ID: 915399654

View in Genome Browser
Species Human (GRCh38)
Location 1:155612915-155612937
Sequence GTGTTCCTCTCCAGTTTCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915399649_915399654 19 Left 915399649 1:155612873-155612895 CCTGGCTACAGCCCTGGACACAG 0: 2
1: 0
2: 5
3: 28
4: 322
Right 915399654 1:155612915-155612937 GTGTTCCTCTCCAGTTTCCATGG 0: 2
1: 0
2: 1
3: 15
4: 236
915399651_915399654 7 Left 915399651 1:155612885-155612907 CCTGGACACAGTCACTGTTCCTT 0: 2
1: 0
2: 1
3: 23
4: 237
Right 915399654 1:155612915-155612937 GTGTTCCTCTCCAGTTTCCATGG 0: 2
1: 0
2: 1
3: 15
4: 236
915399650_915399654 8 Left 915399650 1:155612884-155612906 CCCTGGACACAGTCACTGTTCCT 0: 2
1: 0
2: 1
3: 26
4: 253
Right 915399654 1:155612915-155612937 GTGTTCCTCTCCAGTTTCCATGG 0: 2
1: 0
2: 1
3: 15
4: 236
915399648_915399654 23 Left 915399648 1:155612869-155612891 CCATCCTGGCTACAGCCCTGGAC 0: 2
1: 1
2: 3
3: 23
4: 325
Right 915399654 1:155612915-155612937 GTGTTCCTCTCCAGTTTCCATGG 0: 2
1: 0
2: 1
3: 15
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915399654 Original CRISPR GTGTTCCTCTCCAGTTTCCA TGG Exonic