ID: 915411756

View in Genome Browser
Species Human (GRCh38)
Location 1:155706473-155706495
Sequence TGGGTTGTGAAAGGTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915411756 Original CRISPR TGGGTTGTGAAAGGTGTGTC TGG Intronic
902224219 1:14986564-14986586 AGGGCTGTGAAAGGAGTGTGTGG + Intronic
903004273 1:20288408-20288430 TGAGATGTGAATGGTGTGTGTGG - Intergenic
903125378 1:21244143-21244165 TGGGTTGGGGAAGCTGTGCCAGG + Intronic
903128978 1:21266132-21266154 TGGGGTATGATAGGGGTGTCTGG + Intronic
903868776 1:26417304-26417326 AGGTTGGTGAAAGGGGTGTCTGG - Intronic
904504633 1:30940689-30940711 CAGGTTGTGAAAGGTGTCTTAGG - Intronic
906124431 1:43418753-43418775 TGGGTCGAGAAAGGAGGGTCAGG + Intronic
908525817 1:64986456-64986478 TTGGTTGAAAAAGGTGTCTCTGG - Intergenic
909925496 1:81433074-81433096 TGGGATGGGAAAGGAGTGACCGG - Intronic
909928218 1:81463502-81463524 TGGGTTTTCAAAGATGTCTCTGG - Intronic
912185680 1:107273185-107273207 GGGGTCCTGAAAGGTGTGGCAGG + Intronic
912943699 1:114067387-114067409 TGGGCAATGACAGGTGTGTCTGG + Intergenic
913117631 1:115711483-115711505 TGGGTTGGGCAAAGTGTGTAGGG + Intronic
914233305 1:145785085-145785107 TGGGTCCTGAAAGGTGGGTAGGG - Intronic
915265562 1:154714364-154714386 TGGTTTGTGTGAGGTGTGTGTGG + Intronic
915265580 1:154714483-154714505 TGGTTTGTGTGAGGTGTGTGTGG + Intronic
915411756 1:155706473-155706495 TGGGTTGTGAAAGGTGTGTCTGG + Intronic
916293727 1:163193793-163193815 TGGGATGAGAAGGGTATGTCAGG - Intronic
917145438 1:171885631-171885653 TGGGGTGTCAAAGATGTGACAGG + Intronic
924026398 1:239837500-239837522 TGGGTTGCAAAATGTCTGTCAGG - Intronic
1066522953 10:36243194-36243216 GGGGTGGGGAAAGGTGTGTTGGG + Intergenic
1074130739 10:110571682-110571704 TGGGTTGAGAAAGGTGAATCTGG + Intronic
1074387978 10:113032192-113032214 TTGGTTGTGAGAGGAGGGTCTGG + Intronic
1075762389 10:124866520-124866542 TGCGTTCTGAAAGGTGTGCAGGG + Intergenic
1076643308 10:131933732-131933754 CGGGTTGGGAAGGGAGTGTCTGG - Intronic
1076810125 10:132882126-132882148 TGGGGTGTGAGTGGTGTGTGTGG + Intronic
1076810131 10:132882153-132882175 TGGGGTGTGAGTGGTGTGTGTGG + Intronic
1077450585 11:2640828-2640850 AAGGCTGTGAAAGGTATGTCTGG - Intronic
1077605092 11:3604350-3604372 AGGGTGATGAAAGGTCTGTCTGG - Intergenic
1080373585 11:31681264-31681286 TGCGTTGTGAATGGGGTTTCTGG + Intronic
1082228595 11:49738046-49738068 TGGGTTATAAAAGGTTTGTAAGG - Intergenic
1083884011 11:65562183-65562205 TAGGTTTTGAAAGGTGACTCCGG - Intergenic
1085356506 11:75842885-75842907 GGAGTTGTGAAAGTTGTGTGTGG + Intronic
