ID: 915406024

View in Genome Browser
Species Human (GRCh38)
Location 1:155660298-155660320
Sequence CTCAAAAAGAAGGGGAGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 1, 2: 1, 3: 47, 4: 268}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915406024_915406034 17 Left 915406024 1:155660298-155660320 CCCTGGCTCCCCTTCTTTTTGAG 0: 1
1: 1
2: 1
3: 47
4: 268
Right 915406034 1:155660338-155660360 TGGCTTTCGAAACATGGAAGAGG 0: 1
1: 0
2: 1
3: 10
4: 117
915406024_915406038 26 Left 915406024 1:155660298-155660320 CCCTGGCTCCCCTTCTTTTTGAG 0: 1
1: 1
2: 1
3: 47
4: 268
Right 915406038 1:155660347-155660369 AAACATGGAAGAGGCAGGGGAGG 0: 1
1: 0
2: 3
3: 73
4: 797
915406024_915406037 23 Left 915406024 1:155660298-155660320 CCCTGGCTCCCCTTCTTTTTGAG 0: 1
1: 1
2: 1
3: 47
4: 268
Right 915406037 1:155660344-155660366 TCGAAACATGGAAGAGGCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 243
915406024_915406033 11 Left 915406024 1:155660298-155660320 CCCTGGCTCCCCTTCTTTTTGAG 0: 1
1: 1
2: 1
3: 47
4: 268
Right 915406033 1:155660332-155660354 CACATATGGCTTTCGAAACATGG 0: 1
1: 0
2: 0
3: 8
4: 102
915406024_915406039 27 Left 915406024 1:155660298-155660320 CCCTGGCTCCCCTTCTTTTTGAG 0: 1
1: 1
2: 1
3: 47
4: 268
Right 915406039 1:155660348-155660370 AACATGGAAGAGGCAGGGGAGGG 0: 1
1: 0
2: 8
3: 96
4: 965
915406024_915406035 21 Left 915406024 1:155660298-155660320 CCCTGGCTCCCCTTCTTTTTGAG 0: 1
1: 1
2: 1
3: 47
4: 268
Right 915406035 1:155660342-155660364 TTTCGAAACATGGAAGAGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 281
915406024_915406036 22 Left 915406024 1:155660298-155660320 CCCTGGCTCCCCTTCTTTTTGAG 0: 1
1: 1
2: 1
3: 47
4: 268
Right 915406036 1:155660343-155660365 TTCGAAACATGGAAGAGGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 227
915406024_915406031 -3 Left 915406024 1:155660298-155660320 CCCTGGCTCCCCTTCTTTTTGAG 0: 1
1: 1
2: 1
3: 47
4: 268
Right 915406031 1:155660318-155660340 GAGGGTCTCCGTCTCACATATGG 0: 2
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915406024 Original CRISPR CTCAAAAAGAAGGGGAGCCA GGG (reversed) Exonic
900011518 1:114741-114763 CTTAAATAGGAGGGGAGCCATGG - Intergenic
900027621 1:291305-291327 CTTAAATAGGAGGGGAGCCATGG - Intergenic
900041579 1:470747-470769 CTTAAATAGGAGGGGAGCCATGG - Intergenic
900063013 1:705724-705746 CTTAAATAGGAGGGGAGCCATGG - Intergenic
901200453 1:7464196-7464218 CACAAAAATAAGGGAACCCACGG + Intronic
901588061 1:10314998-10315020 CTCAAAAAGCTGGGGAGTCGGGG - Intronic
901651038 1:10743407-10743429 CTCAGAATGAAGGAGAGCCCTGG + Intronic
902351400 1:15858124-15858146 CTCAAAAAGAAAGAGAAACAAGG + Intronic
905930475 1:41783369-41783391 CTCAAAGAGAGGGGGTGGCACGG + Intronic
907367352 1:53973382-53973404 CTTAAAGAGAATGGGAGACAAGG + Intergenic
907581546 1:55576708-55576730 AACAAAAAGAATGGGAGCAAGGG - Intergenic
909799243 1:79784686-79784708 CTCAGATAAAAGGGGAACCAAGG - Intergenic
910346222 1:86241831-86241853 CTGAAAATCAAGGGGAACCACGG + Intergenic
910716971 1:90242985-90243007 CACAAAAGGAAGGGGCACCAGGG - Intergenic
911315608 1:96353143-96353165 CTCAAAGAAAAGGTGAGCTAGGG - Intergenic
911744042 1:101419493-101419515 CTTAAAAAAAAAGGGAGGCAGGG + Intergenic
912387210 1:109277457-109277479 CTGAACAAGAAGGGCAGCCATGG + Intergenic
912522529 1:110255629-110255651 CTCAAAAGCAAGGGTTGCCATGG + Intronic
913332430 1:117678617-117678639 CTCAAGAAGAAGTGGTGCCAGGG - Intergenic
914251332 1:145924344-145924366 CAGACAAGGAAGGGGAGCCATGG + Intergenic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
915419188 1:155766094-155766116 CTCAAAGAGAAGAGGAGTCAAGG - Exonic
916232953 1:162558344-162558366 CTCAGAAAGATGAGGAGCAATGG - Intergenic
917048949 1:170896271-170896293 CTCAAAGAGAAGGAATGCCAGGG + Intergenic
918950113 1:191125994-191126016 CTCAGGAAGATGGGGAGCCTTGG - Intergenic
919939778 1:202278326-202278348 ACCAAGAAGAAGGGGAGTCATGG + Intronic
922259958 1:223930749-223930771 CTTAAATAGGAGGGGAGCCATGG - Intergenic
923110063 1:230883231-230883253 CCCCAAAAGGAGTGGAGCCAGGG - Intergenic
923424814 1:233858505-233858527 CTGAAACTGAAGGGGAGTCATGG - Intergenic
923566450 1:235080006-235080028 CTCTGGAGGAAGGGGAGCCAGGG + Intergenic
923818125 1:237403333-237403355 CTCAGAAACAATGGGAGACATGG + Intronic
924341122 1:243033308-243033330 CTTAAATAGGAGGGGAGCCATGG - Intergenic
1063046019 10:2393111-2393133 CCCACACAGAAGGGGAGCCAAGG - Intergenic
1064285890 10:13990920-13990942 ATCAAAAAGAAAGCCAGCCAAGG + Intronic
1064392619 10:14954679-14954701 CTCAAAAAGGTGGGGGCCCAGGG - Intergenic
1064957041 10:20922776-20922798 ATTAAAAGGAAGGGGAGCAACGG - Intronic
1065239273 10:23688881-23688903 GGCAAAAAGCAGGGAAGCCAGGG + Intergenic
1066120363 10:32280448-32280470 CTCAAAAAAAAGGCCAGGCACGG + Intronic
1066456220 10:35574632-35574654 CTCCTAAAGAAGGGTGGCCATGG + Intergenic
1066735348 10:38472099-38472121 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1067146598 10:43698744-43698766 CTCAGCAAGAAGAGGAGCCTGGG - Intergenic
1067773847 10:49147070-49147092 CTCAAAAAGAAGTTGAGCCTGGG - Intergenic
1069787201 10:70996529-70996551 CTCCAAATGCAGGGGAGCCTGGG - Intergenic
1072833836 10:98690111-98690133 CTCAAAAAGAAGGAACTCCAAGG - Intronic
1073688845 10:105785421-105785443 ATCAGAAAGTAGTGGAGCCAGGG - Intergenic
1074549780 10:114431850-114431872 CTCAAAAAGAAGGGGGGAAATGG - Intronic
1076024461 10:127100533-127100555 CTCAGGAGGAAGGGGAGCCCTGG + Intronic
1076127015 10:127983131-127983153 CTAAAAAAGAGGGCCAGCCAGGG - Intronic
1076453793 10:130575453-130575475 CAGGAAAAGAAGGGGAGACAAGG - Intergenic
1076604453 10:131680422-131680444 CTCAGAGTGAAGGGAAGCCATGG + Intergenic
1076619421 10:131777744-131777766 TTCAAGCAGAAGGGGGGCCAAGG + Intergenic
1076967853 11:106975-106997 CTTAAATAGGAGGGGAGCCATGG - Intergenic
1082722674 11:56697421-56697443 ACCAAAAAGAGGGGGACCCATGG + Intergenic
1082739515 11:56895137-56895159 CTCAAAATGAAGGAGGACCAGGG + Intergenic
1084594522 11:70109070-70109092 CTCAAGAAGGAGGGGAGGAAAGG - Intronic
1086783731 11:90938823-90938845 CTCAAAAAGCAGGAGAGTGAAGG + Intergenic
1086894694 11:92298375-92298397 CTCCAAAGGAATGGGACCCATGG - Intergenic
