ID: 915416766

View in Genome Browser
Species Human (GRCh38)
Location 1:155748471-155748493
Sequence GTGTTCCTCTCCAGTTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915416763_915416766 7 Left 915416763 1:155748441-155748463 CCTGGACACAGTCACTGTTCCTT No data
Right 915416766 1:155748471-155748493 GTGTTCCTCTCCAGTTTCCATGG No data
915416761_915416766 19 Left 915416761 1:155748429-155748451 CCTGGCTACAGCCCTGGACACAG No data
Right 915416766 1:155748471-155748493 GTGTTCCTCTCCAGTTTCCATGG No data
915416760_915416766 23 Left 915416760 1:155748425-155748447 CCATCCTGGCTACAGCCCTGGAC No data
Right 915416766 1:155748471-155748493 GTGTTCCTCTCCAGTTTCCATGG No data
915416762_915416766 8 Left 915416762 1:155748440-155748462 CCCTGGACACAGTCACTGTTCCT No data
Right 915416766 1:155748471-155748493 GTGTTCCTCTCCAGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915416766 Original CRISPR GTGTTCCTCTCCAGTTTCCA TGG Intergenic