ID: 915414084

View in Genome Browser
Species Human (GRCh38)
Location 1:155726586-155726608
Sequence TAGGAAAGTAAAGCTGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 431}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915414084_915414090 23 Left 915414084 1:155726586-155726608 CCGGCCTCAGCTTTACTTTCCTA 0: 1
1: 0
2: 3
3: 42
4: 431
Right 915414090 1:155726632-155726654 AAAGCCTTTGCCAGTCACGATGG 0: 2
1: 0
2: 2
3: 16
4: 188
915414084_915414089 -1 Left 915414084 1:155726586-155726608 CCGGCCTCAGCTTTACTTTCCTA 0: 1
1: 0
2: 3
3: 42
4: 431
Right 915414089 1:155726608-155726630 AACAGGGATCTGATAGCTAAAGG 0: 1
1: 1
2: 1
3: 12
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915414084 Original CRISPR TAGGAAAGTAAAGCTGAGGC CGG (reversed) Intronic
900308710 1:2023352-2023374 TGGCACAGTCAAGCTGAGGCCGG - Intronic
900506718 1:3032959-3032981 GAGAAAAGCAAAACTGAGGCTGG + Intergenic
901578699 1:10222347-10222369 TGGGCAAGGAAAGCTGAGACAGG + Intronic
901861308 1:12076394-12076416 TTGGAGAATAAAACTGAGGCCGG - Intronic
902721159 1:18305092-18305114 TGGGAAAGTAAGGCTGAGAGAGG + Intronic
903053475 1:20618763-20618785 AAGGAAAGGAAAGGTGGGGCAGG - Exonic
903200752 1:21736158-21736180 TAGGAAGGGAAGGCTGAGGCAGG + Intronic
903791028 1:25893169-25893191 TATTAAAACAAAGCTGAGGCTGG - Intronic
903841561 1:26245401-26245423 TAGGAAAGGCAAGAGGAGGCAGG - Intronic
904510789 1:31005489-31005511 TAAAAAAATAAAGCTGATGCTGG - Intronic
904893269 1:33795081-33795103 TAGCAAGGTCAAGGTGAGGCGGG + Intronic
905233935 1:36532584-36532606 TAGCAAATTAAACCTGAGGAGGG + Intergenic
905461714 1:38126576-38126598 CAGGGAAGTAGAGCTGGGGCTGG + Intergenic
905768004 1:40619210-40619232 TAGGAAAGTCATTGTGAGGCAGG + Intergenic
905994634 1:42370875-42370897 TAGCTAAGTGAAGCTAAGGCTGG + Intergenic
906397290 1:45477374-45477396 CAGGAAAGTAAATTTCAGGCAGG + Intronic
906617612 1:47244802-47244824 TAGGAAAGAAAAGAGGAGCCGGG - Intergenic
907106272 1:51885536-51885558 TTTAAAAGTAAGGCTGAGGCTGG - Intergenic
907357111 1:53885340-53885362 TAGAAAAGTATAACTGAAGCTGG + Intronic
907491648 1:54812355-54812377 TAGGTAGGGAAAACTGAGGCTGG + Intronic
908621047 1:65979906-65979928 TAGGAGATTAAAGCTGAGGAAGG + Intronic
909225269 1:73012314-73012336 TAGTAAGGTAAAGTTGAGGTAGG + Intergenic
910116595 1:83738635-83738657 TTGGAAAGTTAGGTTGAGGCTGG - Intergenic
910300452 1:85701051-85701073 AAGTAAAGTAATGCTGAAGCAGG - Intronic
910407449 1:86904295-86904317 GAGGAAATTAAAGCTTAGGGAGG - Intronic
912581092 1:110721616-110721638 CAGGAAAATTAAGTTGAGGCAGG - Intergenic
913118866 1:115721310-115721332 AAAGAATGTCAAGCTGAGGCAGG - Intronic
913575668 1:120171944-120171966 TAAGAAAGGCAAGATGAGGCTGG + Intronic
914557982 1:148787514-148787536 TAAGAAAGGCAAGATGAGGCTGG + Intergenic
914614852 1:149342716-149342738 TAAGAAAGGCAAGATGAGGCTGG - Intergenic
915002659 1:152607709-152607731 TAGGAAACTAAGCCTGAGCCAGG - Intergenic
915414084 1:155726586-155726608 TAGGAAAGTAAAGCTGAGGCCGG - Intronic
917213075 1:172649800-172649822 TAGGCAAGTAAAGATCAGGAAGG - Intergenic
917369848 1:174280727-174280749 TGGGAAAGTAAACTAGAGGCTGG + Intronic
918252645 1:182717287-182717309 GAGAAAACTAAGGCTGAGGCCGG + Intergenic
919606513 1:199690598-199690620 TAGAAAACTAAAGCTCAGGGAGG + Intergenic
919677301 1:200396171-200396193 TAGGAAAGTGAATCTGGGGGAGG - Intergenic
919705956 1:200676144-200676166 TAGCAAAGGAAGGCTCAGGCAGG + Intergenic
919933389 1:202236061-202236083 AGGGAAGGGAAAGCTGAGGCAGG - Intronic
920080980 1:203372797-203372819 TAGGAAAGTAAGAAAGAGGCAGG + Intergenic
920309415 1:205040023-205040045 CAGGAAAGGAGAGGTGAGGCGGG + Intergenic
920443650 1:205999187-205999209 TAGGAAGGGAAAGCTGGGGCAGG + Intronic
922452446 1:225747849-225747871 TAGAAAAGTAAGGGTCAGGCAGG - Intergenic
923159815 1:231306357-231306379 TAGGAAAGTAAGGCAGAAGGTGG - Intergenic
923207601 1:231773964-231773986 TGGGAATGTAAGGATGAGGCTGG + Intronic
924387962 1:243518016-243518038 CAGGAAATTAAAGCTGACACTGG + Intronic
1062813819 10:484784-484806 AACGAAAGTAAAACAGAGGCCGG + Intronic
1064066718 10:12188427-12188449 TAGGAAAGTGGCGGTGAGGCCGG + Intronic
1064284268 10:13978821-13978843 TGGGAAAGTACAGGAGAGGCAGG + Intronic
1064902883 10:20313713-20313735 TAGGAAGTTAAAGCTGGGGGTGG - Intergenic