1085553320 11:77395724-77395746 TGGTTTGCCAAAGGTGGGTCAGG - Intronic
1089013353 11:115147755-115147777 TGGGGTGTGAAGTGTGTGTGGGG + Intergenic
1089556293 11:119317350-119317372 GGGGTAGTGACAGGTGTCTCGGG + Intronic
1089715159 11:120352630-120352652 TGGGTGGGGAAAGGGGTGTGTGG + Intronic
1091345471 11:134850229-134850251 TGGGCTGTGAATGGTGTTTTGGG + Intergenic
1095589212 12:43885092-43885114 TGGGATGGGATAGGTGTCTCGGG - Intronic
1096424845 12:51492402-51492424 TGAGGTGGGAAAGGGGTGTCAGG - Intronic
1098530553 12:71537037-71537059 TGGGTTATGCAATGTTTGTCAGG + Intronic
1098831803 12:75373237-75373259 TGGGTGATGACAGGGGTGTCTGG + Intronic
1100782588 12:98045168-98045190 TGGGTTGGGGAAGGTGTGAGTGG - Intergenic
1102033481 12:109758092-109758114 TGGGGTGTGGAAGGTGCGTGTGG + Intronic
1102583624 12:113908088-113908110 TGGGTTGAGTGAGGTGTGTGGGG - Intronic
1104728264 12:131091049-131091071 GGGGTGGTGAAGGGTGGGTCTGG - Intronic
1106865886 13:33963555-33963577 TGAGTAGGGAAAGGTGTGTCTGG - Intronic
1110147491 13:72209414-72209436 TTGGGTGTGAAAGGTGTAACTGG - Intergenic
1111240782 13:85472067-85472089 TGGGTTTTAAAAGGGGTGTGTGG + Intergenic
1113883021 13:113638975-113638997 TGAGATGTAACAGGTGTGTCGGG + Intronic
1119481266 14:74959768-74959790 TGGGTTGGGGCAGGTGTTTCAGG - Intergenic
1120919796 14:89744510-89744532 TGGGTGATGACAGGTGTGGCTGG - Intergenic
1121985690 14:98503297-98503319 TGGGCTGTCAAAGCTGAGTCAGG - Intergenic
1122392466 14:101399688-101399710 TGGGTTCTGAAAGGTCAGGCGGG - Intergenic
1122765898 14:104069691-104069713 TGGGCTTTGAAAGAAGTGTCGGG + Intergenic
1124884147 15:33669008-33669030 TGGTTTTTAAAAGGTGTATCTGG + Intronic
1125403435 15:39328552-39328574 TGAGTTTTGAAAGGTCTGTGTGG + Intergenic
1128781600 15:70362222-70362244 TGGGTGGTGGAAGGTGGGTGGGG + Intergenic
1128799987 15:70491134-70491156 TGGGTTGTGAAAGGTGCGGAGGG + Intergenic
1129516245 15:76159372-76159394 TGGCTGGTGAAAGGTGGGGCGGG + Intronic
1130182317 15:81643129-81643151 GGGATTGTGAAAGGTGATTCTGG - Intergenic
1132292255 15:100712028-100712050 GGGGCTCTGAAAGGGGTGTCTGG - Intergenic
1134057512 16:11179952-11179974 TGGGCTGTGAGTGCTGTGTCTGG - Exonic
1138158704 16:54731896-54731918 TGGGATGAAAAAGGTGTTTCAGG - Intergenic
1138537607 16:57668172-57668194 TGGGTTGTGAAAGGTGAGTGTGG - Exonic
1140779163 16:78278012-78278034 TGGGGTGTGAACGGTGTGAGTGG + Intronic
1141364791 16:83432641-83432663 TGGGTGGAGAAAGGTGTAGCCGG + Intronic
1143336743 17:6177111-6177133 CCAGTTGTGAAAGGGGTGTCTGG + Intergenic