1087122298 11:94587757-94587779 CTAATAAAGAAGGTGAGACATGG - Intronic
1088063805 11:105690510-105690532 CTTAAAAAGAGGGGGAGAGAGGG + Intronic
1088715754 11:112547917-112547939 GTCAAGAAGAAGAGGGGCCAGGG - Intergenic
1089757074 11:120695090-120695112 CTCTCAAAGAGGGGGAGCCAGGG + Intronic
1090070602 11:123541555-123541577 GTCAACAAGAAAGGGAGCAAAGG - Intronic
1093137954 12:15474380-15474402 TTCAGCAAGAAGGGGAGCCCAGG - Intronic
1095435492 12:42183192-42183214 CTCAAGGAGAAGGAGAGACAGGG - Intronic
1095726339 12:45457107-45457129 CTCAAAAAGAGGGAGAGAGATGG - Intergenic
1096691307 12:53323772-53323794 GTGAAAAAGAAGGGCAGACACGG - Intronic
1096772969 12:53948128-53948150 AAAAAAAAGAAGAGGAGCCAGGG + Intergenic
1096828790 12:54299058-54299080 AAAAAAAAGAAGGGGAGCAAGGG + Intronic
1097293274 12:57937870-57937892 CTCAAAAAAAAGGGGCGGCAGGG - Intergenic
1097837069 12:64283804-64283826 TTCAAACACAAGGTGAGCCAGGG - Intronic
1099288292 12:80743213-80743235 CTCCAAAAGGTGGGGAGGCATGG - Intergenic
1099624904 12:85059102-85059124 GTCAAAAAGAAACTGAGCCATGG - Intronic
1101247811 12:102901621-102901643 TTCAAAAAGAAGGAAAGCCTAGG + Intronic
1101877685 12:108606498-108606520 CTCAGAAAGAAAGGGATGCAGGG - Intergenic
1101999263 12:109546435-109546457 CACAAGCAGAATGGGAGCCAGGG + Intergenic
1102229165 12:111250408-111250430 CTCTAAAACAAGAGGACCCAGGG + Intronic
1102340520 12:112117825-112117847 CTCAAAAAAAAAAGAAGCCAGGG + Intergenic
1102400861 12:112628442-112628464 CTGATTAAGAAGGGGACCCATGG + Intronic
1102976462 12:117210266-117210288 CTCAAAAAGTAGGCCAGGCATGG - Exonic
1105901725 13:24760788-24760810 CTCAAACAGAAAGTGAGCAAAGG + Intergenic
1108464730 13:50703921-50703943 CTTTAAAAAAAGGGAAGCCAGGG + Intronic
1108568947 13:51730447-51730469 CGTAAAGAGAAGGGGATCCAGGG - Intronic
1109718038 13:66242777-66242799 ATCAAGGAGAAGGGCAGCCAGGG - Intergenic
1110800119 13:79684597-79684619 CTGAAAAAGAATGAGATCCAGGG - Intergenic
1111724165 13:91983343-91983365 CTCAAAAAAAAAAGGACCCAAGG + Intronic
1112193616 13:97202960-97202982 CAAAACAAGAAGTGGAGCCAAGG - Intergenic
1112919779 13:104597874-104597896 CTCAGAAAGAAGGAGGGCCAGGG - Intergenic
1113780099 13:112971791-112971813 ATCACATAGAAGGGGGGCCAGGG - Intronic
1113865857 13:113522918-113522940 CTAAAAAAGAAGGCCAGGCACGG - Intronic
1115282121 14:31675910-31675932 ATGAAACAGAAGGGGACCCAAGG - Intronic
1115784314 14:36806999-36807021 AACAAAAAGAAGGGGAGTGAAGG + Intronic
1115989485 14:39137632-39137654 GACAAAAAGAAGGGGAAGCAGGG + Intergenic
1117889229 14:60399798-60399820 CAGACAAGGAAGGGGAGCCATGG - Intronic
1118518419 14:66552813-66552835 GACAAAAAGAAAGGGAGGCAGGG - Intronic
1118827884 14:69400239-69400261 CTTTTAAAGAAGGGGAGCCTTGG + Intronic
1119867357 14:77985098-77985120 CTCAAAAAGAAAGGGAAAGATGG - Intergenic
1120228752 14:81820090-81820112 GGCAAAAAGCAGAGGAGCCAAGG + Intergenic
1120748914 14:88179364-88179386 CACAAAAAGAAGAGGAGAGACGG + Intergenic
1122281763 14:100627648-100627670 CTCAAAGAGAAGAGGAGGCAGGG - Intergenic
