ID: 915419188

View in Genome Browser
Species Human (GRCh38)
Location 1:155766094-155766116
Sequence CTCAAAGAGAAGAGGAGTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 374}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915419188_915419199 26 Left 915419188 1:155766094-155766116 CCTTGACTCCTCTTCTCTTTGAG 0: 1
1: 1
2: 2
3: 23
4: 374
Right 915419199 1:155766143-155766165 AAACTTAGAAGGGGCAAGGGAGG 0: 1
1: 0
2: 1
3: 42
4: 377
915419188_915419197 22 Left 915419188 1:155766094-155766116 CCTTGACTCCTCTTCTCTTTGAG 0: 1
1: 1
2: 2
3: 23
4: 374
Right 915419197 1:155766139-155766161 TTCGAAACTTAGAAGGGGCAAGG 0: 1
1: 0
2: 0
3: 18
4: 202
915419188_915419200 27 Left 915419188 1:155766094-155766116 CCTTGACTCCTCTTCTCTTTGAG 0: 1
1: 1
2: 2
3: 23
4: 374
Right 915419200 1:155766144-155766166 AACTTAGAAGGGGCAAGGGAGGG 0: 1
1: 0
2: 2
3: 48
4: 417
915419188_915419192 -3 Left 915419188 1:155766094-155766116 CCTTGACTCCTCTTCTCTTTGAG 0: 1
1: 1
2: 2
3: 23
4: 374
Right 915419192 1:155766114-155766136 GAGGGTCTCCGTCTCACATATGG 0: 2
1: 0
2: 0
3: 3
4: 64
915419188_915419198 23 Left 915419188 1:155766094-155766116 CCTTGACTCCTCTTCTCTTTGAG 0: 1
1: 1
2: 2
3: 23
4: 374
Right 915419198 1:155766140-155766162 TCGAAACTTAGAAGGGGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 122
915419188_915419195 16 Left 915419188 1:155766094-155766116 CCTTGACTCCTCTTCTCTTTGAG 0: 1
1: 1
2: 2
3: 23
4: 374
Right 915419195 1:155766133-155766155 ATGGCTTTCGAAACTTAGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 126
915419188_915419194 15 Left 915419188 1:155766094-155766116 CCTTGACTCCTCTTCTCTTTGAG 0: 1
1: 1
2: 2
3: 23
4: 374
Right 915419194 1:155766132-155766154 TATGGCTTTCGAAACTTAGAAGG 0: 1
1: 0
2: 0
3: 2
4: 62
915419188_915419196 17 Left 915419188 1:155766094-155766116 CCTTGACTCCTCTTCTCTTTGAG 0: 1
1: 1
2: 2
3: 23
4: 374
Right 915419196 1:155766134-155766156 TGGCTTTCGAAACTTAGAAGGGG 0: 1
1: 0
2: 1
3: 5
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915419188 Original CRISPR CTCAAAGAGAAGAGGAGTCA AGG (reversed) Exonic
904506381 1:30958655-30958677 CTCAAAGAGAAAAAAAGTAAGGG - Intronic
905643725 1:39609978-39610000 CTGTGAGAGAAGAGGTGTCAGGG + Intergenic
905930475 1:41783369-41783391 CTCAAAGAGAGGGGGTGGCACGG + Intronic
906829727 1:49018417-49018439 CTCTAGGAGAAGAGGTGGCAAGG - Intronic
907367352 1:53973382-53973404 CTTAAAGAGAATGGGAGACAAGG + Intergenic
908533623 1:65056966-65056988 CACAGAGAGAAGAGGGGCCAGGG - Intergenic
909344786 1:74572464-74572486 CTGAGAGAGAAGAGGTGACAAGG - Exonic
910094060 1:83499778-83499800 TTTCAAGAGGAGAGGAGTCAAGG + Intergenic
910118395 1:83757701-83757723 CACACAGAAAAGAGAAGTCAGGG - Intergenic
911216860 1:95204074-95204096 CTCACAGGGCAGAGGGGTCAGGG - Intronic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
915419188 1:155766094-155766116 CTCAAAGAGAAGAGGAGTCAAGG - Exonic
916286649 1:163112768-163112790 TTTAAAGAAAAGAGGAGTAAAGG + Intronic
916992921 1:170264367-170264389 ATGAAAGAAGAGAGGAGTCAAGG - Intergenic
917132258 1:171755208-171755230 CTGAAAGTGAAAAGAAGTCAGGG - Intergenic
917460722 1:175226763-175226785 CCCAAAGACAAGAGGAGTGAAGG - Intergenic
919008191 1:191927100-191927122 CTCAAAGAGAAGATTAGTGGTGG + Intergenic
919041150 1:192390383-192390405 CTCTAAGAAAAGGGAAGTCAGGG - Intergenic
919167673 1:193916570-193916592 CTCTAAGAAAAGAGTGGTCAGGG - Intergenic
920530026 1:206695071-206695093 CTCACAGAGAGGAGGAGGAAGGG + Intronic
923074046 1:230593264-230593286 CAGAAAGGGAAGAGAAGTCAAGG + Intergenic
923346602 1:233059200-233059222 CTCAAGCAGCACAGGAGTCAAGG - Intronic
923424814 1:233858505-233858527 CTGAAACTGAAGGGGAGTCATGG - Intergenic
923711744 1:236393276-236393298 CTCAAAGAGCAGTGAAGTTATGG + Intronic
924643755 1:245857948-245857970 CTCAAGGAGAAGCTGAGGCAGGG + Intronic
924829157 1:247574112-247574134 CACAAAGAGAAAAGAAATCAAGG - Intronic
1063468261 10:6262764-6262786 CTCAAAGACTAGAGGAGCAAAGG + Intergenic
1065507898 10:26447719-26447741 CTCAAAAAAAAGAAAAGTCATGG - Intronic
1067720466 10:48724050-48724072 GTCAAAGAGAAGAGGAAAGATGG - Intronic
1068409171 10:56632755-56632777 CACATGGAGAAGATGAGTCATGG - Intergenic
1068420910 10:56791739-56791761 CTCATAGTGAAGTAGAGTCATGG - Intergenic
1068568803 10:58606065-58606087 CTCAAAGAGGAAAGTTGTCAGGG - Intronic
1068757933 10:60675302-60675324 TTCAAAGATAAAAGGATTCAGGG + Intronic
1070429899 10:76327384-76327406 GTCAAAGAGAAGATGAGGCTGGG - Intronic
1071259946 10:83910651-83910673 CTCAAAGAGATGATGAGATAAGG - Intergenic
1072465519 10:95658640-95658662 CTAAAAGAGGAGAGGAGTACAGG + Intergenic
1072726401 10:97816708-97816730 ATCAAAGGGAAGAGGAGACAAGG - Intergenic
1074661543 10:115664080-115664102 CTCAATGAGAACAGGAATCAAGG - Intronic
1074744257 10:116515499-116515521 CTTAAAGAGCAGAAGAGTGAGGG - Intergenic
1075087273 10:119422003-119422025 CCCATAGGGAAGAGGAGGCAAGG + Intronic
1077029008 11:455257-455279 CTCTAAGAAAAGAGGGGTGAAGG - Intronic
1077227483 11:1444718-1444740 CTCAAGGAGGAGAGAAGTCGGGG - Intronic
1077786636 11:5391002-5391024 ATCAGAGATGAGAGGAGTCAAGG - Intronic
1077934652 11:6770821-6770843 TTCAAAGAGAAGAAAAATCAGGG + Intergenic
1078547333 11:12255844-12255866 TTCCAAGAGAAGAGGAGCCTCGG - Intronic
1079013544 11:16849634-16849656 CTGAAAGAGAACAGAATTCAGGG + Intronic
1079392501 11:20034834-20034856 CTGAAAGATGAGAGGAGGCAGGG + Intronic
1080626554 11:34035682-34035704 ATCAAAGCGAAGAGGACTGAGGG - Intergenic
1081095511 11:38928871-38928893 CTCAAAGAGATTATGACTCAAGG + Intergenic
1082161154 11:48889222-48889244 CTCAGAGAGGAGAGGTGTGATGG + Intergenic
1084415429 11:69029694-69029716 CTTATAGAGAAGGGGATTCAAGG + Intergenic
1084420043 11:69055885-69055907 CCCAAAGAGAAGAGGAGAGGAGG + Intronic
1084978804 11:72817563-72817585 ATCTTAGAGCAGAGGAGTCATGG + Intronic
1086545396 11:87961792-87961814 CTCTAAGAGAAAATGTGTCATGG + Intergenic
1086593702 11:88545551-88545573 CTCAAGGAGAAGAGGTTTGAAGG - Intronic
1086822851 11:91456467-91456489 CTGAAAGAGAAAAGGAGAAAAGG + Intergenic
1087382910 11:97430303-97430325 TTCTAAGAGAAGAGGAATCTGGG + Intergenic
1088587045 11:111368439-111368461 CACCAAGAGAAGAGGAGTCCAGG + Intronic
1090076763 11:123584600-123584622 CTAAAAGAGGAGACCAGTCAGGG + Intronic
1090900346 11:131025510-131025532 TTCAAAGAGAAAAGGAATCTGGG - Intergenic
1090917254 11:131176664-131176686 CCCTTAGGGAAGAGGAGTCAGGG + Intergenic
1091593174 12:1857431-1857453 CTCAGAGAAGAAAGGAGTCAGGG + Intronic
1092779310 12:11970546-11970568 CTCGTAGAGCAGAGGAGTGAGGG - Intergenic
1092948213 12:13476114-13476136 ATCAGAGAGAAGCGGAGGCAGGG + Intergenic
1093087315 12:14880680-14880702 CTAAAGGAGAGGAGGAGTGAGGG + Intronic
1094331944 12:29303399-29303421 CTGAAAGACAACAGGAGGCAAGG - Intronic
1095294066 12:40508474-40508496 GTCAATGAGAAGAAGAGACAAGG - Intronic
1095435492 12:42183192-42183214 CTCAAGGAGAAGGAGAGACAGGG - Intronic
1095521080 12:43066837-43066859 GTAAAAGAAAAGAGGAATCAAGG + Intergenic
1096117725 12:49065193-49065215 CTATAAGAGGAGAGGATTCAGGG + Intronic
1098901485 12:76116085-76116107 GTGAAAGAGAAGAGGAGGTAGGG + Intergenic
1100922870 12:99509157-99509179 CCCAAGGAGAAGATGAGACAGGG - Intronic
1101640264 12:106582090-106582112 GACAAAGAGAAGTGGAGGCAGGG + Intronic
1102069218 12:110003520-110003542 CTGAGAGTGAAGAGGAGTGAGGG + Intronic
1102193249 12:111005230-111005252 CAGAAAGAGCAGAGGAGTCTGGG + Intergenic
1102257428 12:111424472-111424494 CTCCCAGAGAACAGGAGTCTTGG - Intronic
1103527350 12:121577741-121577763 CTGAAAGGGAAAAGGAGTGAAGG + Intronic
1104611200 12:130229188-130229210 CTCCAAGAGCTGGGGAGTCAAGG + Intergenic
