ID: 915430032

View in Genome Browser
Species Human (GRCh38)
Location 1:155859493-155859515
Sequence GCCTTCTTCCGAATGGTCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915430032_915430035 -3 Left 915430032 1:155859493-155859515 CCGAGGACCATTCGGAAGAAGGC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 915430035 1:155859513-155859535 GGCGGAGCCTACCTCTCATCAGG 0: 1
1: 0
2: 0
3: 0
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915430032 Original CRISPR GCCTTCTTCCGAATGGTCCT CGG (reversed) Exonic
902934474 1:19754872-19754894 TCATTCTTCCTAATGATCCTGGG + Intronic
903740860 1:25557598-25557620 GCCTTCTGGTGATTGGTCCTCGG + Intronic
915430026 1:155859460-155859482 CGCCTCTTCCGAATGGTCCTCGG - Intergenic
915430032 1:155859493-155859515 GCCTTCTTCCGAATGGTCCTCGG - Exonic
917070315 1:171143166-171143188 GCCTTCTTCTGTGTGGTCCTAGG - Exonic
922204730 1:223436413-223436435 GACTTCTTGCAAATCGTCCTTGG - Intergenic
923305847 1:232687349-232687371 GCTTTCTTCCGAATGAGCCTTGG - Intergenic
1065800680 10:29349027-29349049 GCCTTCTTCTGAATGGCTGTCGG - Intergenic
1073941690 10:108706539-108706561 GCCTGCTTCCCAATGATTCTGGG + Intergenic
1075399515 10:122150886-122150908 GCCACCTTCCGAATAGTCCGTGG - Intronic
1081707930 11:45196545-45196567 GCCTTTTTATGAATGGTCTTGGG - Intronic
1085391941 11:76186688-76186710 GCCTTCTTCAGAATGTTCTGCGG - Exonic
1087054688 11:93922126-93922148 CCCTTCCTCAGAAGGGTCCTAGG + Intergenic
1087333582 11:96814393-96814415 GCTTTTTTCCGTATGTTCCTTGG - Intergenic
1088593159 11:111420441-111420463 GCCTTCTTCCTCCTGATCCTTGG - Intronic
1091095668 11:132819926-132819948 GCCTTCTCCCCCAGGGTCCTGGG + Intronic
1091664773 12:2411328-2411350 GCCTTGTCCCTAAAGGTCCTAGG - Intronic
1092002604 12:5044425-5044447 GCCTTCTTCCTCCTCGTCCTCGG - Exonic
1100959242 12:99944376-99944398 GCCTCCTTCCCAGTGGCCCTTGG + Intronic
1101121424 12:101584534-101584556 ATCTTCTTCCAAATGGTCATTGG + Intronic
1101897661 12:108768584-108768606 GCCTTCTTCCTGTTGGACCTTGG + Intergenic
1102816865 12:115873084-115873106 TCTTTCTTCTGAATGGTGCTGGG - Intergenic
1103722001 12:122980242-122980264 GCTTCCTTCCGGATGGGCCTGGG + Exonic
1104669920 12:130673527-130673549 GCCTTCTTCCCAAAGCTCCGTGG - Intronic
1106110214 13:26770713-26770735 GCCTTTTCCAGAATGTTCCTAGG - Intergenic
1108208758 13:48117501-48117523 TCCTTCTTCCCAATGATTCTAGG - Intergenic
1115162635 14:30413201-30413223 GCCGTCTTCTCTATGGTCCTGGG - Intergenic
1125347742 15:38735782-38735804 GCCTTCTTCTGAAAGGTCTTAGG + Intergenic
1125937385 15:43648824-43648846 GCGTTGCTCCGCATGGTCCTGGG - Exonic
1129542741 15:76364287-76364309 GCCTTCTTCCCGGTGGTCCCAGG + Intronic
1134807921 16:17141352-17141374 CCCTGCTTCCGAATGAACCTGGG + Exonic
1137470948 16:48758116-48758138 ACCTTCTTCCAAATGATACTAGG - Intergenic