1065487776 10:26251192-26251214 TAGAAAAAGAAAGATGAGGCTGG - Intronic
1065528251 10:26643696-26643718 TAGGAAAGCAAACTAGAGGCAGG - Intergenic
1069679736 10:70275412-70275434 GGGGAAAGTAAAGGGGAGGCAGG + Intronic
1071087851 10:81884162-81884184 TAGGTAAGTAAGACTGAGGTGGG - Intronic
1071278939 10:84081890-84081912 AAGAAAAGAAAAGCTGATGCTGG + Intergenic
1071342437 10:84661281-84661303 CAGGTAGGGAAAGCTGAGGCTGG - Intergenic
1071761050 10:88607545-88607567 TAGGTAACTAGATCTGAGGCTGG + Intergenic
1074512810 10:114133284-114133306 AAGGAAAGAAGAGCTGAGGATGG + Intronic
1075413359 10:122245381-122245403 GAGGAAAGGAAACCTGAGGCAGG + Intronic
1075503815 10:123003489-123003511 TAGGAAACTAAGGCTGAGAGAGG - Intronic
1075651667 10:124131539-124131561 GAGGAAATCAAAGCTGAAGCAGG - Intergenic
1075893275 10:125972687-125972709 TATGAAAGTAAAGAAGATGCAGG + Intronic
1076564185 10:131386899-131386921 GTGGAAAGAAAAGCTGAGGGAGG + Intergenic
1078183653 11:9032919-9032941 GTGGGAAATAAAGCTGAGGCTGG + Intronic
1078567672 11:12430996-12431018 AAGGAAAATAAGGCTGAGGGTGG - Intronic
1078632725 11:13018064-13018086 TAAGAAAGTTAGGCTGGGGCCGG - Intergenic
1078806304 11:14708602-14708624 TAGTACAGTAAATCTGATGCAGG + Intronic
1079713373 11:23714551-23714573 AAGGAAACTAAAGCTCAGGCAGG - Intergenic
1080466359 11:32501176-32501198 TTGGAAAGTACAGATTAGGCTGG + Intergenic
1080597222 11:33784105-33784127 AAGGAAGGAAAAGATGAGGCAGG - Intergenic
1081865127 11:46355532-46355554 CAGGAAACTGAGGCTGAGGCAGG + Intronic
1082006036 11:47419561-47419583 AAGAAAAGTGAGGCTGAGGCCGG + Intronic
1082868749 11:57923760-57923782 CAACAAAGAAAAGCTGAGGCTGG + Intergenic
1084309186 11:68306430-68306452 TAGAAAAGAAAAGCAGAGGCTGG - Intergenic
1084600102 11:70140231-70140253 TAAGAAAGTAAAGGAGTGGCCGG + Intronic
1085085624 11:73664603-73664625 GAGAAAATTAAGGCTGAGGCTGG - Intergenic
1086406820 11:86505700-86505722 TAGGAAAGCAAAGCTCAGAGAGG + Intronic
1086414739 11:86577253-86577275 CAGAAAAGCAAAGCTGAGGAGGG + Intronic
1086856540 11:91872457-91872479 TAAGAAAGCAAAGTGGAGGCAGG - Intergenic
1087079100 11:94152642-94152664 TAGGATCGTAAGGCTCAGGCAGG - Intronic
1087095498 11:94313772-94313794 TGGGAGAGTAAATCTGAGGATGG - Intergenic
1087993416 11:104774078-104774100 AAGGAAAGTAAGGCTGAGGCCGG - Intergenic
1088050144 11:105503373-105503395 TATGAAAGAATAGCTGAGACTGG + Intergenic
1088447266 11:109945472-109945494 TAGGGAAGCAAAGTTGAGGGTGG - Intergenic
1088538494 11:110887343-110887365 GAGGAAAGCAAAGCTTAGGGAGG - Intergenic
1089171011 11:116511500-116511522 TAGGAAAGTAAATATGACTCTGG + Intergenic
1089574233 11:119430274-119430296 CAGCAAAGCAAAGCAGAGGCAGG + Intergenic
1089775052 11:120830218-120830240 TAGGAGAGGGAAGCTGATGCTGG - Intronic
1089793186 11:120958921-120958943 TAGGGCAGAAGAGCTGAGGCAGG + Intronic
1090704361 11:129323074-129323096 CTGGAAAGTAGAGATGAGGCAGG + Intergenic
1090929417 11:131281987-131282009 TATGAAAGAATACCTGAGGCTGG + Intergenic
1092004817 12:5060448-5060470 TTGGGAAGTCAAGTTGAGGCAGG + Intergenic
1092751782 12:11725958-11725980 TAGGAAGGAATATCTGAGGCTGG - Intronic
1094077709 12:26496510-26496532 TAGGAAAGCAAGGTTCAGGCTGG - Intronic
1095366316 12:41410708-41410730 GAGGAAATTAAGGCTGAGACAGG - Intronic
1096066171 12:48742566-48742588 TATAAAAATGAAGCTGAGGCCGG - Intergenic
1096725711 12:53560216-53560238 TAAAAAAGTAAAGAGGAGGCCGG - Intronic
1097103027 12:56602839-56602861 TGCGAAAGAAAAGCTGACGCTGG + Exonic
1097484184 12:60173317-60173339 TAAGAAAATAAAACTGAGGTTGG + Intergenic
1098931152 12:76415548-76415570 TAAGAAATTAAATCAGAGGCTGG - Intronic
1099196104 12:79617921-79617943 GAGGAAAGCAAAGCGGAAGCAGG - Intronic
1100473677 12:94916315-94916337 TAGGAAAATGAGGCTGAGACTGG - Intronic
1101010694 12:100446239-100446261 TTTGAAAATAAAGTTGAGGCTGG + Intergenic
1101827930 12:108235142-108235164 TAGGAAATTAAAGCTCAGAGAGG - Intronic
1101891999 12:108725479-108725501 GAGGAAAGTGAAGCTCAGGGAGG + Intronic
1102081174 12:110099284-110099306 CAGGAAACTAAAGCTCAGACAGG - Intergenic
1102312887 12:111860910-111860932 TAGGCAAGTGAGGCCGAGGCAGG + Intronic
1102975132 12:117201413-117201435 AGGGAAAGGAAAGCTAAGGCCGG - Intergenic
1103088458 12:118080294-118080316 TAGGAATGCAAAAGTGAGGCTGG - Intronic
1104409066 12:128543047-128543069 AAGGAAAGTGAAATTGAGGCTGG + Intronic