1105262174 13:18787774-18787796 CTTACTGGGAAGAGGAGTCAAGG - Intergenic
1105662718 13:22516379-22516401 CTCATGGGGAAGGGGAGTCATGG + Intergenic
1106057689 13:26254109-26254131 CTCAAAGAGAGGAGGAGGGAGGG - Intergenic
1106617163 13:31340300-31340322 CTCAAAAAGAAAAGGAGTATAGG + Intergenic
1106635619 13:31525610-31525632 CTCAAAGAGAGGAGGTGAGATGG - Intergenic
1106680879 13:32006154-32006176 TTCAATCAGGAGAGGAGTCAGGG - Intergenic
1107016500 13:35711794-35711816 CCCCAAGAGAAGAGCAGTCCTGG + Intergenic
1107032286 13:35865595-35865617 CTCAAGAAGCATAGGAGTCAAGG - Intronic
1107271388 13:38621756-38621778 CACAAAGAGCATAGGACTCAAGG - Intergenic
1107406454 13:40118506-40118528 TTCAAAGAGAGCATGAGTCAGGG + Intergenic
1107441422 13:40430639-40430661 CTCAGAAAGAAAAGTAGTCAAGG + Intergenic
1108114528 13:47112284-47112306 CCCAAAGAGAACAGGATCCATGG - Intergenic
1108503884 13:51091918-51091940 CACAAAGACATGAGGAGTCTGGG - Intergenic
1109358367 13:61263845-61263867 CTCAAATAGATGAGGTGACAAGG - Intergenic
1109819992 13:67640156-67640178 CTAAAAGAGAACAGCAGTGAGGG + Intergenic
1110184838 13:72660884-72660906 CTCAGAGAGCAGAGGAGACTTGG - Intergenic
1110624331 13:77635089-77635111 GTCTAAGAGAAGAGTATTCAGGG + Intronic
1113104905 13:106761181-106761203 CTCAAAGAGAAAAGAAGGCTCGG + Intergenic
1114377961 14:22169597-22169619 CTCAATGAGAAGAGAAGGCAAGG - Intergenic
1116045372 14:39736314-39736336 CTCTAAGAAAAGGGAAGTCAGGG + Intergenic
1118074514 14:62283545-62283567 ATCAAATAGAGCAGGAGTCATGG - Intergenic
1118467063 14:66040586-66040608 ATCAATGAAAAGAGGAGACAAGG - Intergenic
1118914524 14:70091466-70091488 ATAAAAGAGAGTAGGAGTCAAGG - Intronic
1119326274 14:73761251-73761273 CTCAGGGAGAAGAGGAGGGAGGG + Intronic
1119391814 14:74296046-74296068 CTGAGAGGGAACAGGAGTCAGGG - Intronic
1120616993 14:86719024-86719046 CCCAGAGAGAATAGGAGACAGGG + Intergenic
1120748914 14:88179364-88179386 CACAAAAAGAAGAGGAGAGACGG + Intergenic
1122281763 14:100627648-100627670 CTCAAAGAGAAGAGGAGGCAGGG - Intergenic
1122379622 14:101293163-101293185 CTCCAAGAGAAGAGGGGACAGGG + Intergenic
1122930082 14:104929085-104929107 CTCTAACAGCAGAGGTGTCAAGG + Intronic
1125037514 15:35143153-35143175 CTCAAAGAGTACAGGAGGCCAGG + Intergenic
1125076651 15:35626932-35626954 CTCAAAGAGAAGAGGAGGAATGG - Intergenic
1125888450 15:43247516-43247538 CTCAAAAAAAAAAGGAGACAAGG + Intronic
1126200009 15:45974837-45974859 CACCAAGAAAAGAGGAGGCAAGG + Intergenic
1126557779 15:50008221-50008243 CTCAAAGAGAACAAGAATTAAGG + Intronic
1128643639 15:69359139-69359161 CTCATAGAAAAGAGGTGTGAGGG - Intronic
1128678516 15:69629290-69629312 CCCAAAGAGAAGACAATTCATGG - Intergenic
1129042578 15:72702760-72702782 CAAAAAGAGAAGAGAAGGCAAGG - Intronic
1129195884 15:73966088-73966110 TTGAGAGAAAAGAGGAGTCAGGG - Intergenic
1129924518 15:79351044-79351066 CTCAATAAAATGAGGAGTCATGG + Intronic
1130406371 15:83605818-83605840 CCCAAAGAGAAAAGGAGGCCAGG + Intronic
1131601174 15:93850567-93850589 CTCAAAGAAAAGAGGGGGAATGG - Intergenic
1132228580 15:100164481-100164503 CTCTAAGGGAATAGGGGTCAGGG + Intronic
1133473301 16:6096255-6096277 CCCAAAGAAAAGAGGAGAAAAGG + Intronic
1135105271 16:19644065-19644087 CCCAGAGAAAACAGGAGTCAAGG - Intronic
1136997335 16:35199518-35199540 CTTAAAGAGAAGTGGTGTCTTGG - Intergenic
1137953232 16:52803485-52803507 CTCAGAAGGAAAAGGAGTCATGG + Intergenic
1139016321 16:62693218-62693240 CTGAAAGAGAAGGGGTTTCATGG - Intergenic
1139319470 16:66101802-66101824 CTCAATGATAACAGGAGTAACGG - Intergenic
1139331680 16:66197109-66197131 CTTAGAGAGAGGAGGGGTCATGG - Intergenic
1139370169 16:66462232-66462254 CTCACAGAGAAAAGGTGGCAAGG - Intronic
1139596398 16:67960789-67960811 CCCAAAGAGAAGAGGGCTGAAGG + Intronic
1139802397 16:69533910-69533932 CTCCAGGAGAAAAGGAGTCCAGG - Intergenic
1141403694 16:83773265-83773287 CTTCAAGAAAAGAGAAGTCAAGG + Intronic
1143875200 17:9986048-9986070 CTCAAGGAGATAAGGTGTCAAGG - Intronic
1144155703 17:12498565-12498587 CTCAAAGAGAAGAAATATCAAGG - Intergenic
1144408352 17:14974591-14974613 CCCAAAGGGAAGAGGGGGCAGGG - Intergenic
1146071145 17:29683090-29683112 CACAAAGAGAGGAGGAGCCTGGG - Intronic
1146818590 17:35965415-35965437 TTCAAAGAGAAGAGGCTTCAAGG + Intergenic
1147149933 17:38508869-38508891 CTCAATGGGAAGAAGAGTCCCGG + Intronic
1148373474 17:47120183-47120205 CTCAAAGAGAAGAGGCAATATGG + Intronic
1149009621 17:51841827-51841849 GTCACAGTGAAGTGGAGTCAGGG - Intronic
1149585744 17:57785184-57785206 CACTAAGAGAAGAGGATGCAGGG + Intergenic
1149639355 17:58193012-58193034 TTCAAAGAGATGGGGACTCAGGG - Intronic
1150197371 17:63314421-63314443 TTCAAAGAGCAGAGGCTTCAAGG - Exonic
1151418484 17:73982292-73982314 CTCAAGGAGAAGAGGGAGCAAGG + Intergenic
1152942549 17:83180614-83180636 CACAGAAACAAGAGGAGTCAAGG - Intergenic
1153270066 18:3311843-3311865 CTAAAAGAGAAGAGAATTGAGGG - Intergenic
1153784481 18:8522642-8522664 CACAGAGAGAAGGGGGGTCAAGG - Intergenic
1153918057 18:9763262-9763284 ATCAGAGAGATGAGGAGACAGGG + Intronic
1153971981 18:10235362-10235384 CACATTGAGAAGAGGAGTCTTGG - Intergenic
1154215649 18:12414208-12414230 ATCAAAGAGAAGAGTACTCAGGG + Intronic
1154467918 18:14667867-14667889 CCCAAATAAAAGAGGAGGCAAGG - Intergenic
1154948808 18:21187958-21187980 CTCTAAGAAAGAAGGAGTCAGGG + Intergenic
1155260711 18:24039366-24039388 CACAAAGAGAAGTGTATTCAAGG + Intronic
1155488128 18:26369659-26369681 CCAAAAGAGAAGAGGAGCTAAGG - Intronic
1158245813 18:55430984-55431006 AGCAAAGGGAAAAGGAGTCAGGG + Intronic
1159382297 18:67676021-67676043 GGCAAAGTGAAGAGGATTCAAGG - Intergenic
1160098054 18:75893835-75893857 CTCAAGAAAAAGAGGAGTCACGG + Intergenic
1162410080 19:10500377-10500399 ATCAAAGGGAAGAGGTGGCAGGG - Intronic
1163256910 19:16161492-16161514 TGCAGAGAGAAAAGGAGTCAAGG + Intronic
1163803615 19:19383262-19383284 CTCAAAAAGAATAGGAGGCTGGG + Intergenic
1165568211 19:36751314-36751336 GTCAAAGCAAAGAGGAGCCAAGG + Intronic
926669090 2:15559214-15559236 TCCAAAGACAAGAGAAGTCAAGG + Intronic
927144191 2:20150671-20150693 ATCAAACAGAAGATGAATCATGG - Intergenic
928647625 2:33371308-33371330 GGGAAGGAGAAGAGGAGTCAGGG - Intronic
930374856 2:50551966-50551988 CTCTAAGAGAGGAGGGGTAAAGG - Intronic
930935150 2:56939954-56939976 CTCTAAGAAAAGATAAGTCAGGG - Intergenic
930968865 2:57369238-57369260 CTCAAAGAAAAGGGAAGTCCAGG - Intergenic
931026929 2:58120649-58120671 CTCTAAGAAAAGAGACGTCAGGG - Intronic
931183633 2:59928619-59928641 CTCACAGAGAAAAAGAGTTAAGG + Intergenic
931645461 2:64417788-64417810 GTTAAGGAGAAGTGGAGTCAGGG + Intergenic
931855620 2:66299180-66299202 GGGATAGAGAAGAGGAGTCAGGG + Intergenic
932771889 2:74505141-74505163 GTGAAAGAGAAGAGGAGGTAGGG - Exonic
934631334 2:95926961-95926983 ATTAAAGACAAAAGGAGTCAGGG - Intronic
934935914 2:98465315-98465337 AGCAGAGAGAAGCGGAGTCACGG - Intronic
934944793 2:98532299-98532321 TTCAGAGAGAGGAGGAGTGATGG - Intronic
935439531 2:103076064-103076086 CCCAGAGAGGAGAAGAGTCAAGG + Intergenic
935578827 2:104737885-104737907 GTCAAAGAGAAGAGAAGCAAAGG - Intergenic
936495797 2:113019754-113019776 ATAAAGGAGAAGAGGATTCAAGG + Intergenic
937754248 2:125516382-125516404 CTCTAAGAGAAGGGGAGTGCCGG + Intergenic
938170691 2:129073187-129073209 CTCTAAGATCAGAGGACTCATGG + Intergenic
938992275 2:136641770-136641792 CTCAATGAGAAAAGAAGTCCTGG - Intergenic
939688029 2:145223687-145223709 CTAAAAGTGAAGAGAAGGCAAGG - Intergenic
941175165 2:162188494-162188516 CTCAAAATCAAGAGGAGTCCAGG + Intronic
941470258 2:165876290-165876312 AGCAAAGAGAGGAGGAGGCAAGG - Intronic
943317290 2:186405802-186405824 CTTAAAGAGAAGAGGATTCCTGG - Intergenic