1122536886 14:102471245-102471267 CTCAAGAAGAAAGAGAGGCAGGG - Intronic
1125076651 15:35626932-35626954 CTCAAAGAGAAGAGGAGGAATGG - Intergenic
1125142045 15:36419746-36419768 CAGAAAAAGAAGGTGAGTCAAGG + Intergenic
1125782163 15:42279364-42279386 CTCAAAATGCAGGTGGGCCAGGG + Intronic
1125888450 15:43247516-43247538 CTCAAAAAAAAAAGGAGACAAGG + Intronic
1126935249 15:53699880-53699902 CTCAAGGTGAAGGAGAGCCACGG + Exonic
1127540645 15:59935318-59935340 TTCAAAAAGATGGGGTGCCATGG + Intergenic
1127830238 15:62743913-62743935 CTCAGACCAAAGGGGAGCCAGGG - Intronic
1127920471 15:63490492-63490514 CTCAAAAAAAAGGGGAACTCTGG + Intergenic
1130834595 15:87637049-87637071 CTCAGCACTAAGGGGAGCCAAGG + Intergenic
1134488623 16:14678818-14678840 CTGAGAGAGATGGGGAGCCAAGG - Intronic
1135192779 16:20368339-20368361 GTCAAAAAGCATGGGATCCAAGG + Intronic
1135639115 16:24104888-24104910 CTGAAGAACACGGGGAGCCAAGG + Intronic
1135813327 16:25609447-25609469 TTAAAAAAGAAAGGGAGGCATGG + Intergenic
1137328035 16:47461204-47461226 CTAAAAAAGCAGTGGAGCTAGGG + Exonic
1138314463 16:56056913-56056935 CTCTCAAAGAAGGGCAGACACGG + Intergenic
1138884514 16:61060005-61060027 CTGAAAAAGATGAGGAGCTAAGG + Intergenic
1142260668 16:89041169-89041191 CTCAAACAGGAGGGGAGGGAAGG - Intergenic
1142452827 16:90192164-90192186 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1142736105 17:1900783-1900805 CTCAAAAAAAGGGGGAGAAAGGG + Intergenic
1142974990 17:3637937-3637959 CTCCAAAAGCAGGAGACCCAGGG + Intronic
1143869788 17:9949861-9949883 CTAAAAAAGAAAGGGAGGGAGGG - Intronic
1145336435 17:21916788-21916810 CTCAAAAAGAAAGGGCTCGAAGG + Intergenic
1147977398 17:44255569-44255591 CTGAAAAAGAAGGGAAGCTAAGG + Intronic
1148578562 17:48727958-48727980 CTCAGAGACAAGGGGACCCAGGG + Intronic
1148695925 17:49558231-49558253 CTTAAAAAGAAGGCCAGGCATGG - Intergenic
1150186021 17:63182098-63182120 GTCAGGAAGAAGGGGAGGCAGGG - Intronic
1150569413 17:66373056-66373078 CTCAAAAAAGAGGGGAACAAAGG + Intronic
1152252808 17:79220572-79220594 CTCATCAAGCAGGGGACCCAGGG + Intronic
1152995607 18:403576-403598 TTCAAAAAGATAGAGAGCCATGG - Intronic
1153569898 18:6459719-6459741 CTCAAGAAATAGGGCAGCCAAGG - Intergenic
1153719655 18:7888962-7888984 TACAAAAAGGAGGGGAGCAAGGG + Intronic
1155022032 18:21905399-21905421 CTGAAAAAGCAGGGGGGCCGAGG + Intergenic
1155829395 18:30493669-30493691 ATCAAGATGAAAGGGAGCCAGGG - Intergenic
1157712953 18:49862659-49862681 CTCGAAAATAAGCTGAGCCAGGG - Intronic
1158242174 18:55389532-55389554 GGCAAGAAGAAGGGGAGGCAAGG + Intronic
1159291476 18:66428164-66428186 CTCAAAAAAAAGGGAAGAAAGGG - Intergenic
1160098054 18:75893835-75893857 CTCAAGAAAAAGAGGAGTCACGG + Intergenic
1160644658 19:176598-176620 CTTAAATAGGAGGGGAGCCATGG - Intergenic
1163612441 19:18308467-18308489 TTCAAACAGCAGGAGAGCCAAGG + Intronic
1163803615 19:19383262-19383284 CTCAAAAAGAATAGGAGGCTGGG + Intergenic
1165992858 19:39826087-39826109 CTAAAAAAGCAAAGGAGCCATGG + Intronic
925341110 2:3137016-3137038 CTCAAAATGGGTGGGAGCCACGG - Intergenic
926572712 2:14547028-14547050 GTAAAAAAGAAGGGGCTCCAAGG - Intergenic