1104525016 12:129513055-129513077 TAGAAAAGAATATCTGAGGCTGG + Intronic
1104666629 12:130652025-130652047 TAACAAGATAAAGCTGAGGCAGG - Intronic
1104904123 12:132204470-132204492 TAGGACAGAAAGGCCGAGGCAGG + Intronic
1106295898 13:28413296-28413318 GAGGAAGGAAAAGCAGAGGCTGG - Intronic
1106360884 13:29029581-29029603 TATGAAAGAATACCTGAGGCTGG + Intronic
1106456168 13:29929243-29929265 TAGGGAAGTCAGGCTAAGGCAGG - Intergenic
1106526537 13:30545805-30545827 CAGGAAGTTGAAGCTGAGGCAGG - Intronic
1107716267 13:43202473-43202495 TAGCAATGTAAAGCTGATACAGG + Intergenic
1109092853 13:58070620-58070642 GAGGAAAGTCAAGAAGAGGCAGG - Intergenic
1110045209 13:70819351-70819373 AAAGAAAGAAAGGCTGAGGCGGG + Intergenic
1110990745 13:82039483-82039505 TAGGAAAGAAAACTGGAGGCCGG - Intergenic
1112561280 13:100516999-100517021 TAGGAGTGGAAAGCTCAGGCTGG - Intronic
1112614934 13:100994593-100994615 TAGAAAAGAACAGATGAGGCTGG + Intergenic
1112893564 13:104269381-104269403 TATGAAAGAATACCTGAGGCTGG - Intergenic
1114453275 14:22839856-22839878 TAAGAAAGCAAAGCTGGAGCAGG + Intronic
1114546153 14:23503041-23503063 TAGAAATGTTAAGCTAAGGCTGG - Intronic
1115250280 14:31338602-31338624 TATGAAAGTAAAGATCAGTCTGG + Intronic
1115618585 14:35119743-35119765 TAGGAAAGAAAGGAGGAGGCTGG + Intronic
1116453146 14:45086623-45086645 TTGGAAAGTTAAGTTGAGACTGG + Intronic
1116539930 14:46089493-46089515 TACGAAGGAATAGCTGAGGCTGG + Intergenic
1116827150 14:49683701-49683723 AAGGAAAGGAAAAATGAGGCAGG + Intronic
1116927647 14:50656736-50656758 TCAGAAAGTACAGCTGGGGCCGG - Intronic
1117669695 14:58094031-58094053 TAAGAAACTTAAGCTGTGGCTGG + Intronic
1117907529 14:60605862-60605884 GTGGAAAGTAAAGGTGAGGTTGG + Intergenic
1117908207 14:60611894-60611916 GTGGAAAGTAAAGGTGAGGTTGG - Intergenic
1118045624 14:61967962-61967984 TAAGAAAGTGGAGATGAGGCTGG + Intergenic
1118718577 14:68577671-68577693 TAGAAAAATAAAGCAGGGGCTGG - Intronic
1118848106 14:69563342-69563364 TAGAAATGAAAAGCTCAGGCTGG - Intergenic
1119068812 14:71559362-71559384 ACAAAAAGTAAAGCTGAGGCTGG - Intronic
1119391216 14:74292383-74292405 AAGAAAAGAAAATCTGAGGCAGG + Intronic
1121065836 14:90963922-90963944 AGGGAAAGACAAGCTGAGGCTGG + Intronic
1121089679 14:91172373-91172395 TATGAAAATAAAATTGAGGCTGG - Intronic
1121248105 14:92478101-92478123 TAAGAAAGTGAGGCTGGGGCTGG - Intronic
1121814718 14:96920454-96920476 TAGGAAGGTGGAGCTGGGGCTGG + Intronic
1121926477 14:97931727-97931749 ATGGAATGTAAAGCTGAGGAGGG + Intronic
1122552857 14:102559438-102559460 TAGGAATTTAAAGCTGAAGGAGG - Intergenic
1122615577 14:103015696-103015718 CAGGAAATTAAAGAAGAGGCTGG + Intronic
1123155983 14:106226451-106226473 TAGGAAAGAGTACCTGAGGCTGG + Intergenic
1123682824 15:22774938-22774960 TAGGAAAGTAAAAAGTAGGCAGG + Intronic
1125156267 15:36589969-36589991 GAGGAAAGAAAAGGTGAAGCAGG - Intronic
1125165165 15:36695520-36695542 AAGGAAAGTAAAGTTCAGGGAGG - Intronic
1125170905 15:36765350-36765372 TATGAAAATTAAGCTCAGGCTGG - Intronic
1125910568 15:43434962-43434984 TAAGAAAGTAAATTTTAGGCTGG + Intronic
1126037280 15:44558415-44558437 TAACAAGGTGAAGCTGAGGCAGG + Intronic
1126115681 15:45205349-45205371 TAGTAGTGAAAAGCTGAGGCTGG + Intergenic
1126690090 15:51282261-51282283 TTGGGAAAAAAAGCTGAGGCAGG + Intronic
1126906349 15:53372037-53372059 TAGGAAAGTAAGGCTCAGAGAGG - Intergenic
1127417817 15:58774184-58774206 TAGAAATGCAAAGATGAGGCCGG + Intronic
1128160011 15:65417374-65417396 TAGGCAGGTCAAGCTGAGCCTGG - Intronic
1129002745 15:72347676-72347698 TAATAAAGTAAAGGTGAGCCGGG - Exonic
1129228102 15:74181465-74181487 TGGGAGAAGAAAGCTGAGGCAGG + Intronic
1130183884 15:81659965-81659987 TAGGAAAATGAAGCTGAGAGTGG - Intergenic
1130188187 15:81705840-81705862 TAGGAAAATGAAGCTGAGAGTGG - Intergenic
1130812377 15:87393564-87393586 TATGAAAGAACACCTGAGGCCGG + Intergenic
1131025470 15:89137858-89137880 TGGGGAGGTAAGGCTGAGGCTGG - Intronic
1131806218 15:96125484-96125506 AAGAAAAGAAAAGCTGAGCCAGG - Intergenic
1133177469 16:4026126-4026148 TATGAAACTAAAGTAGAGGCTGG + Intronic
1135725467 16:24850684-24850706 GAGGAAAACAAAGCTGAGGCCGG - Intronic
1135892184 16:26367198-26367220 AAGAAAAGAAGAGCTGAGGCTGG + Intergenic
1136922632 16:34345033-34345055 TAGGGAAGAAAAGATGGGGCTGG - Intergenic
1136981941 16:35066773-35066795 TAGGGAAGAAAAGATGGGGCTGG + Intergenic
