ID: 915409822 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:155691853-155691875 |
Sequence | CCCGTAGGGTATCCGAAGTC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 53 | |||
Summary | {0: 1, 1: 6, 2: 14, 3: 17, 4: 15} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
915409817_915409822 | -8 | Left | 915409817 | 1:155691838-155691860 | CCAGTCTCAGCACCACCCGTAGG | 0: 1 1: 1 2: 17 3: 35 4: 181 |
||
Right | 915409822 | 1:155691853-155691875 | CCCGTAGGGTATCCGAAGTCCGG | 0: 1 1: 6 2: 14 3: 17 4: 15 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
915409822 | Original CRISPR | CCCGTAGGGTATCCGAAGTC CGG | Intronic | ||