ID: 915409817

View in Genome Browser
Species Human (GRCh38)
Location 1:155691838-155691860
Sequence CCTACGGGTGGTGCTGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 1, 2: 17, 3: 35, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915409817_915409822 -8 Left 915409817 1:155691838-155691860 CCAGTCTCAGCACCACCCGTAGG 0: 1
1: 1
2: 17
3: 35
4: 181
Right 915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG 0: 1
1: 6
2: 14
3: 17
4: 15
915409817_915409824 -5 Left 915409817 1:155691838-155691860 CCAGTCTCAGCACCACCCGTAGG 0: 1
1: 1
2: 17
3: 35
4: 181
Right 915409824 1:155691856-155691878 GTAGGGTATCCGAAGTCCGGTGG 0: 2
1: 3
2: 19
3: 23
4: 22
915409817_915409826 4 Left 915409817 1:155691838-155691860 CCAGTCTCAGCACCACCCGTAGG 0: 1
1: 1
2: 17
3: 35
4: 181
Right 915409826 1:155691865-155691887 CCGAAGTCCGGTGGCGACAAAGG 0: 2
1: 10
2: 19
3: 21
4: 94
915409817_915409828 20 Left 915409817 1:155691838-155691860 CCAGTCTCAGCACCACCCGTAGG 0: 1
1: 1
2: 17
3: 35
4: 181
Right 915409828 1:155691881-155691903 ACAAAGGAATGAGAAGAGACAGG 0: 23
1: 18
2: 19
3: 67
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915409817 Original CRISPR CCTACGGGTGGTGCTGAGAC TGG (reversed) Intronic
902956985 1:19932169-19932191 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
903276614 1:22226042-22226064 CCCACGGGTGGGGATTAGACAGG - Intergenic
903569075 1:24291104-24291126 CCCACAGGTGGTGATGACACAGG + Intergenic
904001820 1:27343110-27343132 GCTCCAGGTGGGGCTGAGACCGG - Intronic
904242415 1:29156740-29156762 CCTACGGGTGGTGTTGAGGCTGG - Intronic
904653555 1:32025152-32025174 CCTACTGGGGGTGCTGAGGTGGG + Intronic
907431514 1:54414845-54414867 GCTACGCGGGGGGCTGAGACAGG - Intergenic
908221914 1:62015642-62015664 CCTACTGGGGAGGCTGAGACAGG - Intronic
914855288 1:151346247-151346269 CCCCCAGGTGGTGCTGAGGCTGG - Exonic
915074098 1:153294882-153294904 GCTACTCGTGGGGCTGAGACAGG - Intergenic
915409817 1:155691838-155691860 CCTACGGGTGGTGCTGAGACTGG - Intronic
915410621 1:155698987-155699009 CCTACGGATGGTGTTGAGGCTGG - Intronic
921228511 1:213045124-213045146 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
924721421 1:246626566-246626588 GCTACTTGTGGAGCTGAGACAGG - Intronic
1065444757 10:25786876-25786898 GCTACGTGGGATGCTGAGACAGG + Intergenic
1066447453 10:35496584-35496606 ACTTTGGGGGGTGCTGAGACAGG + Intronic
1066654477 10:37685686-37685708 CCTACAGGTGGTGTTGAGTCTGG + Intergenic
1068707201 10:60090204-60090226 GCTACTTGGGGTGCTGAGACAGG + Intronic
1069051945 10:63804147-63804169 CCTACTCGGGATGCTGAGACAGG + Intergenic
1071488999 10:86123287-86123309 CCTACCGGTGATGCTGAGAGTGG + Intronic
1072660930 10:97363127-97363149 CCTACGGGTGGTGCCCAGGAAGG + Intronic
1073009760 10:100349948-100349970 CCTACAGGGGGTGCTGAGGCTGG - Intronic
1073188091 10:101629393-101629415 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1074833014 10:117263159-117263181 CCTCCTGCTGGTGCTGACACAGG - Intronic
1076809636 10:132879851-132879873 CCTGGGGCTGGAGCTGAGACTGG - Intronic
1078489137 11:11753206-11753228 CTTACTTGTGGTCCTGAGACTGG - Intergenic
1081508902 11:43747943-43747965 CCTGCGGGTGGTGTTGAGGCTGG + Intronic
1082063964 11:47883586-47883608 CCTACAGGAGGATCTGAGACAGG + Intergenic
1083662761 11:64259376-64259398 CCGACAGGTGGTGAGGAGACAGG - Intronic
1083784920 11:64939039-64939061 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1087580690 11:100048017-100048039 GCTACTGGGGGTGCTGAGGCAGG + Intronic
1092871554 12:12810298-12810320 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1096492785 12:52022147-52022169 GCTACTGGGGATGCTGAGACAGG + Intergenic
1096783082 12:54001876-54001898 TCTCAGGGTGATGCTGAGACGGG - Intronic
1097899760 12:64860660-64860682 CCCATGGGTGGTTCTGATACAGG + Intronic
1098028972 12:66235162-66235184 ACTGCTGGTGGTGCTGGGACTGG + Intronic
1100424497 12:94471354-94471376 GCTACGGGGGGTGCTGAGGCAGG - Intergenic
1104682879 12:130763356-130763378 GCTACTGGGGGTGCTGAGCCAGG + Intergenic
1104721786 12:131048492-131048514 CCTACGGGAAGCGCTGAGATGGG + Intronic
1105039347 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG + Intergenic
1107695310 13:42993845-42993867 CCAAAGGGTGATCCTGAGACTGG - Intergenic
1108683373 13:52798499-52798521 GCTACTTGGGGTGCTGAGACAGG - Intergenic
1112875518 13:104033553-104033575 CCTACTGGTGAGGCTGAGGCAGG - Intergenic
1114524803 14:23360737-23360759 CCTACGGGTCCTGCAGAGAGAGG - Exonic
1114636299 14:24188739-24188761 CCTACGGGAGCTGCTGCTACCGG - Exonic
1119813148 14:77541138-77541160 GCTACTTGAGGTGCTGAGACAGG - Intronic
1120036807 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG + Intronic
1123444775 15:20320111-20320133 GCTACCCGTGGGGCTGAGACAGG - Intergenic
1128342705 15:66833829-66833851 CCTATGGGGGAGGCTGAGACAGG + Intergenic
1133173008 16:3993250-3993272 CCTCCGGGTGTTGAAGAGACCGG - Intronic
1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1134001778 16:10788505-10788527 CTTACGGGTGGTGTTGAGGCTGG - Intronic
1134381830 16:13734418-13734440 GCTACTGGGGATGCTGAGACAGG + Intergenic
1136750532 16:32631769-32631791 CCTACGTGGGAGGCTGAGACAGG + Intergenic
1137625208 16:49903419-49903441 CCTACAGGTGGTGCAGAAGCTGG - Intergenic
1140786620 16:78348567-78348589 GCTACTGGTGGGGCTGAGGCAGG - Intronic
1141475221 16:84268384-84268406 CCCAGGGATGGTGCTGACACAGG - Intergenic
1141982892 16:87560941-87560963 CCTAGGGGTGGGGCTAGGACCGG + Intergenic
1142002094 16:87669953-87669975 CCCACGGCTGGAGCTGACACAGG - Intronic
1142257005 16:89018904-89018926 CCTACGGGTGCTTCTGGGAAAGG - Intergenic
1203052662 16_KI270728v1_random:890974-890996 CCTACGTGGGAGGCTGAGACAGG + Intergenic
1142578318 17:924346-924368 CCTACGCGGGGGGCTGAGGCAGG - Intronic
1143621446 17:8082817-8082839 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1146443033 17:32913703-32913725 CGTACGGGTGGTGTTGAGGCTGG + Intergenic
1148932799 17:51140721-51140743 GCTACTGGGGGTGCTGAGGCAGG + Intergenic
1149527304 17:57366616-57366638 CCTACGGGTTGTCCTGGAACAGG + Intronic
1150812608 17:68368538-68368560 CCTCCCGCTGGTGCTGAAACAGG - Exonic
1151126775 17:71853865-71853887 CCTACTGGGGATGCTGAGGCAGG - Intergenic
1151328171 17:73391520-73391542 CCCATGGGTGGTCCTGGGACTGG + Exonic
1154001035 18:10482549-10482571 CCTGTAGGTGGTGCTGAGCCAGG + Intronic
1155961095 18:31995525-31995547 GCTACGGGGGAGGCTGAGACAGG + Intergenic
1157850487 18:51044502-51044524 GCTACGCGGGGAGCTGAGACTGG - Intronic
1158144755 18:54299321-54299343 CCTACTGGGGAGGCTGAGACAGG + Intronic
1158463408 18:57667327-57667349 GCTGCGGGTGGTGCTGAGATGGG - Intronic
1159904650 18:74078436-74078458 GCTGCGGCTGGTGCTGAGGCGGG - Intronic
1161051936 19:2168724-2168746 CCTACTGGGGAGGCTGAGACAGG - Intronic
1161159482 19:2753945-2753967 CCTAGGGTTGGGGCTGAGATGGG + Intergenic
1161178561 19:2863834-2863856 CCTACGGGTGATGTTAAGGCTGG + Intergenic
1161898542 19:7100439-7100461 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1162007960 19:7791846-7791868 CCTACGGGTAGTGTTGAGGCTGG - Intergenic
1162009141 19:7801056-7801078 CCCACGGGTAGTGTTGAGGCTGG - Intergenic
1163031993 19:14550790-14550812 GCTACGGGGGAGGCTGAGACAGG - Intronic
1164291827 19:23876587-23876609 CCCACAGGTGGTGTTGAGGCTGG - Intergenic
1165258604 19:34595175-34595197 CCTACGGGTAGTGTTGAGGCTGG - Exonic
1165312603 19:35038019-35038041 CCTGCGGGAGGAGCTGAGACAGG - Intronic
1165350399 19:35272061-35272083 CCTAAAGGTGGTGATGGGACTGG + Intronic
1165360033 19:35330674-35330696 GCTTGGGTTGGTGCTGAGACCGG + Intronic
1165556430 19:36636552-36636574 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
1166045659 19:40228871-40228893 GCTACTGGTGAGGCTGAGACAGG + Intergenic
1166424728 19:42667565-42667587 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1166849051 19:45749258-45749280 GCTACTTGTGGGGCTGAGACAGG + Intronic
1166897214 19:46031436-46031458 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1167327774 19:48835950-48835972 CCTATGGGTGATCATGAGACTGG - Intronic
1167881883 19:52465934-52465956 CCTAAGGGTGGTGTTGAGGCTGG - Intronic
1167893999 19:52566275-52566297 GCTACTTGGGGTGCTGAGACAGG - Intronic
1168494293 19:56837303-56837325 GCTGCGGGTGGTCCTGAGAGGGG - Intronic
1168524526 19:57078146-57078168 CCTACTTGGGGGGCTGAGACAGG + Intergenic
925145232 2:1578300-1578322 CCTAATGGTGGTGGTGAGAGAGG - Intergenic
925292714 2:2758467-2758489 CTTAGAGGTGGAGCTGAGACTGG + Intergenic
926847491 2:17158458-17158480 CCTCCAGGTGGTGCAGAAACTGG - Intergenic
928281550 2:29950745-29950767 CCAACGGGAGGTGCAGACACAGG - Intergenic
930659098 2:54036204-54036226 GCTACGTGTGGAGCTGAGGCAGG - Intronic
933300952 2:80540483-80540505 GCTACTGGTGAGGCTGAGACAGG + Intronic
933835965 2:86245724-86245746 CCTATGGGTGGTGTTGAGGCTGG + Intronic
935524254 2:104146108-104146130 GCTACTGGGGGTGCTGAGGCGGG - Intergenic
939919630 2:148093027-148093049 CCTACGCGAGAGGCTGAGACAGG - Intronic
941016838 2:160367335-160367357 ACTGCTGGTGGTGCTGGGACTGG + Exonic
942115676 2:172726716-172726738 GGAACAGGTGGTGCTGAGACAGG + Intergenic