1137249008 16:46729539-46729561 AAGGAAAGGAATCCTGAGGCTGG + Intronic
1137272620 16:46912299-46912321 GAGGAAGGTACAGCTGAGGAGGG - Intronic
1139271133 16:65683441-65683463 TGTGTATGTAAAGCTGAGGCAGG - Intergenic
1139743517 16:69055736-69055758 TTGAAAAGTAAAGCTGAGCCAGG + Intronic
1140303183 16:73777782-73777804 AAGGAAAGTGAGGCTCAGGCAGG + Intergenic
1140603944 16:76511911-76511933 GAGGAAAATAAAGTTGAGGCAGG + Intronic
1140783057 16:78314108-78314130 TAAGAAAGTACAGGAGAGGCCGG + Intronic
1142166826 16:88595514-88595536 TATGAAAGTAAGGCTGGGGACGG + Intronic
1142791482 17:2269805-2269827 TAGAAAACTAAAGCTCAGCCAGG + Intronic
1142921341 17:3189824-3189846 TTGGAAAATAAACCTGAGGGGGG + Intergenic
1143317979 17:6047216-6047238 GAGGAAAGTAAAGCTCAGACAGG + Intronic
1143318585 17:6052697-6052719 TTGGAAAGTAAATTTGGGGCAGG + Intronic
1143570175 17:7753153-7753175 TCGGAAAGTAAGGCCGAGGAAGG + Intronic
1143959151 17:10700056-10700078 AAGGAAAGTTAAGTTGGGGCAGG - Intronic
1143998200 17:11027457-11027479 TAGGAAATTAAGGCTCAGGGAGG - Intergenic
1144114738 17:12077004-12077026 TAGGAAAGTCATTCTGAGGCAGG + Intronic
1144319435 17:14099783-14099805 TATGAAACTAAAGCTCAGGAGGG - Intronic
1144538740 17:16117314-16117336 GAGGAAAGATAAGCTGGGGCAGG + Intronic
1145876436 17:28321721-28321743 TAAAAAAATAAAGCTGACGCTGG - Intronic
1148982984 17:51595351-51595373 TACGTAAGGAAGGCTGAGGCAGG + Intergenic
1150155162 17:62847058-62847080 TTAGAAAGTCAATCTGAGGCTGG - Intergenic
1150242555 17:63646937-63646959 AAGCAAAGGAAAGCTGAGGGTGG - Intronic
1151081919 17:71339267-71339289 TATGAAAGAAAAGTTTAGGCTGG - Intergenic
1151773695 17:76183039-76183061 TCGGGAAGCAAGGCTGAGGCAGG - Intronic
1152116558 17:78391295-78391317 TCGGAAAGAAAAGCTGGAGCAGG - Intronic
1153600535 18:6776935-6776957 TTGAAAAGGTAAGCTGAGGCAGG + Intronic
1153636961 18:7120880-7120902 TAGTGAAGAAAAGCTCAGGCTGG + Intergenic
1153860720 18:9202252-9202274 TAGGAAAATAGAACTAAGGCTGG - Intronic
1155300611 18:24426295-24426317 TAGGAATGTAAAGACGAGTCTGG + Intergenic
1155943682 18:31824797-31824819 TAGGAAAATGAGGCTGAGACTGG + Intergenic
1155988607 18:32256458-32256480 TAGGAAGATAAAGGAGAGGCAGG - Intronic
1156541074 18:37911097-37911119 TAGAATAGGAAAGCTGAGCCTGG - Intergenic
1156794527 18:41027073-41027095 TATGAAAGAATACCTGAGGCTGG - Intergenic
1157456977 18:47840631-47840653 TAGAAAAGTGATGCTGAGGTAGG - Exonic
1158112841 18:53960777-53960799 TAGGCAAGGAAAACTCAGGCAGG + Intergenic
1158210113 18:55039637-55039659 TAGGAAAGTGAAGGTGTGGATGG + Intergenic
1158994474 18:62903656-62903678 TGGGAATGGGAAGCTGAGGCAGG + Intronic
1159110679 18:64052942-64052964 CAGGATAGTAAGGCAGAGGCTGG + Intergenic
1159381453 18:67665304-67665326 TAGGAAAGTAAAAAGGAGACAGG - Intergenic
1160307233 18:77751364-77751386 AAGGAAAGGAAAGCTGAGGCTGG + Intergenic
1160958661 19:1707170-1707192 AAGAAAAGAAAAGCAGAGGCGGG + Intergenic
1163093716 19:15040179-15040201 TTAAAAAATAAAGCTGAGGCGGG + Intergenic
1163959267 19:20672010-20672032 TAGAAAACTAATGCAGAGGCCGG - Intronic
1164026222 19:21355661-21355683 TAGAAGATCAAAGCTGAGGCCGG - Intergenic
1164567826 19:29340572-29340594 GAGAAAAATAAAGCTTAGGCTGG + Intergenic
1164608326 19:29615890-29615912 TAGCAAAGTAAACCTTAGGTGGG - Intronic
1165103104 19:33450759-33450781 TTATAAAGTAAAACTGAGGCAGG + Intronic
1165428245 19:35757240-35757262 GAGGAAACTAAGGCTGAGGAGGG + Intronic
1168184218 19:54687543-54687565 AAGGAAAGTAAGGATAAGGCTGG - Intronic
926424539 2:12728958-12728980 AATGAAAGAAAAGCTGAGTCTGG - Intronic
926685015 2:15691562-15691584 TAGGAAACTGAGGCTGAGGGAGG - Intronic
926802509 2:16671486-16671508 TAGGGAAGGAAAGTGGAGGCAGG + Intergenic
927537019 2:23871267-23871289 TAGTAAAGCAGAGCTGAGGGTGG - Intronic
929288136 2:40159167-40159189 GAGGAAAGCAAAGCTGTGGAAGG - Intronic
929523272 2:42674989-42675011 TAAAAAATTAATGCTGAGGCTGG + Intronic
930567351 2:53038109-53038131 TAGGAAACTAAAGTTTAGGGAGG - Intergenic
931855898 2:66301621-66301643 TCGGAAATGCAAGCTGAGGCTGG + Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932423001 2:71612411-71612433 TTGGAAGGTAAAGCTGTGGGGGG + Intronic
933124692 2:78590191-78590213 TTGGAGAGTAAAGATGAGACAGG + Intergenic
933791972 2:85890012-85890034 TAAGAAAGTAAAGTGGTGGCTGG + Intergenic
933878994 2:86649067-86649089 TAGGGAGGTAGAGCTGATGCAGG + Intronic
