ID: 915404985

View in Genome Browser
Species Human (GRCh38)
Location 1:155653218-155653240
Sequence CCTTCTGTAGTCAAAGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915404985_915404990 14 Left 915404985 1:155653218-155653240 CCTGGTACTTTGACTACAGAAGG No data
Right 915404990 1:155653255-155653277 CTGAAAAAGTCCCTTCCATTTGG No data
915404985_915404991 15 Left 915404985 1:155653218-155653240 CCTGGTACTTTGACTACAGAAGG No data
Right 915404991 1:155653256-155653278 TGAAAAAGTCCCTTCCATTTGGG No data
915404985_915404992 19 Left 915404985 1:155653218-155653240 CCTGGTACTTTGACTACAGAAGG No data
Right 915404992 1:155653260-155653282 AAAGTCCCTTCCATTTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915404985 Original CRISPR CCTTCTGTAGTCAAAGTACC AGG (reversed) Intergenic
No off target data available for this crispr