ID: 915399649

View in Genome Browser
Species Human (GRCh38)
Location 1:155612873-155612895
Sequence CTGTGTCCAGGGCTGTAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 2, 1: 0, 2: 5, 3: 28, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915399649_915399656 28 Left 915399649 1:155612873-155612895 CCTGGCTACAGCCCTGGACACAG 0: 2
1: 0
2: 5
3: 28
4: 322
Right 915399656 1:155612924-155612946 TCCAGTTTCCATGGTTCATCTGG 0: 2
1: 0
2: 2
3: 12
4: 123
915399649_915399654 19 Left 915399649 1:155612873-155612895 CCTGGCTACAGCCCTGGACACAG 0: 2
1: 0
2: 5
3: 28
4: 322
Right 915399654 1:155612915-155612937 GTGTTCCTCTCCAGTTTCCATGG 0: 2
1: 0
2: 1
3: 15
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915399649 Original CRISPR CTGTGTCCAGGGCTGTAGCC AGG (reversed) Exonic