934754984 2:96818545-96818567 TAGAAAAGAAGAGGTGAGGCTGG - Intronic
935300887 2:101693134-101693156 CCAGAAAGCAAAGCTGAGGCAGG - Intergenic
936039331 2:109137893-109137915 GAGGAAAGTACTCCTGAGGCTGG + Intronic
936168566 2:110146800-110146822 GAGGAGAGTTAAGCTGTGGCTGG - Exonic
937925304 2:127163138-127163160 TTCTAAAGTAAACCTGAGGCTGG + Intergenic
938796765 2:134724253-134724275 TAAAAAAGGAAAGCTGAGGAAGG + Intergenic
939032332 2:137091935-137091957 TTGCCAAGTAAAGCAGAGGCTGG - Intronic
939393720 2:141601896-141601918 TAAGAAAATAATGCTAAGGCCGG - Intronic
939955043 2:148520673-148520695 TAGGTTAGTAAAACTAAGGCGGG - Intergenic
941925437 2:170889627-170889649 CAGGAAAGAAAAGATGAGGCAGG - Intergenic
942549627 2:177101702-177101724 AAGAAAAGAAAAGCTGGGGCAGG + Intergenic
943319015 2:186424146-186424168 TAGGACAGTGAAGCTTTGGCAGG + Intergenic
943470545 2:188289750-188289772 TAGGAAACTGAGGATGAGGCCGG + Intergenic
943792236 2:191946373-191946395 TAGTAAAGTGAAGCTTAGACTGG + Intergenic
944329100 2:198444485-198444507 TAGAAAAGTAGAGCAGAGTCTGG + Intronic
944348167 2:198693506-198693528 TAAGAAAATAAAGCTGGGGTGGG + Intergenic
946424720 2:219587654-219587676 TAAGAAAGTAAAGTGGTGGCTGG + Intergenic
946558951 2:220891081-220891103 TAGGGAGGAAATGCTGAGGCAGG + Intergenic
947184766 2:227445050-227445072 TAAGAAAGTAAAGCAGGGCCGGG + Intergenic
947341665 2:229146774-229146796 TAAGAAAGGAAAGCAGAGGGAGG + Intronic
947485837 2:230548071-230548093 TAGGAACCAAAAGATGAGGCAGG - Intergenic
948019666 2:234720157-234720179 GAGAAAAGTCAAGCAGAGGCCGG + Intergenic
948070723 2:235121408-235121430 TAAGAAAATGAAGTTGAGGCAGG - Intergenic
1168805660 20:670982-671004 TATGAAAGGAAAACAGAGGCTGG + Intronic
1168923302 20:1558745-1558767 TAGGAAAAGAAAGCAGAGCCAGG + Exonic
1168990935 20:2095234-2095256 CAGAATAGTAAGGCTGAGGCTGG - Intergenic
1169084569 20:2818755-2818777 GAGGAAAGTGAAGTTGAGGAAGG - Intronic
1169684209 20:8252128-8252150 AAGGAAAGAAAAGCAGAGGAGGG + Intronic
1169793063 20:9431804-9431826 TAAGAAAATAAAGCGGAGGCCGG - Intronic
1169830017 20:9814870-9814892 TATAAAAGTATACCTGAGGCTGG + Intronic
1170119394 20:12895365-12895387 TCAGAAAGCAAAGCAGAGGCTGG - Intergenic
1170636809 20:18113330-18113352 TAGCTGAGTATAGCTGAGGCTGG - Intergenic
1170902801 20:20482501-20482523 TAGGAATGAAAAGATGAGGTGGG + Intronic
1171073293 20:22097024-22097046 TATAAAAGTAAACATGAGGCTGG + Intergenic
1172584296 20:36071680-36071702 GAGGAAAGGAAAGCTGGGGGTGG + Intergenic
1173235889 20:41245042-41245064 AAACAAGGTAAAGCTGAGGCTGG + Intronic
1173739532 20:45388385-45388407 TAGGAAAGAAAAGCTTATCCAGG - Intronic
1173853400 20:46233244-46233266 AAGGAAAGAAAAGGTGAGGAGGG - Intronic
1174219536 20:48942446-48942468 TAAGAAAGAAAGGCTGAGCCAGG - Intronic
1175012913 20:55757953-55757975 TAGAAAAGTGAAACAGAGGCTGG - Intergenic
1175799161 20:61791429-61791451 TAGGAAAGTCCATCTTAGGCCGG + Intronic
1177657488 21:24037918-24037940 TAAGAAAGTAATGTTGAGGCTGG + Intergenic
1178642417 21:34355814-34355836 AAAGAAAGAAAAGCAGAGGCTGG + Intergenic
1178841159 21:36138444-36138466 TTGGAACTTAAAGCTAAGGCTGG - Intronic
1178859864 21:36279607-36279629 TTGGAAAGAAAAGCTAAGGGTGG + Intronic
1179292358 21:40029799-40029821 TAGGTAAGTGAAGCTGGGGGTGG - Intronic
1179895522 21:44360040-44360062 TAGAAAAGTTCAGATGAGGCTGG - Intronic
1180757907 22:18175871-18175893 CAGGAAGCTAAAACTGAGGCAGG + Intronic
1180768193 22:18359664-18359686 CAGGAAGCTAAAACTGAGGCAGG + Intergenic
1180778114 22:18502726-18502748 CAGGAAGCTAAAACTGAGGCAGG - Intergenic
1180810838 22:18760037-18760059 CAGGAAGCTAAAACTGAGGCAGG - Intergenic
1180910825 22:19448736-19448758 AAGGCAAGTAAAGAGGAGGCTGG + Intergenic
1181196987 22:21194292-21194314 CAGGAAGCTAAAACTGAGGCAGG - Intergenic
1181812332 22:25411238-25411260 TAGAAAAGAAAAGCAAAGGCTGG + Intergenic
1182038627 22:27219011-27219033 CAGGAAATGGAAGCTGAGGCTGG - Intergenic
1182584897 22:31339256-31339278 TAGGAATGTAAATCTGCTGCTGG + Intronic
1185276833 22:49953540-49953562 TAGGGAAGTGGACCTGAGGCCGG + Intergenic
1203229813 22_KI270731v1_random:100551-100573 CAGGAAGCTAAAACTGAGGCAGG + Intergenic
949548049 3:5089507-5089529 GAGGAAAGAAGATCTGAGGCAGG + Intergenic
952253896 3:31679256-31679278 GAGGAGAGTGAAGCTGGGGCAGG - Intronic
