ID: 915399656

View in Genome Browser
Species Human (GRCh38)
Location 1:155612924-155612946
Sequence TCCAGTTTCCATGGTTCATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 2, 1: 0, 2: 2, 3: 12, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915399652_915399656 -3 Left 915399652 1:155612904-155612926 CCTTATCGCCTGTGTTCCTCTCC 0: 2
1: 0
2: 1
3: 17
4: 167
Right 915399656 1:155612924-155612946 TCCAGTTTCCATGGTTCATCTGG 0: 2
1: 0
2: 2
3: 12
4: 123
915399650_915399656 17 Left 915399650 1:155612884-155612906 CCCTGGACACAGTCACTGTTCCT 0: 2
1: 0
2: 1
3: 26
4: 253
Right 915399656 1:155612924-155612946 TCCAGTTTCCATGGTTCATCTGG 0: 2
1: 0
2: 2
3: 12
4: 123
915399649_915399656 28 Left 915399649 1:155612873-155612895 CCTGGCTACAGCCCTGGACACAG 0: 2
1: 0
2: 5
3: 28
4: 322
Right 915399656 1:155612924-155612946 TCCAGTTTCCATGGTTCATCTGG 0: 2
1: 0
2: 2
3: 12
4: 123
915399651_915399656 16 Left 915399651 1:155612885-155612907 CCTGGACACAGTCACTGTTCCTT 0: 2
1: 0
2: 1
3: 23
4: 237
Right 915399656 1:155612924-155612946 TCCAGTTTCCATGGTTCATCTGG 0: 2
1: 0
2: 2
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915399656 Original CRISPR TCCAGTTTCCATGGTTCATC TGG Exonic