1143493931 17:7300074-7300096 TGGGTTGTGGAAGCTGTGGCAGG - Intergenic
1144025443 17:11272618-11272640 TGGTTTCTCTAAGGTGTGTCTGG + Intronic
1144211008 17:13015735-13015757 TTGCTTTTGAAAGATGTGTCAGG + Intronic
1144891331 17:18495955-18495977 TGGCTTGGGGAAGGGGTGTCAGG + Intergenic
1145140892 17:20448362-20448384 TGGCTTGGGGAAGGGGTGTCAGG - Intergenic
1148018275 17:44537742-44537764 CAGGTTGTTAAAAGTGTGTCTGG + Intergenic
1150287363 17:63961808-63961830 GGGGTTTAGAGAGGTGTGTCCGG - Intronic
1156729473 18:40173819-40173841 TGGGTGGAGAAAGGCATGTCAGG + Intergenic
1161041432 19:2112773-2112795 TGGGTGGCGGAAGCTGTGTCCGG + Intronic
1161762910 19:6187570-6187592 TGGGTGGTGACAGAGGTGTCTGG + Intronic
1162498317 19:11035770-11035792 TGGGCTGGGAAAGTTGGGTCGGG - Intronic
1166339183 19:42127344-42127366 TGGGTTCTGAAGGATGAGTCCGG - Intronic
1167649948 19:50723699-50723721 TGGGTGGTGAACTGTGGGTCTGG + Intronic
1168584027 19:57578494-57578516 TGGGCTGTGGAGGGTGTGGCAGG - Intronic
1168599859 19:57708895-57708917 TGGGTGGGGGAAGGTGTGTGAGG + Intronic
925280061 2:2677653-2677675 TGGGTGATGACAGGGGTGTCTGG - Intergenic
929967108 2:46543658-46543680 TGGGTTGGGAGAGGAGGGTCCGG + Intronic
931390556 2:61839668-61839690 TGTGTTCTGAGAGGTGTTTCTGG + Exonic
932412445 2:71555340-71555362 TGGGTGGGGAGGGGTGTGTCGGG + Intronic
933374922 2:81467241-81467263 TGGGTGGCGGCAGGTGTGTCGGG - Intergenic
943151537 2:184120167-184120189 TGGGTTGTATAAGCTCTGTCTGG + Intergenic
943480502 2:188411480-188411502 TGGGTGATGAAAGGGGTGGCTGG + Intronic
943633030 2:190275633-190275655 TGAGTTGTGAAAAGTTTGTGAGG + Intronic
943749618 2:191497523-191497545 TGGGATGGGAAAGCTGTGGCTGG + Intergenic
948036209 2:234860118-234860140 TGGGTTGTAAAAGGTAAGTCAGG + Intergenic
948484372 2:238271203-238271225 TGGGCTCTGAAAGGTGAGGCAGG + Intronic
1169679454 20:8194295-8194317 TGGCATGTGAAAAGTGTTTCTGG + Intronic
1171968421 20:31548260-31548282 TGGAATGTGAAAGGAGTGTCTGG + Intronic
1172221512 20:33277444-33277466 TGGGTTTTGGAAAGAGTGTCTGG - Intronic
1174384572 20:50179467-50179489 TGGGTTGGGGAAGGTGGGTTGGG + Intergenic
1175283029 20:57817804-57817826 TGGTTTATGAAAGGTTTGTGGGG - Intergenic
1175384515 20:58585535-58585557 TGGGTTGTGCAGGGGCTGTCAGG + Intergenic
1178063202 21:28874590-28874612 TGGGTGATGACAGGTGTGGCTGG + Exonic
1179769560 21:43604293-43604315 TGGTTTGTGCATGGTGTGTGTGG - Intronic
1179769581 21:43604533-43604555 TGGGGTGTGTATGGTGTGTGTGG - Intronic
1181084792 22:20434862-20434884 TGGGGTCTGAAGGGTGTGGCAGG - Intronic