945728389 2:213502235-213502257 GCTACGGGGGAGGCTGAGACAGG - Intronic
946351301 2:219155811-219155833 GCTACGGGGGGCGCTGAGGCAGG + Intronic
948402016 2:237691769-237691791 CCTGCGGGTGGAGCTGCGGCCGG + Intronic
948822381 2:240556716-240556738 TCTACGGGTGGTGTTGAGGCTGG + Intronic
1170571542 20:17635509-17635531 CCTTGGGGAGGTGCTGAGGCAGG + Intronic
1170770104 20:19325332-19325354 GCTACTGGTGGGGCTGAGGCAGG + Intronic
1174318545 20:49721981-49722003 CCTACTCGGGGGGCTGAGACAGG + Intergenic
1179241102 21:39593419-39593441 CCTACACGGGATGCTGAGACAGG - Intronic
1179466749 21:41580988-41581010 CCTCCGGGAGATGCTGAGCCAGG + Intergenic
1179775414 21:43658894-43658916 CCCCCGGGTGGAGTTGAGACTGG - Intronic
1180011344 21:45053574-45053596 CCTGAGGGAGGTGCTGAGAAGGG + Intergenic
1181174436 22:21027747-21027769 GCCAGGGGTGGGGCTGAGACTGG + Exonic
1181353202 22:22276075-22276097 GCTACTTGTGGGGCTGAGACAGG + Intergenic
1182344938 22:29656048-29656070 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1183229252 22:36570649-36570671 GCTACTGGGGGTGCTGAGGCAGG + Intronic
1184548339 22:45189254-45189276 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
950298717 3:11855352-11855374 CCTACGGGGGAGGCTGAGGCAGG - Intergenic
950543136 3:13624226-13624248 CCTCCCGGTAGTGCTGTGACTGG - Intronic
954357572 3:50095087-50095109 ACTTGGGGAGGTGCTGAGACAGG + Intronic
954670005 3:52285697-52285719 GCTACTGGTGGGGCTGAGGCAGG - Intronic
954690542 3:52393237-52393259 CCTACGGCTGCTGGGGAGACTGG + Intronic
959012114 3:101089627-101089649 CCTACGGGTGGTATTAAGGCTGG + Intergenic
960889427 3:122431913-122431935 GCTACTTGTGGGGCTGAGACTGG - Intronic
961140890 3:124555071-124555093 CCTACAGGTGGGGCTAAAACAGG - Intronic
961712032 3:128835142-128835164 CCTGTGGGTGGTGTTGAGGCTGG + Intergenic
962201427 3:133403813-133403835 CCTCTGGGTGGGGGTGAGACAGG - Intronic
965432047 3:168601091-168601113 CCTAAACGTTGTGCTGAGACAGG - Intergenic
965765708 3:172128089-172128111 CCTACGGGTTGTGTTGAGCAAGG + Intronic
967997771 3:195179846-195179868 CCTAAGTGTGGTGTTGAGCCAGG + Intronic
968576491 4:1368694-1368716 CCTACGGGTGAGGCTTAGCCGGG - Intronic
969052713 4:4384865-4384887 CCTACAGGTGGGCCTGAGAGAGG - Intronic
969322028 4:6418134-6418156 CCTACAGACGGTGCTGGGACAGG + Intronic
969647642 4:8441738-8441760 CCTACGGGTGGTGTTGAGGCTGG - Intronic
969869694 4:10096941-10096963 CCGTGGGGTTGTGCTGAGACTGG + Intronic
970407645 4:15778766-15778788 CCGCCGGGTGGTGCTGAGTAGGG + Intronic
971454150 4:26828196-26828218 CCTAAGGGTGGTGATCAGAATGG - Intergenic
972510024 4:39760063-39760085 GCTACTCGTGGGGCTGAGACAGG + Intronic
973888998 4:55350872-55350894 GCTACTGGGGGTGCTGAGGCAGG - Intronic
975125317 4:70775824-70775846 GCTACTTGTGGGGCTGAGACAGG + Intronic
975278554 4:72532970-72532992 CCTAAGTGTGGTGCTTACACAGG - Intronic
975624826 4:76335689-76335711 GCTACTGGGGGTGCTGAGGCAGG - Intronic
980420056 4:132547292-132547314 TCTAATGGTGGTCCTGAGACTGG - Intergenic
981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
