ID: 915416763

View in Genome Browser
Species Human (GRCh38)
Location 1:155748441-155748463
Sequence AAGGAACAGTGACTGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915416763_915416768 16 Left 915416763 1:155748441-155748463 CCTGGACACAGTCACTGTTCCTT No data
Right 915416768 1:155748480-155748502 TCCAGTTTCCATGGTTCATCTGG No data
915416763_915416766 7 Left 915416763 1:155748441-155748463 CCTGGACACAGTCACTGTTCCTT No data
Right 915416766 1:155748471-155748493 GTGTTCCTCTCCAGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915416763 Original CRISPR AAGGAACAGTGACTGTGTCC AGG (reversed) Intergenic