926920757 2:17937460-17937482 ATCAAGGAGGAGGGGAGCCAAGG - Intronic
927019721 2:19004005-19004027 AGGAAAAAGAAGGGAAGCCATGG - Intergenic
927145499 2:20162819-20162841 CTCAGAAAGAAGGAGACTCACGG + Intergenic
927622198 2:24673441-24673463 CTCCAAAAGAAGAGGTCCCAAGG - Exonic
927717628 2:25362805-25362827 CCGAAGAAGAAGTGGAGCCACGG + Intergenic
928073575 2:28242130-28242152 CCCTAGAAGAAGTGGAGCCAGGG + Intronic
928217507 2:29374318-29374340 CTCAAAAAGGTGGTGAGCGATGG + Intronic
928259168 2:29751067-29751089 CTCAAAAGGAAGGGGAGGAGAGG + Intronic
929409760 2:41684678-41684700 GTCAAAAAGTATGGGAACCACGG + Intergenic
929913017 2:46108199-46108221 CTCAAAAATAAGGCCAGGCATGG - Intronic
929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG + Intergenic
930173547 2:48276943-48276965 CTCAAAGAAAACGTGAGCCAAGG - Intergenic
930722268 2:54648963-54648985 CTGAAAAAGAAAAGGAGCAATGG - Intronic
930835063 2:55784171-55784193 TTAAAGAAGATGGGGAGCCAAGG - Intergenic
932040030 2:68289774-68289796 TTAAAAAAGAAAGGGAGCCTGGG - Intronic
933794132 2:85906405-85906427 CTCAAAAAGAAAGGGAAGGAAGG - Intergenic
934068752 2:88364479-88364501 TTAAAAAAGAAGAGGATCCAAGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
935316775 2:101842660-101842682 CTGAACAGGAAGGAGAGCCAAGG + Exonic
935577212 2:104723416-104723438 CTCATAAAGAAGGGGCCCCTCGG + Intergenic
936233007 2:110720470-110720492 CTCAGAAAGATGTGGAGCCGAGG - Intergenic
936520057 2:113206213-113206235 CACAGAAAGCAGGGAAGCCAGGG - Intronic
937148747 2:119671208-119671230 CTAAAAAGGCAGGAGAGCCAAGG - Intergenic
937944243 2:127317243-127317265 CTTAAAAAGAAGTAGAGACAAGG - Intronic
938601713 2:132849233-132849255 TTCAAAAAGAGGGGGAGCCATGG - Intronic
939260014 2:139795277-139795299 CTCAAAACAAAGGGGATTCAGGG + Intergenic
939994014 2:148903096-148903118 ATCAGAAAGATGGGGAGCCTCGG + Intronic
940774350 2:157871334-157871356 CCCAAAAAGGAGGGGAGTGAGGG + Intronic
946043388 2:216801763-216801785 ATCAGAAAGAAGAGGAGGCAAGG - Intergenic
947020118 2:225665564-225665586 CTCAAAAAAAAAAGGAGCTAGGG - Intergenic
948355242 2:237372504-237372526 ATCAAAGAGAAGGGGAGCAAAGG + Intronic
949084267 2:242136825-242136847 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1168755271 20:312390-312412 CTCAAAAAGGAAGGGAGGGAGGG - Intergenic
1168764339 20:371681-371703 CTCCCAAAGAAGAGGAGACAAGG - Intronic
1168811587 20:708199-708221 CTCAGAAAGTAGTGGTGCCAGGG - Intergenic
1169214889 20:3786998-3787020 CTCAAAAAGAATAAGAACCAGGG + Intronic
1170792250 20:19517770-19517792 CCCTACAAGAAGAGGAGCCAGGG - Intronic
1172293824 20:33793904-33793926 CACATAATGAAGGGGAGTCATGG + Intergenic
1172824145 20:37766120-37766142 ATCATAAAGAAGGGGAAACATGG + Intronic
1173394781 20:42669181-42669203 CTCAAAAAGATGTGGAGAAAGGG - Intronic
1173941387 20:46914043-46914065 CTCAAAACGAAGAGGAGGAACGG - Intronic
1175562895 20:59946885-59946907 CTCACAAAAAAGGGCAGGCAAGG - Exonic
1176280850 20:64309309-64309331 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1176513730 21:7767559-7767581 CTCAAAAAGAAAGAGAGAGAAGG - Intronic