945224835 2:207523004-207523026 AGCAAAGACATGAGGAGTCAAGG + Intergenic
946043388 2:216801763-216801785 ATCAGAAAGAAGAGGAGGCAAGG - Intergenic
947243674 2:228022688-228022710 CTCTAAGAAAAGGGAAGTCAGGG + Intronic
947859926 2:233351608-233351630 GTCACAGACAAGAGGAGCCAAGG - Intergenic
948355242 2:237372504-237372526 ATCAAAGAGAAGGGGAGCAAAGG + Intronic
1168764339 20:371681-371703 CTCCCAAAGAAGAGGAGACAAGG - Intronic
1169111347 20:3036224-3036246 GTGAAAGAGAAGAGGAGTCAAGG + Intronic
1169538543 20:6574954-6574976 CTCAATGGGCAGAGAAGTCAGGG - Intergenic
1170019709 20:11823471-11823493 CTCTAAGAAAAGGGAAGTCAGGG - Intergenic
1172110113 20:32539595-32539617 AACAAAGAGAAGAGGAGCGATGG - Intronic
1173274172 20:41565050-41565072 ATAAAACAGAAGAGAAGTCATGG + Intronic
1173941387 20:46914043-46914065 CTCAAAACGAAGAGGAGGAACGG - Intronic
1174907203 20:54564044-54564066 CTGAAAGAAAATAGGAGTCTAGG - Intronic
1175407166 20:58742761-58742783 CTCAAGGAGACGAGGAGCCCTGG + Intergenic
1175673888 20:60930823-60930845 CTCAAAGCGAAGAGGACTGCAGG + Intergenic
1176019710 20:62956437-62956459 CTCAAAGAGAACAGGGGAGAGGG - Intronic
1176269406 20:64227906-64227928 TGCAAAGAAAAGTGGAGTCAAGG + Exonic
1176844602 21:13867063-13867085 CTCACTGGGAAGAGGAGCCAAGG - Intergenic
1177710967 21:24773819-24773841 ATCAAAGAAGAAAGGAGTCAAGG + Intergenic
1177859638 21:26437793-26437815 AACAAAGAGGAGAGCAGTCATGG - Intergenic
1178124050 21:29498563-29498585 CTCTGAGAGAATAGGGGTCATGG - Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179032024 21:37729315-37729337 CCCAAAAAGAAGAAGAATCAGGG - Intronic
1182115195 22:27752457-27752479 CTCAATGAAAAGAGGGTTCAGGG - Intronic
1184275182 22:43405821-43405843 CCCAGAGAGAAGAGGACACAGGG + Intergenic
1184448810 22:44570771-44570793 AGCACTGAGAAGAGGAGTCAGGG - Intergenic
1184694639 22:46132685-46132707 CACAAGGAGAAGAGGTGACAAGG + Intergenic
1185004950 22:48270346-48270368 CTCAGAGAGAGGGAGAGTCAGGG - Intergenic
1185122111 22:48977478-48977500 CTCAGAGAAAGGGGGAGTCAGGG + Intergenic
1185221915 22:49633283-49633305 CAGAAAGAGCAGAGGAGGCAGGG - Intronic
1185238121 22:49726337-49726359 CTCAAAGAGAAGCAGGTTCATGG - Intergenic
949201448 3:1384948-1384970 CTCAGAGAGAAGAGGCGACTAGG - Intronic
949343667 3:3056053-3056075 TTCAAAGGGAAGAGGGGCCACGG - Intronic
950626149 3:14248600-14248622 CACCAAGGGAAGAGGAATCAGGG - Intergenic
950778101 3:15367688-15367710 CTCAAACAGAACAGAAGGCAGGG - Intergenic
951363696 3:21754552-21754574 TTGAATGAGATGAGGAGTCAAGG - Intronic
951853496 3:27169401-27169423 GCCAAAGTGCAGAGGAGTCATGG - Intronic
951926280 3:27912082-27912104 CTCATAGAGCAGAGCAGTAAAGG + Intergenic
952743586 3:36757829-36757851 ATGGAAGGGAAGAGGAGTCAGGG - Intergenic
954924225 3:54218162-54218184 CACAAAGAGAAGAGATGTGAAGG - Intronic
955400958 3:58591286-58591308 CTCAATGGGAAGATGAGACATGG + Intronic
956527320 3:70179264-70179286 CTCAAAAAGAAGGGGAACCAAGG - Intergenic
956871209 3:73420149-73420171 CTCCAAGACAGAAGGAGTCATGG - Intronic
957034793 3:75283783-75283805 CTCAAAGAGAAGTGTAGCCCTGG + Intergenic
957119347 3:76069770-76069792 CTCAGAGAGAAGAGGTGTTGCGG + Intronic
957516640 3:81262919-81262941 CTCTAAGAGGAGGAGAGTCAGGG - Intergenic
957742438 3:84289152-84289174 CTTAAAGAGAAGCAGAGTTAGGG - Intergenic
959613517 3:108321244-108321266 TCAAAATAGAAGAGGAGTCAAGG - Intronic
960486207 3:118255679-118255701 CTTAGTGAGAAGAGGAGACAGGG + Intergenic
963240708 3:142999986-143000008 CTCACAGAGAATAGGAGGCCTGG + Intronic
963950661 3:151196493-151196515 ACCAAAGAGAAGAGGACTAAAGG + Intronic
964147447 3:153482640-153482662 CTGCAAGAAAAGAGGAATCAGGG + Intergenic
965209192 3:165762916-165762938 CTTTAAGAAAAGAGAAGTCAAGG + Intergenic
965210334 3:165778637-165778659 CTCACAGTGAAGTGGAGTCAGGG - Intronic
