ID: 915409518

View in Genome Browser
Species Human (GRCh38)
Location 1:155689222-155689244
Sequence CGGGACTCCGGACCTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 2, 1: 0, 2: 1, 3: 12, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915409509_915409518 11 Left 915409509 1:155689188-155689210 CCGACACGGGTATTGTACCGCTG 0: 2
1: 0
2: 0
3: 0
4: 30
Right 915409518 1:155689222-155689244 CGGGACTCCGGACCTCCAGGAGG 0: 2
1: 0
2: 1
3: 12
4: 84
915409515_915409518 -6 Left 915409515 1:155689205-155689227 CCGCTGAGGGAAAGGAGCGGGAC 0: 2
1: 0
2: 0
3: 10
4: 162
Right 915409518 1:155689222-155689244 CGGGACTCCGGACCTCCAGGAGG 0: 2
1: 0
2: 1
3: 12
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915409518 Original CRISPR CGGGACTCCGGACCTCCAGG AGG Intronic
900346521 1:2213022-2213044 CGGAACTCCGTGCCTCCAGGCGG + Intergenic
901024504 1:6271956-6271978 CGGCACTCCGTGCCTGCAGGAGG - Intronic
901266241 1:7913102-7913124 CGGAACTCCCACCCTCCAGGAGG + Intergenic
906000667 1:42421656-42421678 TGGAACTCGGGACCTCAAGGTGG - Exonic
907264768 1:53250877-53250899 CAGGACACTGGACCTCCAGCAGG + Intronic
910138403 1:83999098-83999120 CGGGACTCCGGTGCTCGACGCGG + Exonic
910590230 1:88922390-88922412 AGGGATTCCCGACCTCCAGGTGG + Intergenic
914377043 1:147080661-147080683 CGCGACCCAGGCCCTCCAGGAGG - Intergenic
914474692 1:148013637-148013659 CGCGACCCAGGCCCTCCAGGAGG + Intergenic
915393395 1:155563377-155563399 CGGGACTCCGGACCTCCAGGAGG + Intergenic
915409518 1:155689222-155689244 CGGGACTCCGGACCTCCAGGAGG + Intronic
921383890 1:214551196-214551218 CGGGACTCCGGGGCGCCACGGGG - Exonic
1063663891 10:8050660-8050682 CGGGGCTCCGGGGCTCCGGGGGG + Intergenic
1066454124 10:35558457-35558479 CGGGACTCTGGACTTCAAGCTGG - Intronic
1073559264 10:104482926-104482948 CGTGCCTCCTGACCCCCAGGTGG - Intergenic
1076536320 10:131179878-131179900 CAGGACTCCAGACCTGCTGGTGG - Intronic
1084030862 11:66479972-66479994 CGGGACTCGGGACCTGGGGGTGG - Intergenic
1084780797 11:71407120-71407142 CGGGACACAGGCCCTCCAAGAGG - Intergenic
1097107654 12:56634908-56634930 AGGGACTCCGGAGCTGGAGGTGG + Intronic
1099635462 12:85206152-85206174 TGGGACTGCTGACTTCCAGGTGG + Intronic
1104960678 12:132487325-132487347 CAGGACTCCGAACCTCCCTGGGG - Intergenic
1108518361 13:51222905-51222927 GGGGGCTCCGGAGCTACAGGAGG - Intronic
1113917734 13:113884295-113884317 CGGGACCCCGGACCTCCCAGAGG - Intergenic
1114413840 14:22525822-22525844 AGGGACTGGGGTCCTCCAGGAGG - Intergenic
1123203608 14:106691724-106691746 AGGCACTCAGGACCACCAGGGGG - Intergenic
1123630468 15:22257251-22257273 CGGGGCTCCGGACCCCGCGGCGG + Intergenic
1135536325 16:23297098-23297120 GGGGCCTCCGGACCTGTAGGTGG + Intronic
1137393071 16:48097606-48097628 GGGGAATGCGGAACTCCAGGGGG - Intronic
1138688808 16:58749095-58749117 CGGGGCTCGGGACCTACAGCGGG + Intergenic
1141665421 16:85463039-85463061 CGGGACCCGGGGCCTCTAGGAGG - Intergenic
1141719249 16:85746550-85746572 CGTGACTCAGGACCTCCATGGGG - Intronic
1141945941 16:87310399-87310421 TGGGACTCCAAACCTCCAGGAGG + Intronic
1141972622 16:87493396-87493418 CGGGGCTCCGGACCCCGCGGCGG - Intergenic
1144481822 17:15636104-15636126 CGGCACTCCTGTACTCCAGGTGG + Exonic
1144779692 17:17801589-17801611 CTGGACTCCAGATCTCCAGGAGG + Intronic
1144916480 17:18727668-18727690 CGGCACTCCTGTACTCCAGGTGG - Exonic
1145165830 17:20612824-20612846 CGGAACTCCGGCTCCCCAGGGGG - Intergenic
1150389469 17:64781924-64781946 CTGGACTCCTGGCCCCCAGGAGG - Intergenic
1150789975 17:68195978-68196000 CTGGACTCCTGGCCTCCAGGAGG + Intergenic
1152283678 17:79400146-79400168 CGGGGCTCTGGAACTCCAGAGGG + Intronic
1152749745 17:82057175-82057197 ACGGACCTCGGACCTCCAGGCGG + Exonic
1156494860 18:37519071-37519093 GGGCTCTCAGGACCTCCAGGTGG - Intronic
1157725165 18:49958597-49958619 GTGGACTGCGGCCCTCCAGGAGG - Intronic
1157907842 18:51585567-51585589 TGGGACTCCAAACCTCCATGAGG + Intergenic
1160103493 18:75946328-75946350 TGGGCCTCCTGGCCTCCAGGTGG - Intergenic
1160663350 19:311741-311763 CGGGGCTCCAGGCCTCCAGTCGG + Intronic
1160805146 19:989393-989415 CTGCACTCAGGACCTGCAGGCGG - Intronic
1161417391 19:4155052-4155074 CGGGACCACAGAGCTCCAGGCGG + Intronic
1162125699 19:8498539-8498561 CAGGCCTCCTGACCTCCAGCGGG + Exonic
1162421601 19:10568805-10568827 CGAGACCCCGGCCCTCCCGGCGG + Exonic
1164527120 19:29020629-29020651 TGGCACACCCGACCTCCAGGAGG - Intergenic
925953635 2:8939308-8939330 CGGGGCTTCGGACCTCCATCGGG - Intronic
926228025 2:10982228-10982250 CCGGACTCCAGACCTGCACGTGG + Intergenic
932104036 2:68926824-68926846 CTGGGCTCTGAACCTCCAGGAGG + Intergenic
932288863 2:70558379-70558401 TGGGACTCAGGGCCACCAGGTGG + Intergenic
934555611 2:95285629-95285651 CGGGCCTCTGGATCTGCAGGTGG - Exonic
936913426 2:117615554-117615576 GGGGACCCTGGACCACCAGGGGG + Intergenic
941110335 2:161414453-161414475 CGAGACTGCGCCCCTCCAGGCGG - Intergenic
943441928 2:187935654-187935676 CAGGACTCCGCATCTGCAGGTGG - Intergenic
947552487 2:231056707-231056729 CGGGACTCCTGACCTCGAGGAGG + Intergenic
947826322 2:233108074-233108096 CGGACCTCCTGTCCTCCAGGAGG + Intronic
1169194030 20:3673884-3673906 CAGGACTCTGGACATTCAGGTGG - Exonic
1170454244 20:16517696-16517718 CAGGACTCCAGACCACCAGTTGG + Intronic
1172037260 20:32018999-32019021 CGCGACCCCGGCCCGCCAGGCGG + Exonic
1174161315 20:48552732-48552754 CAGGCCTCCGGACCTGCAGGCGG + Intergenic
1175914378 20:62418935-62418957 CGGGTCCTTGGACCTCCAGGTGG + Intronic
1176138538 20:63535563-63535585 CTGGACTGTGGACTTCCAGGTGG + Intronic
1178977236 21:37230731-37230753 CGGGGCACCCGTCCTCCAGGTGG + Intronic
1180090954 21:45533635-45533657 CTGGACTCTGGGCCTCCAGCAGG + Intronic
1183739544 22:39662302-39662324 CGGGCCTGCCGCCCTCCAGGCGG - Exonic
1185287070 22:50006394-50006416 CAGGACTCAGGGCCTCCCGGAGG - Intronic
961887108 3:130103597-130103619 AGTTACTCCGGGCCTCCAGGGGG - Intronic
968908710 4:3466061-3466083 CAGGACTCGGGCCCTCCCGGTGG - Intronic
970428153 4:15964265-15964287 CAGGACTCAGGATATCCAGGTGG - Intronic
975689317 4:76949283-76949305 AGGGGCTGCGGACCACCAGGCGG - Intergenic
975973823 4:80072951-80072973 GGGGACTTCAGCCCTCCAGGCGG - Intronic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
1001922338 5:175610424-175610446 GGGGACTCAAGGCCTCCAGGTGG - Intergenic
1002089336 5:176795173-176795195 CGGCACACTGGTCCTCCAGGAGG + Intergenic
1002196302 5:177503494-177503516 CGGGCCTCCGGGTCTCCAGTTGG + Intronic
1002932727 6:1645499-1645521 GAGGGCTCCGGACCTCCAGGAGG - Intronic
1003008965 6:2408843-2408865 CGGGTCTCTGGCTCTCCAGGTGG - Intergenic
1003514336 6:6805660-6805682 CAGGACTCCACACTTCCAGGTGG - Intergenic
1007631636 6:43276100-43276122 TGGGACTCAGGACCTCCGCGAGG - Intronic
1017756364 6:157532510-157532532 TGAGATTCCGGATCTCCAGGGGG + Intronic
1019428070 7:986716-986738 GGGGCCTCCGCGCCTCCAGGAGG - Exonic
1019472609 7:1229587-1229609 CCGGACTCCGGGCCCCCAGCTGG + Intergenic
1034447155 7:151119636-151119658 CTGGAGTCCTGACCTGCAGGTGG - Intronic
1039591959 8:38757089-38757111 AGGGGCTCCGCATCTCCAGGCGG + Intronic
1040889482 8:52302037-52302059 CGGGACTCCGAGCCTGCAGAGGG + Intronic
1044127265 8:88474095-88474117 CAGGACTCTGGACCTCCAGCAGG + Intergenic
1044473704 8:92602014-92602036 CAGGAATCCGGCCCTGCAGGTGG + Intergenic
1049808841 8:144554144-144554166 GGGGGCTGCGGACCTCCAGGAGG + Intronic
1057236764 9:93367210-93367232 CGGGACGCCTGCCTTCCAGGTGG - Intergenic
1057801157 9:98192290-98192312 CGGGAGCCCGGACCTCGAGGCGG + Intronic
1059791137 9:117642889-117642911 CAGGGCTCCGGACCTGCAGCCGG - Intergenic
1061889378 9:133609518-133609540 CGGGACGCGCGACCTCCTGGAGG + Intergenic
1189652391 X:43204026-43204048 GGGGTCTCCTGACCTGCAGGTGG + Intergenic