982979338 4:162112352-162112374 CCTACTGGGGAGGCTGAGACAGG - Intronic
984244357 4:177257446-177257468 GCTACTGGGGGTGCTGAGGCAGG - Intergenic
986672326 5:10153308-10153330 GCTACTGGGGGTGCTGAGGCAGG + Intergenic
988956706 5:36327393-36327415 CCTAAGTGTGGAGCAGAGACTGG + Intergenic
990308803 5:54518582-54518604 CCGACGGGTGGTGCTGCGGGGGG - Exonic
991944194 5:71883715-71883737 TTTACGGGTGGGGCTGAGCCAGG + Intergenic
992586447 5:78245032-78245054 CCTATGGGTGGTTTTGAGGCTGG - Intronic
995946577 5:117654763-117654785 GCTACTTGTGGTGCTGAGATGGG - Intergenic
998433701 5:142088769-142088791 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1000047905 5:157536514-157536536 CCTACTGGGGAGGCTGAGACAGG + Intronic
1000498217 5:162012761-162012783 GCTACTGGGGGAGCTGAGACAGG + Intergenic
1002867551 6:1135940-1135962 CAGAAGGGTGATGCTGAGACAGG - Intergenic
1004138215 6:12989585-12989607 CCTACAGGCAGTGTTGAGACTGG - Intronic
1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG + Intergenic
1005576676 6:27196248-27196270 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1005721680 6:28608415-28608437 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1005907490 6:30276909-30276931 GATACGGGTGGACCTGAGACAGG - Intergenic
1006150552 6:31984701-31984723 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006151109 6:31990514-31990536 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006156853 6:32017439-32017461 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006157410 6:32023252-32023274 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006223246 6:32513354-32513376 TCCACGGGTGGTGTTGAGGCTGG + Intergenic
1007226447 6:40318616-40318638 CCTACTGATGGTGCTGTGCCAGG - Intergenic
1009593841 6:65709140-65709162 GCTACTGGGGGTGCTGAGGCAGG - Intergenic
1009938409 6:70260434-70260456 TCTACTCGTGATGCTGAGACAGG + Intronic
1012178444 6:96120380-96120402 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG + Intergenic
1014526204 6:122504854-122504876 CCTACGGATGGTGTTGAGGCTGG - Intronic
1014588355 6:123229795-123229817 CCTACCATTGGTGCTGAGGCTGG - Intronic
1015479822 6:133696196-133696218 CCTACAGGTGGCGATGAGAAAGG - Intergenic
1017279386 6:152607094-152607116 CCTACTGGGGGGGCTGAGGCAGG - Intronic
1017839872 6:158212617-158212639 GCTACTTGTGGGGCTGAGACGGG + Intergenic
1020089541 7:5331080-5331102 CCTATGGATGGTGCTTACACTGG + Intronic
1022380044 7:29851197-29851219 CCTCAGGAGGGTGCTGAGACTGG + Intronic
1026573436 7:71552550-71552572 GCTACGAGGGGGGCTGAGACAGG - Intronic
1027176119 7:75904779-75904801 CCTCCAGGTGATGCTGATACAGG - Intronic
1028719677 7:94014547-94014569 GCTACTGGCGGGGCTGAGACAGG - Intergenic
1029271323 7:99378569-99378591 CCTACTGGGGAGGCTGAGACAGG + Intronic
1032018591 7:128394439-128394461 CCTTCGGTGAGTGCTGAGACTGG - Exonic
1032496814 7:132368933-132368955 CCTTCAGGTGGTGCTGACAGCGG - Intronic
1034075657 7:148228714-148228736 GCTACTGGGGATGCTGAGACAGG + Intronic
1034635877 7:152566797-152566819 CCTACTGGGGAGGCTGAGACGGG - Intergenic
