ID: 915409822

View in Genome Browser
Species Human (GRCh38)
Location 1:155691853-155691875
Sequence CCCGTAGGGTATCCGAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 6, 2: 14, 3: 17, 4: 15}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915409817_915409822 -8 Left 915409817 1:155691838-155691860 CCAGTCTCAGCACCACCCGTAGG 0: 1
1: 1
2: 17
3: 35
4: 181
Right 915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG 0: 1
1: 6
2: 14
3: 17
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915409822 Original CRISPR CCCGTAGGGTATCCGAAGTC CGG Intronic