ID: 915399650

View in Genome Browser
Species Human (GRCh38)
Location 1:155612884-155612906
Sequence AGGAACAGTGACTGTGTCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 2, 1: 0, 2: 1, 3: 26, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915399650_915399656 17 Left 915399650 1:155612884-155612906 CCCTGGACACAGTCACTGTTCCT 0: 2
1: 0
2: 1
3: 26
4: 253
Right 915399656 1:155612924-155612946 TCCAGTTTCCATGGTTCATCTGG 0: 2
1: 0
2: 2
3: 12
4: 123
915399650_915399654 8 Left 915399650 1:155612884-155612906 CCCTGGACACAGTCACTGTTCCT 0: 2
1: 0
2: 1
3: 26
4: 253
Right 915399654 1:155612915-155612937 GTGTTCCTCTCCAGTTTCCATGG 0: 2
1: 0
2: 1
3: 15
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915399650 Original CRISPR AGGAACAGTGACTGTGTCCA GGG (reversed) Exonic