergenic
No off target data available for this crispr