965405390 3:168261655-168261677 CTGGAAGAGAAGAGAAGGCAGGG - Intergenic
966464367 3:180213394-180213416 CTCAAAGAGGGGAAGAGTAACGG - Intergenic
967122937 3:186399713-186399735 TTCAAAGGGAAGTGGAGTCATGG - Intergenic
967264037 3:187674417-187674439 TTAAGAGAGAAGAGGAGCCAGGG + Intergenic
968029069 3:195467255-195467277 GTGTGAGAGAAGAGGAGTCAAGG + Intergenic
968480998 4:833001-833023 CTCAGAGAGAAGCGGGCTCAGGG - Intergenic
968757635 4:2425295-2425317 CTCAGAGAGAAGGGGAGGCCAGG - Intronic
969073301 4:4557162-4557184 CTCAAAGAGGACAGGACCCAGGG - Intergenic
969924578 4:10574306-10574328 CTCACAGAGAAGAGAGTTCAAGG - Intronic
971335961 4:25724418-25724440 CTCAAAGAAAAGAAAAGACAAGG + Intergenic
971671113 4:29559141-29559163 CTCACAGAGATGAGGAGTAGGGG - Intergenic
972739756 4:41878575-41878597 CTCAGAGAGCAGCGAAGTCAGGG + Intergenic
974787439 4:66637389-66637411 CTCGGAGAGAAAAGGATTCAAGG + Intergenic
975933206 4:79552379-79552401 CTCAAAGAAAAGGGAGGTCAAGG - Intergenic
977544606 4:98362668-98362690 CTCAAAGAGATTAGAAGTCAGGG - Intronic
978075521 4:104524483-104524505 CAAAAAGAGAAGAGAAGTCTAGG - Intergenic
979353942 4:119680422-119680444 CTTAAAGAGAAGAGGGATTAAGG + Intergenic
979482675 4:121237750-121237772 GCCAAAAAGAAGAGGAATCAAGG + Intergenic
979647524 4:123088753-123088775 CTGAAGGAGAAGAGGAAGCAAGG - Intronic
981259603 4:142704061-142704083 TTCACAGAGCAGAGGACTCAAGG + Intronic
982038695 4:151373195-151373217 CTCAAGGAAAATAGGGGTCATGG + Intergenic
982105102 4:152004788-152004810 TTCAAAGAGAAGAGGACAGAAGG - Intergenic
982277984 4:153656377-153656399 CTATCAGAGAAGAGGAGACAGGG - Intergenic
983065180 4:163201573-163201595 GTTAAGGAGAAGAGGAGTGAAGG + Intergenic
983615302 4:169697566-169697588 CACAAAGAGAAGAGGATTCCAGG - Exonic
984909247 4:184656558-184656580 TTGAGAGAGAAGAGGAGACATGG + Intronic
985065537 4:186117446-186117468 CTAAGAGAGAAGAGGAGGCGCGG + Intronic
985341180 4:188956272-188956294 GGCAAAGAACAGAGGAGTCAAGG + Intergenic
986412144 5:7492001-7492023 CTGAAAGAGCACAGGTGTCACGG + Intronic
987108015 5:14659975-14659997 CTCACAGCGAAGAGGAGAGATGG - Intergenic
988952890 5:36282801-36282823 CACAAGGAGAAGAGGAATGATGG - Intronic
989183657 5:38602463-38602485 CTCAAAGAGAAGATGATGGAGGG - Intronic
989740267 5:44762795-44762817 CTCCAAGAGCTGAGGAGGCAAGG - Intergenic
990889518 5:60632878-60632900 CTGGAAGTGAAGAGAAGTCAGGG + Intronic
991260106 5:64657905-64657927 ATAATAGAGAAGATGAGTCAAGG + Intergenic
991474134 5:67001989-67002011 CGCACAGAGAAGAGTAATCAAGG - Intronic
992334875 5:75756312-75756334 AGGAAAGAGAAGAGGAATCAGGG - Intergenic
994885524 5:105556399-105556421 CTCTAAGAGAAGAAGAGGAAAGG + Intergenic
995027002 5:107435520-107435542 CTCTGAGAGAAGAGGACTCATGG + Intronic
995190754 5:109317080-109317102 CTCACAGAGCTGAAGAGTCAGGG - Intergenic
996029542 5:118689635-118689657 TTGAGAGAGAAGAGGAGTCCAGG + Intergenic
996337526 5:122400980-122401002 CCCAAGGACAATAGGAGTCAAGG + Intronic
996729804 5:126706010-126706032 TTCAAAGACAAGAGGAGGCCAGG - Intergenic
996962060 5:129263058-129263080 CTCAAAGTGAAGGAGAGACAGGG - Intergenic
997855282 5:137367732-137367754 GTGAAAGAGAAGAGGCATCAGGG - Intronic
997871068 5:137505500-137505522 CTCCAGGAGAAGAGGGGACAGGG - Intronic
997944494 5:138187421-138187443 GGGAAAGAGAAGAGCAGTCATGG + Exonic
998007253 5:138665299-138665321 CTCAGAGAGAACAACAGTCAAGG - Intronic
998587038 5:143438130-143438152 CTGAAAGAGATAAGGAGTAAGGG - Intergenic
998731801 5:145086055-145086077 CAGAAAGAGAAAAGGATTCATGG + Intergenic
998738810 5:145175692-145175714 CTAAAAGAGAGGAAGGGTCAGGG + Intergenic
998795850 5:145818007-145818029 TCCAATTAGAAGAGGAGTCATGG - Exonic
998977801 5:147667626-147667648 CTCTCAGAGAAGAGGTGTGAAGG + Intronic
999922379 5:156335749-156335771 GTCAAAAAGGACAGGAGTCAAGG - Intronic