1182989446 22:34753087-34753109 CTGGTTGTGCAAGGTGAGTCTGG + Intergenic
1184784077 22:46663402-46663424 TGGCTTGTGACAGTTGTGTGGGG + Intronic
1185040815 22:48503283-48503305 TGAGTTGTGAAAAGTCTGGCTGG + Intronic
1185053846 22:48567747-48567769 TGGGCTGTGGAAGGGGTGGCTGG + Intronic
1185403197 22:50629037-50629059 TGTGGTGTGGAATGTGTGTCTGG + Intergenic
951364093 3:21759314-21759336 GGGATTGTGAATGATGTGTCTGG + Intronic
963466020 3:145684551-145684573 TGCGTTGCGAAGGGTGGGTCCGG - Intergenic
965765758 3:172128482-172128504 TGGGGTCTCAAAGGTGTGTGTGG + Intronic
968602674 4:1517744-1517766 AGGGCTGTGAACGGTCTGTCTGG + Intergenic
968682185 4:1928939-1928961 TGGGTTGGGAGGGGTGTGGCAGG + Intronic
970063433 4:12062879-12062901 TGTCTTGTGAAAGGTCCGTCAGG - Intergenic
972607005 4:40622909-40622931 TGGGTTAAGAAAGGAGTGTGCGG + Intronic
972743304 4:41909506-41909528 TGGGGAGTGAAGGTTGTGTCTGG + Intergenic
985791322 5:1929116-1929138 TGCGTTGTGTATGGTGTGTGTGG + Intergenic
987258963 5:16184440-16184462 TGGGTTGGGAGTGGTGTGTGAGG - Intergenic
987419151 5:17697996-17698018 GGGAATGTGAAAGGTGTGTTTGG - Intergenic
987472652 5:18351869-18351891 TGGGTTATGACAGGGGTGGCTGG - Intergenic
989486279 5:41995568-41995590 TGGGTGATGACAGGGGTGTCTGG + Intergenic
994276067 5:97839326-97839348 TGTGTTATGAAAGGTATTTCAGG + Intergenic
996401035 5:123062772-123062794 AGTGTAGTGAAAGGTGAGTCAGG + Intergenic
998830436 5:146152241-146152263 AGTGTTGGGAAAGGTGTGTGTGG - Intronic
1001071087 5:168585730-168585752 TGGGCTTTGAAGGGTGTGTAGGG - Intergenic
1001829560 5:174774112-174774134 TGGGTGGGGAAGGGTGTGGCAGG - Intergenic
1002624897 5:180519251-180519273 TTGGTAGAGAAAGCTGTGTCAGG + Intronic
1003426833 6:6003399-6003421 TGGGTTGTTAAGGGTGTCTGGGG - Intronic
1005115599 6:22332098-22332120 TGGGATGTGGAAGGTGAATCTGG + Intergenic
1005385028 6:25278081-25278103 TGGGTTTAGAAAAGTGTTTCAGG + Intergenic
1006084893 6:31588680-31588702 TGGGTTGAGGAAGGTGTCTGGGG - Exonic
1007093421 6:39198921-39198943 GGTGTTGTGGAAGGTATGTCTGG + Intronic
1007348136 6:41248525-41248547 TGGGGTGTGCAAGGTGACTCAGG - Intergenic
1008131053 6:47720502-47720524 AGGGTTGAGACAGGTCTGTCAGG + Intronic
1010196576 6:73245752-73245774 TGGGTGGTGGGGGGTGTGTCTGG - Intronic
1010375539 6:75164785-75164807 TGGCTGGTGAAAGATGTGTCAGG - Intronic
1016147223 6:140691922-140691944 TGGGTGATGACAGGGGTGTCTGG + Intergenic
1018167820 6:161116092-161116114 TTGGATGTGAAAGGTGAGTGAGG + Intronic
1021399528 7:20193896-20193918 TGGCTTCTTAAAGGTGTGTGTGG - Intronic