1035556975 8:574626-574648 CCCATGGGTGGTGCAGAGGCAGG + Intergenic
1037340431 8:17838988-17839010 CCTACGAGGGGCGCTGAGGCAGG - Intergenic
1037945164 8:22985099-22985121 CCTATGGGTGGTGTTGAGACTGG - Intronic
1040348351 8:46534223-46534245 CCTACAGGTGGTGTTGAGGCTGG + Intergenic
1040580248 8:48693004-48693026 ACTACTGGTGAGGCTGAGACAGG + Intergenic
1042313674 8:67402669-67402691 GCTACTGGTGAGGCTGAGACAGG - Intergenic
1042927419 8:73980198-73980220 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1043622100 8:82206745-82206767 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1047005713 8:120617941-120617963 CCTAAGGGTGTTGCTAAGAAAGG + Intronic
1047267857 8:123325205-123325227 CCTACTGGGGAGGCTGAGACAGG - Intronic
1048136511 8:131751589-131751611 GCTACTTGTGGGGCTGAGACAGG + Intergenic
1049103800 8:140598626-140598648 CCTCCTGGTGGGGCTCAGACAGG - Intronic
1051379151 9:16437184-16437206 CCTAGCAGTGGTGCTGAGACAGG + Exonic
1052993970 9:34539831-34539853 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1053242764 9:36509885-36509907 CCTACTGGGGAGGCTGAGACAGG - Intergenic
1054183218 9:61928796-61928818 CCTACTGGGGAGGCTGAGACAGG - Intergenic
1054470139 9:65529186-65529208 CCTACTGGGGAGGCTGAGACAGG + Intergenic
1054655288 9:67659678-67659700 CCTACTGGGGAGGCTGAGACAGG + Intergenic
1056593403 9:87984155-87984177 CCTACGGGTGGTGTTGGGGTTGG - Intergenic
1057116047 9:92523413-92523435 CCTATGGGTGGTGTTGAGGCTGG - Intronic
1057157657 9:92857867-92857889 GCTACTTGTGGGGCTGAGACAGG - Intronic
1057275697 9:93675016-93675038 CCAACAGGTAGTGCTGGGACAGG + Exonic
1058857045 9:109072601-109072623 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1060237600 9:121876879-121876901 CCTGCGGGTGATTCTGATACGGG + Intronic
1061194763 9:129101803-129101825 CCTACAGGTGGAGTTGAGGCTGG + Intronic
1061671655 9:132192176-132192198 CATGGGGGTGGGGCTGAGACTGG - Intronic
1061926210 9:133807290-133807312 CCTGCGGCTGGTGCTGAGCCCGG - Exonic
1062257238 9:135632777-135632799 GCTACTGGGGGTGCTGAGGCAGG - Intronic
1062538047 9:137029421-137029443 CCCACGGGTGGTGCTGACCAGGG - Intronic
1188811301 X:34656906-34656928 CCTGGGGGCGGTGCTGAGCCCGG - Exonic
1189448476 X:41104176-41104198 ACTACTGGGAGTGCTGAGACAGG - Intronic
1189688700 X:43592972-43592994 CCTAGGGGTGGAAGTGAGACAGG - Intergenic
1190186621 X:48240221-48240243 GCTACTAGTGGTGCTGAGGCAGG - Intronic
1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG + Intergenic
1190732492 X:53234736-53234758 CCCACAGGTGGGGCTGAGGCGGG + Exonic
1193595433 X:83439384-83439406 CCTGCTGGTGGTGGGGAGACAGG - Intergenic
1195272952 X:103251099-103251121 CCAGAGGGTGGTGCTCAGACAGG - Intergenic
1195295211 X:103469881-103469903 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1198712302 X:139518272-139518294 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1201377090 Y:13334271-13334293 CCCACGGGTGGTGATGAGGCTGG + Intronic
1201668936 Y:16493271-16493293 CCTACGGATGGTGTTGAGGCTGG + Intergenic