ID: 915399648

View in Genome Browser
Species Human (GRCh38)
Location 1:155612869-155612891
Sequence GTCCAGGGCTGTAGCCAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 2, 1: 1, 2: 3, 3: 23, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915399648_915399654 23 Left 915399648 1:155612869-155612891 CCATCCTGGCTACAGCCCTGGAC 0: 2
1: 1
2: 3
3: 23
4: 325
Right 915399654 1:155612915-155612937 GTGTTCCTCTCCAGTTTCCATGG 0: 2
1: 0
2: 1
3: 15
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915399648 Original CRISPR GTCCAGGGCTGTAGCCAGGA TGG (reversed) Exonic