ID: 915394317

View in Genome Browser
Species Human (GRCh38)
Location 1:155571023-155571045
Sequence TATAGCTACAAGACTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915394314_915394317 6 Left 915394314 1:155570994-155571016 CCACATGCATTATTTCTAGCAAA No data
Right 915394317 1:155571023-155571045 TATAGCTACAAGACTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915394317 Original CRISPR TATAGCTACAAGACTGAGGT TGG Intergenic
No off target data available for this crispr