953019242 3:39103437-39103459 TAAGCAAGCAAAGCAGAGGCAGG + Intronic
953463130 3:43097233-43097255 GGAGAAAGTAAAGCTGAGGGTGG + Intronic
954272907 3:49523520-49523542 TAGAGAAACAAAGCTGAGGCTGG - Intronic
954549147 3:51465900-51465922 TAGAAAAATAAGGCTGCGGCTGG + Intronic
955688888 3:61571206-61571228 TAGGAAACTAAAGTTGAAGAAGG + Intronic
955885593 3:63595031-63595053 TCGGAAAGAAAAACTGAGGTAGG + Intronic
956145860 3:66190013-66190035 TAAGAAACTACAGTTGAGGCTGG + Intronic
956158330 3:66321615-66321637 TAGGGAAGTACAGATGAAGCAGG + Intronic
956224221 3:66937795-66937817 TGGGAAAGTAAGAATGAGGCTGG - Intergenic
956330677 3:68103401-68103423 TAGGAATGAACAGCTAAGGCTGG - Intronic
956387367 3:68734400-68734422 CAGGAAAGAAAGGCTGAGGCAGG + Intronic
958804570 3:98794593-98794615 AAGAAAAGTCAAGCTGAGGCCGG + Exonic
959117356 3:102194042-102194064 AAGGAAATTAAAGCTTAGGAAGG - Intronic
960172813 3:114482244-114482266 CAGGAAACTAAAGATGAGGTGGG + Intronic
960384359 3:117003293-117003315 TGGAAAAGTAAAGATGAGGATGG - Intronic
961094225 3:124140864-124140886 AAGAAAAGGAAACCTGAGGCTGG - Intronic
961360265 3:126362694-126362716 TATGAAAGGAAATCTGAGGGCGG - Intergenic
962257143 3:133880300-133880322 TAGGAAAAGAAGGCTGAGGCAGG + Intronic
963229773 3:142897623-142897645 TAGGAAAATAAAGCTTATGTTGG - Intergenic
963856521 3:150259319-150259341 TAGGTAAGTAAGGGAGAGGCTGG + Intergenic
963882462 3:150544337-150544359 TAGGAAAGTCATTCTGAGGCAGG + Exonic
963928745 3:150979406-150979428 TAGGAAAGTAAAAAGGAGGAAGG - Intergenic
964014264 3:151927647-151927669 TAGGAAAGAAAACCTGAGGGAGG - Intergenic
964775687 3:160274172-160274194 TAGGGAAGTAAAGATGAGGGAGG + Intronic
965328172 3:167334274-167334296 AAGAAAACTAAAGCTTAGGCCGG + Intronic
966175382 3:177132797-177132819 CAGGAAATTAAATCAGAGGCAGG + Intronic
966540810 3:181088006-181088028 TAGGAAAATAAAGCAGAGTGAGG + Intergenic
966653285 3:182325243-182325265 AAGGGAAATAAAGCTGAGGCAGG + Intergenic
967113560 3:186317280-186317302 TAGGAAAGAAAAGAAGAGGCTGG - Intronic
967524668 3:190477116-190477138 TATGAAAGAAAATCTGAGACTGG - Intergenic
968169944 3:196502288-196502310 TAGATAAGTAAATCAGAGGCCGG + Intronic
968381967 4:104140-104162 GAGGAAACTAAAGCACAGGCAGG - Intergenic
969089554 4:4683517-4683539 TGGGAAAGGAATGCGGAGGCTGG - Intergenic
969518385 4:7661476-7661498 TGGAAAAGAAGAGCTGAGGCTGG - Intronic
969701066 4:8768096-8768118 TGGGAAAGTAAAGCCAAGGACGG - Intergenic
970044861 4:11840620-11840642 TTGGAAAGCAAAGAGGAGGCAGG - Intergenic
970133850 4:12900412-12900434 CAGGAAAGTAAAACTGAGTCTGG - Intergenic
970617864 4:17784449-17784471 TAGGAAAGTGAAGCTAAGGCAGG + Intergenic
970631006 4:17944607-17944629 TAGGAAAATAAAGATGAGCTTGG - Intronic
970947463 4:21711905-21711927 AAGGATAGGAAAACTGAGGCTGG + Intronic
972917543 4:43899291-43899313 TAGGAAAGAAAAACTTATGCAGG + Intergenic
974185628 4:58441734-58441756 CAGAAAATTAAAGTTGAGGCCGG - Intergenic
974273971 4:59690828-59690850 CAGGAAAGTAAAGCAGAGAAGGG - Intergenic
975173936 4:71265668-71265690 TAGGAAACTAAAGATAAGGCAGG - Intronic
975350541 4:73340757-73340779 TGGGAAACTGAAGCTGAGGGAGG - Intergenic
975420645 4:74159885-74159907 TAGGCAAGTTAAGATAAGGCGGG + Intronic
975578698 4:75887985-75888007 TGGGAAAATAAAGCAGAGGCTGG + Intronic
975910915 4:79265860-79265882 AAGAAAAATATAGCTGAGGCAGG - Intronic
976075315 4:81291650-81291672 AAGGAAAGTAAAGCTGAGAAGGG - Intergenic
976799328 4:88971086-88971108 TAGGCAGGAGAAGCTGAGGCAGG + Intronic
978147878 4:105397924-105397946 TATGAAAGAACTGCTGAGGCTGG - Intronic
978306520 4:107334364-107334386 TGGGAAAAAAAGGCTGAGGCAGG + Intergenic
981023877 4:140056467-140056489 AAGAAAACTAAGGCTGAGGCAGG - Intronic
981807686 4:148735653-148735675 TAGGAAAGCAAAGATGAATCAGG - Intergenic
983115288 4:163808323-163808345 TAGGTCAGTTAAGCTGGGGCAGG - Intronic
983476735 4:168220974-168220996 CAGGAAAATAAAGCTCAGGAGGG + Intronic
984161939 4:176263285-176263307 TATAAAGGAAAAGCTGAGGCTGG - Intronic
984582683 4:181528650-181528672 AAGGAAAGTGAGGCTGAGGGAGG + Intergenic
985170995 4:187150149-187150171 TACGAAGGTATACCTGAGGCTGG + Intergenic
985752839 5:1692032-1692054 TAGAAAAATAAAGGTAAGGCTGG - Intergenic
986508336 5:8475698-8475720 TATGAAACTAATGCTGAGGGGGG + Intergenic
988910641 5:35838082-35838104 TTGAAAAGTAAAGTTGAGGCCGG - Intergenic
990040046 5:51368957-51368979 AAGGAAAGTAAAGCTGTAACTGG - Intergenic
990268973 5:54114290-54114312 TGGGAAGCTAAGGCTGAGGCAGG + Intronic
990521201 5:56583141-56583163 TAGGAAAGTAACGTGGAGCCAGG + Intronic
992326533 5:75665547-75665569 TGTGGAAGTAAAGCTGAGGCTGG + Intronic
993350235 5:86841666-86841688 GAGGAAACTAAAGCTTAGGGAGG - Intergenic
993723066 5:91340936-91340958 TAAGAAAATAAAGAGGAGGCCGG + Intergenic
995809604 5:116089984-116090006 TAGAATAGTGAAACTGAGGCAGG + Intronic
995989451 5:118218994-118219016 TAGAAAAGAATAGCTGAGACTGG - Intergenic
998101027 5:139434616-139434638 TAAGAAAATATAGTTGAGGCTGG - Intronic
999006943 5:147991991-147992013 GAGGAAAGAAGAGCTGAAGCTGG - Intergenic
999186340 5:149712889-149712911 CAGAAAAATTAAGCTGAGGCTGG - Intergenic
999642085 5:153682132-153682154 TAGGAAAGTGAAGCTTAGGAGGG + Intronic
999695299 5:154183538-154183560 TAGGGCAGTAAAACTGAGGCAGG + Intronic
999747253 5:154601707-154601729 TAGCACAGGAAGGCTGAGGCAGG - Intergenic
1000052262 5:157573911-157573933 CAGGAGAGTAAAGCTGATTCAGG - Intronic
1001478748 5:172071310-172071332 TAGATAACTAAAACTGAGGCAGG + Intronic
1001889865 5:175329881-175329903 GAGGAAAGTAAAGCACAGACAGG + Intergenic
1002029808 5:176419455-176419477 TAAGAAAGTAAAGGAGGGGCCGG - Intergenic
1002390584 5:178908854-178908876 TTGGGAAAAAAAGCTGAGGCAGG + Intronic
1003814092 6:9817736-9817758 TAAGAAAGTAAAGTTTGGGCTGG - Intronic
1003958344 6:11186914-11186936 TAGAAAAGTAAAGCTGTTGAAGG - Intronic
1004439881 6:15639995-15640017 TAGGAAAGTAGAAATGAGGGAGG - Intronic
1004476537 6:15978652-15978674 CTGGAAATTAAAGCAGAGGCTGG - Intergenic
1004863273 6:19828645-19828667 AAGGAAACGAAAGTTGAGGCTGG + Intergenic
1006370086 6:33638872-33638894 TAGGAAAGCAGAGCTGAGGGTGG + Intronic
1006656700 6:35600806-35600828 TAGGAAACTAACGCACAGGCAGG - Intronic
1007108787 6:39301128-39301150 TGGGTAAGTATAGCTGAGGGAGG + Intronic
1007370718 6:41425376-41425398 GAGGAAAGTAAGGCTCAGGAAGG + Intergenic
1007706267 6:43793386-43793408 TGGGCAAGAAATGCTGAGGCTGG + Intergenic
1008253440 6:49268602-49268624 TAGGAAAGTAAAGATGAAGATGG + Intergenic
1008273422 6:49516241-49516263 TTAGAAACTAATGCTGAGGCTGG - Intronic
1009676672 6:66832815-66832837 GAGGAAACTAAAGCTAAGGAAGG - Intergenic
1012219500 6:96631191-96631213 AAGGAAAATAAAGCTGAGTGAGG - Intergenic
1014544896 6:122723082-122723104 GAGGAAAGAAAAGCTGAAGGAGG - Intronic
1015659045 6:135553310-135553332 GAGGAAAGTAAAGCTATGGAAGG - Intergenic
1016027478 6:139301726-139301748 TGTGAAAGTAAAGGTCAGGCAGG - Intergenic
1017740078 6:157398468-157398490 GAGGAAAGGGAAGCAGAGGCTGG + Intronic
1018609564 6:165634598-165634620 TAGGGAAGTAAAACAGAAGCAGG + Intronic
1020658234 7:10952664-10952686 TGGGAAGGTAAAGTTGAGGGGGG - Intergenic
1020859438 7:13472594-13472616 TAGTAAAGAAAAGATGAGGCTGG + Intergenic
1021819875 7:24486272-24486294 AAAGAAAGAAAAGTTGAGGCTGG + Intergenic
1023212875 7:37827201-37827223 CATGAAAGTAAAGCTGATGAAGG - Intronic
1023444832 7:40220712-40220734 TAAGAAACTTAAGGTGAGGCTGG - Intronic
1023826582 7:44014164-44014186 CAGCAAAGAAAAGCCGAGGCAGG - Intergenic
1024140953 7:46462796-46462818 TTGGAATGAAAAGCTGAGTCAGG + Intergenic
1024176081 7:46842432-46842454 TTGGAAACTGAAACTGAGGCTGG + Intergenic
1024453552 7:49577750-49577772 TAAGTAAGTACAGCTGATGCAGG - Intergenic
1025564908 7:62422237-62422259 TAGGAAAGATTAGCTGAGCCTGG - Intergenic
1027279797 7:76599674-76599696 TAGGAAAGAAAATCTAGGGCTGG - Intergenic
1027489764 7:78808550-78808572 CATGAAAATACAGCTGAGGCTGG - Intronic
1027496926 7:78899511-78899533 TAGGAAACTAAAGCTTATGAAGG - Intronic
1027952633 7:84836830-84836852 AAGAAAAGTAAAACTGAGGCTGG - Intergenic
1029754871 7:102567568-102567590 CAGCAAAGAAAAGCCGAGGCAGG - Intronic
1029772821 7:102666648-102666670 CAGCAAAGAAAAGCCGAGGCAGG - Intronic
1030400120 7:109039091-109039113 TAAGAAAGTAAGGCTTGGGCAGG - Intergenic
1030551719 7:110969617-110969639 TGGGAAAGGAAACCTCAGGCAGG + Intronic
1030623932 7:111822839-111822861 AAGGAAAGCAGAGCTGAGCCAGG - Intronic
1030919859 7:115369348-115369370 TATAAAAGAATAGCTGAGGCTGG - Intergenic
1031360459 7:120843547-120843569 TGGGAAGGTATAGGTGAGGCAGG - Intronic
1031622227 7:123947945-123947967 TGGGAAAGTTAAGACGAGGCTGG + Intronic
1033115868 7:138624807-138624829 TAGGAAGGGGAGGCTGAGGCAGG - Intronic
1034005493 7:147467733-147467755 TAAGAAAGAACAGCTGTGGCTGG + Intronic
1034835012 7:154344011-154344033 TAGAAAAGTGAAGCAGAGGGTGG - Intronic
1036110277 8:5891773-5891795 GGGGAAACTAAAGCTGAGTCTGG + Intergenic
1036393744 8:8348668-8348690 TAGGTAAGTGAAACTGATGCTGG - Intronic
1036728733 8:11243266-11243288 CAGGAAAGAATAGGTGAGGCAGG + Intergenic
1037695177 8:21217279-21217301 TAGCAAATTAAACCTGAGGAGGG - Intergenic
1038258709 8:25973972-25973994 TAGAAATGAAAAGCTTAGGCTGG - Intronic
1038549250 8:28451513-28451535 TCCGAAAGTAAAGCTGAGTAAGG - Intronic
1038881459 8:31618285-31618307 TAGAAAAAAAAAGCTGAGGCCGG + Intergenic
1039015923 8:33148811-33148833 TAAGAAAGTAAAGGTGACACAGG - Intergenic
1041060947 8:54033791-54033813 TAGCAATGAAAGGCTGAGGCAGG - Intergenic
1041665279 8:60438438-60438460 TAGAAATAGAAAGCTGAGGCTGG + Intergenic
1041784807 8:61620065-61620087 ATGAAAAGTAAATCTGAGGCTGG + Intronic
1041870955 8:62633897-62633919 TAAGAGAGTACAGCTGATGCGGG + Intronic
1044233669 8:89806757-89806779 AAGAAAAGAAAAGCAGAGGCTGG - Intergenic
1044506848 8:93030543-93030565 TATGAAAGAAAACCTGAGACTGG - Intergenic
1044982693 8:97732273-97732295 AAGGAAAGAAAAGATGGGGCCGG + Intergenic
1045021016 8:98044545-98044567 TAGGTAAGAAAAGTTGAGGCTGG - Intronic
1045384878 8:101662525-101662547 TTGGAAAGTCTAGCAGAGGCTGG - Intronic
1045941875 8:107748549-107748571 TAGAAAAGGAAAGCTGATCCCGG - Intergenic
1046062847 8:109159399-109159421 TATGAAGATAAAGCTGAGCCAGG - Intergenic
1047051822 8:121121296-121121318 TAGGAGAATAAAGCTGAGGTGGG + Intergenic
1047189761 8:122667379-122667401 AAGTAAAATAAAGCTGAGGAAGG - Intergenic
1048007897 8:130433857-130433879 TAGAAAACTAAAGCTTAGGCAGG + Intronic
1049962288 9:748290-748312 TAAGAAAGTAAAACTAAGCCAGG + Intergenic
1050833445 9:10044662-10044684 TAAGAAATTAAAGCTCAGGGAGG + Intronic
1051902985 9:22062766-22062788 AAGGAAACTAAAGCTGAGAAAGG - Intergenic
1052961158 9:34298246-34298268 TAGAAAAGTGAAACAGAGGCCGG + Intronic
1053252269 9:36584627-36584649 TAAGAAAATAAAGATGGGGCCGG - Intronic
1055149474 9:72978531-72978553 TCAGAAAGTAGAGCTGAGGATGG - Intronic
1055371602 9:75605707-75605729 TAGGAAATTGAACTTGAGGCTGG - Intergenic
1055377770 9:75668623-75668645 TAAGAAACTAAAGCTTAGGGAGG + Intergenic
1055457212 9:76484082-76484104 TCAGAAAGTAAAACTGAGGCTGG + Intronic
1056386009 9:86098018-86098040 GAGGAAAGTAGTGCTGAGGGTGG - Intronic
1056800710 9:89688945-89688967 TAGGAAAGTCAAGCAAAGGTGGG + Intergenic
1057409836 9:94808334-94808356 TCTTAAAGAAAAGCTGAGGCTGG - Intronic
1058711320 9:107681873-107681895 CAGGAAAGAGAAGCTGAGGCTGG + Intergenic
1060499490 9:124142180-124142202 TAAGAAAGTAAAGGAAAGGCCGG - Intergenic
1061221872 9:129256828-129256850 AAGAAAAGGAAGGCTGAGGCTGG - Intergenic
1062244388 9:135557019-135557041 TAGAAATTGAAAGCTGAGGCCGG - Intergenic
1185581598 X:1213997-1214019 TAGGAAAGAAAAGCTGGGCACGG - Intergenic
1185643426 X:1600626-1600648 GAGGAAAGTGCAGCTGAGCCCGG - Intronic
1185684294 X:1915269-1915291 GAGGAAATTAAAACAGAGGCTGG + Intergenic
1186149358 X:6657782-6657804 TATAAAAGAATAGCTGAGGCTGG - Intergenic
1186546594 X:10456539-10456561 TATCAAAGAAAAGCTTAGGCTGG + Intronic
1187647838 X:21368505-21368527 TAGGAATGTGAAGCTGAGTATGG - Intergenic
1188073765 X:25749781-25749803 TAGGAAAGGAAAGAGGAGGATGG - Intergenic
1188547777 X:31328654-31328676 AAGGAAAATAAGGCTTAGGCAGG - Intronic
1189029202 X:37432555-37432577 TAGGAAGGAAAAGGTGATGCCGG - Intronic
1189197365 X:39163308-39163330 TAGGAAAATGAAGCTAGGGCAGG + Intergenic
1190298862 X:49044242-49044264 CAGGCCAGGAAAGCTGAGGCTGG - Intergenic
1192927284 X:75768435-75768457 GAGGAAAGAAATGCTGAGCCTGG + Intergenic
1194236056 X:91384191-91384213 TAGGAAGGTAAAGCAGGAGCAGG - Intergenic
1194762510 X:97811188-97811210 TAGAAAAGCAAAGGTGGGGCTGG - Intergenic
1194811002 X:98387297-98387319 TAGGAAAGTAAATTTGGGGAAGG + Intergenic
1196131651 X:112163690-112163712 GAGGAAAGTAAAGCTCAGAGAGG - Intergenic
1196481679 X:116157444-116157466 TAAGACAGCAAACCTGAGGCAGG - Intergenic
1197689124 X:129478026-129478048 TGGGAGAGAAAAGCTGAGGCAGG - Intronic
1198343272 X:135735190-135735212 TGGGAAAAAAAAACTGAGGCAGG - Intergenic
1199416357 X:147587327-147587349 GAAGAAAGTAGAGCTGGGGCAGG - Intergenic
1199565363 X:149210074-149210096 AAGGAAACTAAGGCTGAGGCAGG + Intergenic