1000377713 5:160598845-160598867 TCCAAAGACAAGAGGAGGCAAGG + Exonic
1001996159 5:176160903-176160925 CTCTGAGAGAAGTGAAGTCACGG + Intergenic
1002681220 5:180966625-180966647 CTCAAAGAAAAGAACAGCCAAGG + Intergenic
1002876872 6:1218489-1218511 CTAAAACAGAAGAGCAGTCCTGG + Intergenic
1002900716 6:1407657-1407679 CTCCAAGAGAGGAGAAGCCAGGG + Intergenic
1003247063 6:4391397-4391419 CTCAAGGAGAAGAGGAGGACAGG + Intergenic
1003273759 6:4630391-4630413 CACAAAGAGAAGAGGCTTGAAGG + Intergenic
1003492482 6:6635768-6635790 ATCCACGAGAAGAGGAGCCAAGG - Intronic
1003698927 6:8440745-8440767 CTGGGAAAGAAGAGGAGTCATGG - Intergenic
1004145934 6:13066376-13066398 CTGAAAGAGGAGAGGAGGTAGGG + Intronic
1004155137 6:13160939-13160961 CTCTTAGAAAAGAGGAGTGAAGG - Intronic
1004559020 6:16729331-16729353 AGCAAAGAGAAAATGAGTCATGG + Intronic
1004621324 6:17333145-17333167 CTCAAAAAAAAGAAGAGTCAAGG - Intergenic
1004856755 6:19758800-19758822 CTTAAAGAGAAGAGCAGTTTGGG + Intergenic
1006213788 6:32421000-32421022 TTCATACAGAAGAGGTGTCATGG + Intergenic
1006599837 6:35217982-35218004 CTCAAAGAGATGAGAAGGAAGGG - Intronic
1006943919 6:37771554-37771576 CACACAGAGAAGAGGAGAAAGGG - Intergenic
1007986725 6:46214794-46214816 CTGAAAGAGAAGAAGAGGGATGG - Intergenic
1008024082 6:46614353-46614375 TACAAAGAGGAGAGGTGTCATGG + Intronic
1008338791 6:50339228-50339250 AACAAGGAGAAGAGGAGTAAAGG - Intergenic
1008710153 6:54215188-54215210 CTCAATGATCAGAGGAGCCAAGG - Intronic
1008874852 6:56314415-56314437 CTCAATGGGAAGAGGGCTCAAGG - Intronic
1010136402 6:72559163-72559185 CTCTAAGAAAAGGGAAGTCAGGG - Intergenic
1012114996 6:95285642-95285664 CTCTAAGAAAAGGGAAGTCAGGG - Intergenic
1012266165 6:97145837-97145859 CTCAATAGGAAAAGGAGTCAAGG + Exonic
1013139799 6:107321664-107321686 GGCACAGAGAAGAGGAGTGATGG - Intronic
1013868717 6:114729226-114729248 CTCCAAGAAAAGGGAAGTCAGGG + Intergenic
1016282124 6:142430309-142430331 CTCTAAGAGATGAGGACCCAAGG + Intronic
1017178453 6:151526806-151526828 CTCAATGAAAAGAAGACTCAGGG + Intronic
1017501651 6:155031017-155031039 AACAAAGAGAACAGCAGTCAGGG - Intronic
1017556809 6:155580462-155580484 CATAAAGAGAAGAGAATTCAGGG + Intergenic
1017806665 6:157952525-157952547 CTCAAAAAAAAAAAGAGTCAAGG - Intergenic
1017823042 6:158062431-158062453 CTCAAGGAGATGTTGAGTCATGG + Intronic
1018807584 6:167273237-167273259 CCCAAAAAGATGAGCAGTCATGG - Intronic
1020512633 7:9077402-9077424 ATCAAAGAGCAGAGGATACAAGG - Intergenic
1020675973 7:11185564-11185586 CTCTAAGAGAAGGGAGGTCAGGG + Intergenic
1020688063 7:11320084-11320106 CCCAAAGAGGGGTGGAGTCATGG - Intergenic
1020852605 7:13376467-13376489 CTCAAAGAGAGGGGGATTAATGG + Intergenic
1021418869 7:20422226-20422248 CCCAAAGAGAAGTGGAGTGGAGG - Intergenic
1023070316 7:36425027-36425049 CACAGAGAGAAGAGGGCTCAGGG - Intronic
1024414803 7:49094415-49094437 CTCAAAAAGCAAAGGAGTAAAGG - Intergenic
1026210317 7:68298369-68298391 CTCAAGGAAAAGAGGCATCATGG + Intergenic
1026641251 7:72127431-72127453 GTTACAGAGCAGAGGAGTCACGG + Intronic
1027526633 7:79277720-79277742 CTCTAAGAAAAGGGAAGTCAAGG - Intronic
1028600785 7:92598204-92598226 CTTACAGAGAAGAGGAATCTAGG - Intergenic
1028849091 7:95516029-95516051 CTCAAAGGCAAGAGGAGGCCTGG - Intronic
1028996451 7:97105410-97105432 CTCAAAAAAAAGAGGAGGCAGGG + Intergenic
1030388843 7:108900436-108900458 CTCTAAGAAAAGGGCAGTCAGGG - Intergenic
1031510866 7:122648246-122648268 CTCAAGGAGAAAAGGAGCCCAGG - Intronic
1032187347 7:129738285-129738307 ATCAAAATGAAGAGGAGTGAGGG + Intronic
1034054984 7:148024831-148024853 CTCAAAGAAAGGAGAAGGCAGGG - Intronic
1034778369 7:153853171-153853193 CAGACAGAGAAGAGGGGTCAAGG - Intergenic
1035045722 7:155964146-155964168 CTCATAGGTAAGTGGAGTCAGGG + Intronic
1035305009 7:157926547-157926569 CTAAATGAGAAGTGGAGGCAGGG + Intronic