1176926219 21:14752608-14752630 CCCAGCAAGAAGGGGAGCAAAGG + Intergenic
1177901012 21:26915030-26915052 CCCAAGAAGTAGAGGAGCCATGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178647843 21:34398083-34398105 CTCAAAAAGAAAGAGAGAGAAGG - Intronic
1180902023 22:19380546-19380568 CTGAAAAAGAAGATTAGCCAGGG - Intronic
1180954889 22:19737133-19737155 CCCCAAGAGACGGGGAGCCACGG + Intergenic
1181614408 22:24042980-24043002 CTCAAAAGCATGGCGAGCCAGGG - Exonic
1184001869 22:41680658-41680680 CTCAAATGGATGCGGAGCCATGG - Intronic
1184519060 22:44981676-44981698 CTCAGAAAGGAGGGGAGGGAGGG + Intronic
1184579454 22:45404697-45404719 CTGGAAAGGAGGGGGAGCCAGGG - Intronic
949113852 3:295947-295969 CTCAGGAAGAAGGGGCACCAAGG - Intronic
950956584 3:17059865-17059887 GTCAAAAAGAAGGAGAAACATGG + Intronic
953115301 3:39986919-39986941 CCTCAAAAGAAGGGGAGCAAAGG - Intronic
953230893 3:41064031-41064053 GGCAAACAGAATGGGAGCCAGGG + Intergenic
953700029 3:45188229-45188251 CTGAAGAACATGGGGAGCCATGG + Intergenic
954573409 3:51660952-51660974 CTCAAAAAAAGGAGGAGCAATGG - Intronic
954941327 3:54375759-54375781 CAGAAAAAGAATGGGATCCAGGG + Intronic
955522843 3:59791848-59791870 CCCAGAAAGTAGGGGCGCCAAGG + Intronic
956073817 3:65483733-65483755 CTCAACAGGGAGGGTAGCCAGGG + Intronic
956527320 3:70179264-70179286 CTCAAAAAGAAGGGGAACCAAGG - Intergenic
957034793 3:75283783-75283805 CTCAAAGAGAAGTGTAGCCCTGG + Intergenic
958001225 3:87751439-87751461 ATAAAAAAGAAGGGAAGACATGG + Intergenic
958615923 3:96493738-96493760 CTGAAAAGGAAGGGGAGGCAAGG + Intergenic
961304801 3:125951071-125951093 CTCAAACAGAAGTGCAGCCCTGG - Intergenic
961853488 3:129845455-129845477 CTCAAAATGAAGGTGAGGAAAGG + Intronic
961925372 3:130473883-130473905 CTTTAAAGGAAGGGGAACCAGGG - Intronic
962068326 3:132007238-132007260 GTCAAAAAGAAGTGAAGACAGGG - Intronic
963084377 3:141423049-141423071 CCCCAAAAGAAGGGAAGCCAGGG - Intronic
964424955 3:156542607-156542629 TTCTTAAAGAAGGGCAGCCAAGG - Exonic
965153490 3:165013745-165013767 CTCTAAAGGAAGGGGAGAAATGG + Intronic
965426084 3:168524785-168524807 TTCAGAAAGAAAGGGATCCATGG + Intergenic
965515735 3:169619386-169619408 CACAAAAGGAAGGAGAGCCCTGG + Intronic
966535014 3:181022522-181022544 CTCAAAATGAAGGGAAGGGAAGG - Intergenic
966749202 3:183305847-183305869 CTCAAAAAAAAGGGCAACTAAGG + Intronic
968757635 4:2425295-2425317 CTCAGAGAGAAGGGGAGGCCAGG - Intronic
969712812 4:8853851-8853873 CTCAAAAAAAAGGGGGGCGGGGG + Intronic
971656847 4:29358710-29358732 TTCAAAATGAAGGGGAGATAAGG - Intergenic
972569477 4:40297168-40297190 CTCATACAGCAGGGGTGCCAGGG - Intergenic
973588604 4:52417461-52417483 CACAAAAAGCAGGGGAGACAAGG + Intergenic
973893112 4:55387542-55387564 CTCAGAGAGAAGGGGAGCACAGG + Intergenic
974052293 4:56952388-56952410 CTGAGACAGAAGGGGAGGCAGGG - Intergenic
974929858 4:68349750-68349772 CGGAAACCGAAGGGGAGCCATGG - Exonic
975216946 4:71766785-71766807 GGCAAAAAGAAGGGTTGCCAGGG - Intronic
975462354 4:74669158-74669180 CTCATCAAAAAGGGGAGCAAAGG + Intergenic
