ID: 915410626

View in Genome Browser
Species Human (GRCh38)
Location 1:155699002-155699024
Sequence TCCGTAGGGTACCTGAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 2, 2: 10, 3: 19, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915410621_915410626 -8 Left 915410621 1:155698987-155699009 CCAGCCTCAACACCATCCGTAGG 0: 3
1: 16
2: 23
3: 18
4: 96
Right 915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG 0: 1
1: 2
2: 10
3: 19
4: 53
915410620_915410626 7 Left 915410620 1:155698972-155698994 CCAGAATGTAGGGGACCAGCCTC 0: 1
1: 3
2: 3
3: 8
4: 84
Right 915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG 0: 1
1: 2
2: 10
3: 19
4: 53
915410616_915410626 21 Left 915410616 1:155698958-155698980 CCTCATGTTGGGCACCAGAATGT 0: 1
1: 1
2: 3
3: 17
4: 135
Right 915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG 0: 1
1: 2
2: 10
3: 19
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915410626 Original CRISPR TCCGTAGGGTACCTGAAGTC CGG Intronic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
905927694 1:41763492-41763514 GCTGTAGGGGACATGAAGTCAGG - Intronic
912384723 1:109265620-109265642 TCCTGAGGGGACCTGAGGTCGGG + Intronic
913943474 1:125133343-125133365 TGGGTAGAGCACCTGAAGTCAGG + Intergenic
915381782 1:155448250-155448272 TCTGTAGCATAACTGAAGTCAGG + Intronic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
915779830 1:158535100-158535122 CCCGTAGGGTATCCGAAGTTTGG - Intergenic
918002415 1:180509824-180509846 TCAGTAGCATAACTGAAGTCAGG + Intergenic
920954182 1:210602478-210602500 TGCGTGCGCTACCTGAAGTCAGG + Intronic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
1063522125 10:6750650-6750672 ACCCTAGAGAACCTGAAGTCAGG + Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1069727185 10:70587844-70587866 TGGGTAGATTACCTGAAGTCAGG - Intergenic
1075012984 10:118890824-118890846 TCTCTAGGGTACCCGAAGTGAGG - Intergenic
1081141647 11:39508685-39508707 TCATGAGGGTACCTGAAGTATGG - Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1100279468 12:93104546-93104568 TCCCTAGTGAATCTGAAGTCAGG - Intergenic
1101765663 12:107696771-107696793 TCCTTAGCCTACCTGAAGTCTGG - Intronic
1101800791 12:108020257-108020279 TCCCTAAGGTGCCTGAAGCCAGG + Intergenic
1102692075 12:114769291-114769313 GCGGGAGGGTACCTGAGGTCAGG - Intergenic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1113175009 13:107554127-107554149 TACGTAGGGTTCCTGATGTATGG + Intronic
1117253865 14:53958757-53958779 TTAGCATGGTACCTGAAGTCAGG + Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1128991932 15:72267977-72267999 CCGGTAGGTCACCTGAAGTCGGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1135061887 16:19278007-19278029 TCTGTAGGCTAACTCAAGTCTGG + Intergenic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1150952437 17:69818775-69818797 TCGGTAAGGTATCTGGAGTCAGG - Intergenic
1155159714 18:23185608-23185630 TCCTTAGGGTACCTGAAGGAGGG + Intronic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1162009144 19:7801070-7801092 ACCCGTGGGTACCTGAAGTCCGG + Intergenic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
930107106 2:47648947-47648969 TCCCTAAGATACCTGGAGTCAGG - Intergenic
933835959 2:86245709-86245731 CCCATAGGGTAGCTGAAGTCCGG - Intronic
942153312 2:173100671-173100693 TCTGTAGGGTTCCTGATGTCTGG + Intronic
944415844 2:199478933-199478955 TGGGTGGGTTACCTGAAGTCGGG + Intergenic
1169032900 20:2425576-2425598 TCTTAAAGGTACCTGAAGTCAGG + Intronic
1172694485 20:36812819-36812841 TCCGGCAGGTCCCTGAAGTCAGG + Exonic
1178779348 21:35586837-35586859 TCCCTGGAGTATCTGAAGTCAGG - Intronic
1182756374 22:32682949-32682971 TGCATAGGGCACCTGAAGCCAGG + Intronic
1183100264 22:35579436-35579458 TCCGTTGGGTTCCTGATGCCCGG + Intergenic
1183723759 22:39577261-39577283 TGCGCAGATTACCTGAAGTCAGG - Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
956691320 3:71880412-71880434 TGGGTAGATTACCTGAAGTCAGG + Intergenic
962485018 3:135833923-135833945 TCCTTAAAGTAGCTGAAGTCGGG + Intergenic
966446140 3:180003122-180003144 TCAATAGGGTATTTGAAGTCAGG - Intronic
967529402 3:190531777-190531799 TCCCTAGGGCACATGAAATCGGG + Intronic
969076067 4:4578709-4578731 TCCTCAGGGAACCAGAAGTCTGG + Intergenic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
975859361 4:78659799-78659821 TCAGTAGGTTACTGGAAGTCAGG + Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
985634910 5:1031141-1031163 TCCCTGGGGTTCCTGGAGTCTGG - Intronic
988863852 5:35313398-35313420 TCTGTGGGATAGCTGAAGTCAGG + Intergenic
992462686 5:76976495-76976517 TACATTGGGTTCCTGAAGTCTGG - Intronic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
996742601 5:126814764-126814786 TAGGCAGAGTACCTGAAGTCAGG - Intronic
1001575939 5:172763831-172763853 TCCCCAGGGTTCCTGAAGGCTGG - Intergenic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1016489199 6:144577973-144577995 TGCGTAGGTCACCTGAGGTCAGG + Intronic
1019192934 6:170264039-170264061 TCCGCACGGTCCCTGCAGTCTGG + Intergenic
1020862173 7:13507631-13507653 TCAGTAGGGTAACTGAATCCAGG - Intergenic
1021093369 7:16508710-16508732 GCAGTAGATTACCTGAAGTCAGG + Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1058857039 9:109072586-109072608 CCCGTAGGGTACCTGAAGTTCGG - Intronic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1193364022 X:80608867-80608889 TCTGTAGGGTACCTGTGGTGTGG - Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic