ID: 915416760

View in Genome Browser
Species Human (GRCh38)
Location 1:155748425-155748447
Sequence GTCCAGGGCTGTAGCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915416760_915416766 23 Left 915416760 1:155748425-155748447 CCATCCTGGCTACAGCCCTGGAC No data
Right 915416766 1:155748471-155748493 GTGTTCCTCTCCAGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915416760 Original CRISPR GTCCAGGGCTGTAGCCAGGA TGG (reversed) Intergenic