979103006 4:116646401-116646423 CTCAATAAGAACGGGAACCTTGG + Intergenic
979261702 4:118655063-118655085 CTTAAATAGGAGGGGAGCCATGG + Intergenic
979606591 4:122645001-122645023 CCCAAAAGGAAGGGCAGCCCAGG + Intergenic
980407108 4:132367128-132367150 CTCATCAAGAACTGGAGCCAAGG - Intergenic
983150128 4:164268264-164268286 TTTAAATAGGAGGGGAGCCATGG - Intronic
985017492 4:185651692-185651714 CTCAAACAGAAGGGGAAAAAAGG + Intronic
985804503 5:2032258-2032280 CACAAAAATAAGGGGAGGGAAGG - Intergenic
987259615 5:16190041-16190063 CTCACCCAGAAGGGAAGCCAGGG + Intergenic
988709985 5:33763436-33763458 CTCCAAAAGGAAGGTAGCCATGG + Intronic
989781453 5:45269878-45269900 CGTACAAAGAACGGGAGCCAAGG - Intronic
990407217 5:55503774-55503796 CTCAAAACGAAGGAGAGGAAGGG + Intronic
990914403 5:60888185-60888207 CTCAAAAACAATGTGAGGCATGG + Intronic
996714906 5:126579325-126579347 CTCCAAGAGAAGGTTAGCCAAGG - Intronic
996962060 5:129263058-129263080 CTCAAAGTGAAGGAGAGACAGGG - Intergenic
998773317 5:145570845-145570867 CTCAATAAGATGGGGAGCTTTGG - Intronic
1000260016 5:159578734-159578756 ATCAACCAGATGGGGAGCCATGG + Intergenic
1001743429 5:174071840-174071862 CTCAAATGGAAGGGGATCCCCGG + Intronic
1002732266 5:181348182-181348204 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1002752272 6:125923-125945 CTTAAATAGGAGGGGAGCCATGG - Intergenic
1004435240 6:15586052-15586074 CTCAAAATGGAGGGGAGGGAAGG + Intronic
1004621324 6:17333145-17333167 CTCAAAAAAAAGAAGAGTCAAGG - Intergenic
1006788706 6:36684828-36684850 CTCAAAAAGAAAGGCGGGCAGGG - Intronic
1006939296 6:37741347-37741369 CTCAAAAAAAAGGGGGGCGGGGG + Intergenic
1007347180 6:41240367-41240389 CTCAAAAAAAAGGGGTGGGAAGG - Intergenic
1007797453 6:44361637-44361659 CACAAAAGGAAGGGAAGTCAGGG - Intronic
1010048005 6:71470040-71470062 ATCAAAAGAAAGGGGAGCCTTGG - Intergenic
1011772922 6:90694908-90694930 GGCAATAAGAAGGGGAGCTAGGG - Intergenic
1012160421 6:95878035-95878057 CTCTAACAAAAGGGAAGCCAGGG + Intergenic
1013103426 6:107006648-107006670 TTCAAAAAGAAGGCCAGGCATGG + Intergenic
1013635730 6:112027493-112027515 CTCAACAGGAGGGGCAGCCAGGG + Intergenic
1016037002 6:139393561-139393583 CTACAAAAGAAGAGGAGCAATGG + Intergenic
1016530504 6:145054038-145054060 CTCTAAAAGAAGGGGGGTCTGGG + Intergenic
1016994043 6:149948308-149948330 CTCAAGAAGAAGGGGAAAGAAGG + Intronic
1017004296 6:150019249-150019271 CTCAAGAAGAAGGGGAAAGAAGG - Intronic
1017643027 6:156512856-156512878 TTCCAGGAGAAGGGGAGCCAAGG - Intergenic
1017913774 6:158817494-158817516 CTCTAACAGAAGGTTAGCCATGG - Intronic
1019236518 6:170620497-170620519 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1019848393 7:3528890-3528912 CTCAAAAGCAAGGGGAGAGAAGG - Intronic
1020262817 7:6540112-6540134 CTCAAAAAGAAAGGAAGGGAAGG - Intronic
1021097439 7:16549387-16549409 CTCAAAATCAAAGGGAGCCATGG + Intronic
1023926789 7:44675321-44675343 CTAAGAAAGAAGTGGAGCCAGGG - Intronic
1025094507 7:56087049-56087071 CTCAAGTAGCAGGGGAGCCCAGG + Intronic
1026347166 7:69483924-69483946 CTCAAAAAAAAGGGGGGGGAGGG + Intergenic