1022225430 7:28357908-28357930 TGGGTGGTGTAAGGTGGGTGGGG + Intronic
1023602890 7:41897975-41897997 TGGGTTGAGAAGGCTGTGTCAGG + Intergenic
1023731783 7:43198579-43198601 TGGGGTGTGTATGGTGTGTGTGG - Intronic
1024239704 7:47424770-47424792 TGGGGTTGGAAAGGTGTCTCAGG + Intronic
1025761916 7:64403559-64403581 TTGTTTGTGATAGGTGTGTGGGG + Intergenic
1026916083 7:74121104-74121126 TGGGTGGGGAACGGTGGGTCTGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028350899 7:89846529-89846551 TGGTTTGAGAAAGGTATTTCAGG + Intergenic
1029073879 7:97920945-97920967 TGGGTTTTGTAAGCTGTGTAAGG + Intergenic
1031450754 7:121915122-121915144 TGAGATGAGAAAGCTGTGTCAGG + Intronic
1032345121 7:131109878-131109900 TGGGCTGGGAAAGGAGTGTGTGG + Intergenic
1032450651 7:132027622-132027644 TGGGTTATTAAAGGTGGGTTGGG + Intergenic
1037912331 8:22751116-22751138 TGGGTTGTGAAATCTGTCCCAGG + Intronic
1037951050 8:23019010-23019032 TGGGTGGTGAAATCTGAGTCGGG - Intronic
1038068411 8:23986932-23986954 TGGGTGATGACAGGTGTGTGAGG + Intergenic
1040582747 8:48710632-48710654 TGGATTATGGTAGGTGTGTCAGG - Intergenic
1043057265 8:75454431-75454453 TGGGCATTGAATGGTGTGTCTGG + Intronic
1046123499 8:109875010-109875032 TTGGTTGTGGTATGTGTGTCAGG + Intergenic
1047927281 8:129693849-129693871 TGGTTTGTGAAAGGTGGGCAGGG - Intergenic
1048528391 8:135225384-135225406 AGAGTTGTGAAATGTGTGCCTGG + Intergenic
1049413981 8:142487159-142487181 TGGGCTGTGGCAGGTGTGCCCGG - Intronic
1050260427 9:3835724-3835746 TAGGGTGTGAACTGTGTGTCAGG - Intronic
1051897481 9:22003731-22003753 TGGGTTTTTATAGGTGTGTTGGG + Exonic
1053160020 9:35807471-35807493 TGGGGTGGGTAAGGTGTGTGGGG - Intronic
1055111736 9:72566591-72566613 TGCGTTGTGAAAGGTGAAACAGG + Intronic
1055511220 9:76997542-76997564 TGGGTTTTGACAAGTGTGTGTGG - Intergenic
1055692284 9:78845835-78845857 TGGCTTTTGAATGGTATGTCTGG - Intergenic
1056753963 9:89371090-89371112 TGGGGTGTATAAGGTGTGTGTGG + Intronic
1056753980 9:89371158-89371180 TGGGGTGTATAAGGTGTGTGTGG + Intronic
1056754029 9:89371368-89371390 TGGGGTGTGGCATGTGTGTCTGG + Intronic
1057217276 9:93236069-93236091 TGGGTACTGGAAGGAGTGTCAGG + Intronic
1187243662 X:17535261-17535283 TGGGGTGTGATAGGTGGATCAGG + Intronic
1188690984 X:33128858-33128880 TGTATTTTTAAAGGTGTGTCTGG - Intronic
1190037429 X:47038883-47038905 TGGTTTGTGAAAGGTACTTCTGG + Intronic
1192363964 X:70455645-70455667 TGGGTGGAGAAATGGGTGTCGGG - Intronic
1194297534 X:92144455-92144477 TGAGATCTGATAGGTGTGTCAGG + Intronic
1195068904 X:101261096-101261118 TGGGGTGGGGAAGGTGTCTCGGG - Exonic