ID: 915416761

View in Genome Browser
Species Human (GRCh38)
Location 1:155748429-155748451
Sequence CTGTGTCCAGGGCTGTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915416761_915416766 19 Left 915416761 1:155748429-155748451 CCTGGCTACAGCCCTGGACACAG No data
Right 915416766 1:155748471-155748493 GTGTTCCTCTCCAGTTTCCATGG No data
915416761_915416768 28 Left 915416761 1:155748429-155748451 CCTGGCTACAGCCCTGGACACAG No data
Right 915416768 1:155748480-155748502 TCCAGTTTCCATGGTTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915416761 Original CRISPR CTGTGTCCAGGGCTGTAGCC AGG (reversed) Intergenic