1026373664 7:69727852-69727874 CTTAAAAAGAAAGGTAGCTAGGG + Intronic
1026595235 7:71729217-71729239 CTCAAGAAGAAGGGGAACTTGGG - Intergenic
1026863353 7:73808137-73808159 CTCAAAAAAAAAGAGAGACAGGG - Intronic
1028002064 7:85511219-85511241 CTGAATAAAAATGGGAGCCAAGG + Intergenic
1028819623 7:95191275-95191297 CTCAACATGAAGGGGAGAGAGGG + Intronic
1028996451 7:97105410-97105432 CTCAAAAAAAAGAGGAGGCAGGG + Intergenic
1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG + Intronic
1029876962 7:103764545-103764567 CACAAAAAGAAGGCCAGGCATGG + Intronic
1030606468 7:111643784-111643806 CTGAAAAGGGAGGGGAGCCTCGG - Intergenic
1031082028 7:117267701-117267723 TTCAGAAAGTAGGGGAACCAAGG - Intergenic
1032753276 7:134864053-134864075 TTCAAAAAGAAGGGCAGGCTGGG + Intronic
1035511253 8:186111-186133 CTTAAATAGGAGGGGAGCCATGG - Intergenic
1036296092 8:7539068-7539090 CTCAAAAAGAATGTGATGCATGG - Intergenic
1036326474 8:7781951-7781973 CTCAAAAAGAATGTGATGCATGG + Intergenic
1037113737 8:15197711-15197733 CTCAAAAACAGGGGGAGGCAAGG + Intronic
1039147796 8:34468495-34468517 CTCAAGAAGAAAGGGAAACATGG + Intergenic
1043081453 8:75770398-75770420 CTCAAAAAAAAAGGGATGCAGGG + Intergenic
1043451918 8:80376312-80376334 CTCAACTAGAAGGGGACTCATGG + Intergenic
1043707876 8:83376712-83376734 CTCAAAAAGAAGTACAGCAATGG - Intergenic
1045246300 8:100444378-100444400 CTCAAAGAGAAGCGAAGCAAAGG - Intergenic
1049096861 8:140553697-140553719 CTCAAAAAAAAGGCCAGGCATGG - Intronic
1050153014 9:2635922-2635944 CTAGAAAAGAAGGCAAGCCATGG + Intronic
1051434673 9:17018332-17018354 CTCAACAAGAAGGGGTGTTAAGG - Intergenic
1052834450 9:33240240-33240262 CACAACAAGGAGGGCAGCCAAGG - Exonic
1052857738 9:33417543-33417565 ATCAACAAGAAGGGGTTCCATGG - Intergenic
1058070383 9:100595579-100595601 CTGAATAAGAAGGGGACCCATGG + Intergenic
1059153144 9:111967053-111967075 CTCAGAAGGAAGGGGAGGTAGGG + Intergenic
1061263229 9:129491332-129491354 CTCAACAAGCTGGGCAGCCAGGG - Intergenic
1061317339 9:129804556-129804578 CATTAAAAGATGGGGAGCCAAGG + Intronic
1061590415 9:131594250-131594272 CTCAAAGACCAGGTGAGCCAGGG - Intronic
1062756668 9:138300508-138300530 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1187363473 X:18648536-18648558 GTCAAAAAGAAGGGGAGGCTGGG - Intronic
1187797455 X:23019911-23019933 CTCAAACAGAAGGGGAAACAGGG + Intergenic
1187827981 X:23352098-23352120 CTTAAAAAGAGAGAGAGCCATGG + Intronic
1189276530 X:39790514-39790536 CTGAAGATGAAGGGGAGCCAAGG + Intergenic
1192327571 X:70146082-70146104 CTGAAAAAGAAAGGCAGCCAGGG + Intronic
1192741772 X:73900297-73900319 CTCAAAAAAAAGGGGAGAGTGGG + Intergenic
1196276197 X:113768026-113768048 ATCAAAAGGAAGAGGACCCAAGG - Intergenic
1198672719 X:139098724-139098746 CTCCAAAAGTAGGGGAGGAAGGG + Intronic
1198806257 X:140498409-140498431 CTCTAAAAGAAGTGGTGCTAGGG + Intergenic
1201379208 Y:13354395-13354417 CTCAAAAAAAAAGGGAGGCAGGG + Intronic
1202383790 Y:24303527-24303549 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1202486993 Y:25366593-25366615 CTTAAATAGGAGGGGAGCCATGG - Intergenic