1037141142 8:15521837-15521859 CTTAAAGAGCAGAGCAGTTAAGG - Intronic
1038139224 8:24823799-24823821 CCCTAACAGAAGATGAGTCATGG + Intergenic
1038254818 8:25941614-25941636 CTCAGATGGAGGAGGAGTCATGG - Intronic
1038257796 8:25966648-25966670 CTCAAAGAGGAGATGGGCCAAGG - Intronic
1038523299 8:28252096-28252118 TTTAAGGAGAAGAAGAGTCATGG + Intergenic
1039133653 8:34295842-34295864 CTCTAAGAGAAATGTAGTCAAGG - Intergenic
1039457103 8:37714796-37714818 CCCAAAGAGAAGAACTGTCAGGG - Intergenic
1039619430 8:38983042-38983064 CTCAAAGGTAAGAGAAGTGAAGG + Exonic
1041013995 8:53572442-53572464 CTAAAGGAGAAGAGGTGACAAGG - Intergenic
1041148368 8:54904160-54904182 CTCAAAGAGGAAAGCTGTCAAGG + Intergenic
1041645153 8:60243852-60243874 CTCAGAGAGAAGAGGTGTTAGGG - Intronic
1041786109 8:61636447-61636469 GGCCAAGAGAAGAGGAGACAGGG + Intronic
1042333892 8:67610358-67610380 CTCAAAGAGAAAAAGAGTCTCGG - Intronic
1043072003 8:75648944-75648966 CTAAAAGAGAAGAGAAGGGAAGG - Intergenic
1043451918 8:80376312-80376334 CTCAACTAGAAGGGGACTCATGG + Intergenic
1043522396 8:81060362-81060384 GTCAAAGAGCAGAGCAGCCACGG + Intronic
1043796876 8:84553455-84553477 GTCAATAAGAAGAGGAGTCTTGG - Intronic
1044294516 8:90511741-90511763 CTCTAAGAAAAGAGAGGTCAGGG - Intergenic
1045246300 8:100444378-100444400 CTCAAAGAGAAGCGAAGCAAAGG - Intergenic
1046476754 8:114755399-114755421 CTGCAAGAAAAGAGAAGTCAGGG + Intergenic
1046782901 8:118234260-118234282 TTCAAGGAGAAAAGTAGTCAAGG - Intronic
1048214721 8:132483502-132483524 CATAAAAAGAAGACGAGTCAAGG + Intergenic
1049629866 8:143647918-143647940 AACAAAGGGAAGAGGATTCAAGG + Intronic
1050972968 9:11900327-11900349 CTCTAAGAAAAGGGAAGTCATGG + Intergenic
1051239196 9:15034327-15034349 CACAAAGAGAAGAGGATTCCAGG + Intergenic
1052095698 9:24381093-24381115 AGGGAAGAGAAGAGGAGTCAGGG + Intergenic
1056104502 9:83333598-83333620 CTGAAAAAGAATAGGAGTAAAGG - Intronic
1057561480 9:96131286-96131308 CTCACTGAGAAGAGGGATCAGGG + Intergenic
1057719468 9:97520313-97520335 TCCTAAGAGAAGAGGTGTCAGGG - Intronic
1059399358 9:114059220-114059242 CCCACAGAGAAGAGGAGGTAGGG + Intergenic
1060526435 9:124323768-124323790 CTGAGAGAGAAGAGGAGACATGG + Intronic
1062357004 9:136169830-136169852 GTGAAAGAGAAGAGAGGTCAGGG + Intergenic
1187526377 X:20058771-20058793 TTCTAAGAGAAGAGGATTTATGG + Intronic
1187797455 X:23019911-23019933 CTCAAACAGAAGGGGAAACAGGG + Intergenic
1188866771 X:35322975-35322997 CTGAAAGAGAAAAGTAATCACGG + Intergenic
1189033880 X:37476701-37476723 CCTAAAGAGAAGAGAAATCATGG + Intronic
1189770680 X:44423321-44423343 GACACAGAGAAGAGGAGGCAAGG - Intergenic
1190401002 X:50034887-50034909 CTGGAAGAGAAGAGGAGGAAAGG - Intronic
1190618839 X:52265255-52265277 TTAAAGGAGAAGAGGAGGCAAGG - Intergenic
1190780730 X:53592455-53592477 CTCGAGGAGAAGAGGATACAGGG - Exonic
1191931747 X:66380952-66380974 CTCAAAGATAAGACAAGTGATGG - Intergenic
1192730263 X:73795951-73795973 CACAACCAGAAGAGGAGGCATGG + Intergenic
1193310197 X:79998841-79998863 GCCAAAGAGAAGATGAGACATGG + Intergenic
1193488496 X:82117098-82117120 CTGAAAGAGTAGAGGAGCTATGG + Intergenic
1197248488 X:124190520-124190542 CACATATGGAAGAGGAGTCAGGG + Intronic
1197797981 X:130318449-130318471 CTCAAAGAAACGAGGAGACTTGG - Intergenic
1198275660 X:135095709-135095731 CTGGAGGAGAAGAGGAGTGAGGG - Intergenic
1198392843 X:136193787-136193809 CTCAGAGAAGAGAGGAGGCAGGG - Intronic
1202279034 Y:23158779-23158801 CTAAATAAGAAGAGGAGTAAAGG - Intronic
1202285400 Y:23238050-23238072 CTAAATAAGAAGAGGAGTAAAGG + Intronic
1202285703 Y:23242830-23242852 CTAAATAAGAAGAGGAGTAAAGG + Intronic
1202323158 Y:23657720-23657742 CTCAAAGAAAAGAAGAAGCAAGG + Intergenic
1202547614 Y:26012334-26012356 CTCAAAGAAAAGAAGAAGCAAGG - Intergenic
1202576614 Y:26333781-26333803 TTCAAAGTGAAAAGGAGACATGG - Intergenic