1140908250 16:79428532-79428554 TCCTTCTTCCTAAAGGTCATGGG + Intergenic
1141724525 16:85778445-85778467 GTCTTGTTCCGAATGGGCTTGGG - Intronic
1142132932 16:88439003-88439025 GCCTGCTTCCGAGGGGTCCGGGG - Exonic
1144581435 17:16461594-16461616 GTCTTCTTCCTACTGGCCCTGGG - Intronic
1146059125 17:29595380-29595402 GCCTTCTGCCTAGTGATCCTTGG - Intronic
1149413989 17:56439132-56439154 CTCTTCTTCAGAATGTTCCTGGG - Intronic
1155699502 18:28726010-28726032 GACCTCTTCCAAATGGGCCTTGG - Intergenic
1162577258 19:11506220-11506242 GTCTTCTTCCTGGTGGTCCTCGG + Exonic
1167087516 19:47320384-47320406 GCCATCGTCCGGCTGGTCCTGGG + Exonic
1167109199 19:47448905-47448927 GCCTTGTGCCGAGTGGTGCTGGG + Intronic
926092315 2:10058889-10058911 CCCCTCTTCCGAGTGGTCGTAGG + Exonic
931188575 2:59977504-59977526 GCCATCCTCCGAATGGTCTATGG - Intergenic
935148950 2:100417016-100417038 GCCTTCCTCTGCATGCTCCTTGG + Intronic
947478725 2:230477357-230477379 GCCTTTTTCTGACTGGTTCTTGG + Intronic
1170320861 20:15096319-15096341 CCCTTTTTCCGAATGGGCTTTGG + Intronic
1175301762 20:57947953-57947975 GCCTCATTCCGAATGCTGCTGGG - Intergenic
1180198783 21:46212643-46212665 GGCTTCTTCTTAAAGGTCCTGGG - Intronic
1180696318 22:17753737-17753759 GCCGTCTTCCCACTGGCCCTTGG - Intronic
1183933429 22:41248786-41248808 GCCTTGTTCTGGAGGGTCCTGGG - Intronic
1183952880 22:41361693-41361715 GCCTCCTTCCTGAGGGTCCTTGG - Intergenic
949269529 3:2198189-2198211 GTCTTCTTGCTAATGCTCCTTGG + Intronic
951763888 3:26175348-26175370 GACTTCTTCAGAAAGTTCCTAGG - Intergenic
952152238 3:30606248-30606270 GCTTTCTTCAGATTGCTCCTAGG - Intergenic
952814661 3:37436695-37436717 GCCTTCTTCCTCTTGGTTCTTGG + Intergenic
959507395 3:107171308-107171330 GGCTTCTTCCACATGGTGCTGGG + Intergenic
961342058 3:126232079-126232101 GCCTTCTTCCTAATGTTAGTGGG + Intergenic
963357681 3:144230563-144230585 TCATTCTTCCTAATGTTCCTGGG + Intergenic
981927484 4:150155754-150155776 GCCCTCTTCCCATTGCTCCTAGG - Intronic
993648171 5:90484694-90484716 GACTTCCTCCGAGTGGTCCAGGG + Intronic
995041017 5:107588011-107588033 GCCTTCTTCCCAATTTTTCTGGG - Intronic
995770148 5:115660513-115660535 GCCTTCTTCCCAGTGGTTTTAGG - Intergenic
998175720 5:139900839-139900861 GCCTTCTTCCCCTTGGTGCTGGG - Intronic
1000656473 5:163885269-163885291 GCCATCTGCCGAATGGCTCTTGG + Intergenic
1003623708 6:7725018-7725040 GCCTTAGTCCAAATGGTCCTAGG - Intergenic
1006913644 6:37580410-37580432 GCCTTCCTCCAAATGGCCCAAGG - Intergenic
1007574442 6:42916051-42916073 GCCTCCTTCCGAGTGGGCCATGG + Exonic
1010231073 6:73535919-73535941 GCCGTCTTCCTAATGTGCCTTGG + Intergenic
1018414705 6:163591001-163591023 GCGTTCTTCCAGATGGTCCTGGG + Intergenic
1031350869 7:120729425-120729447 GCCTTCTTCCTCATACTCCTTGG - Intronic
1034912479 7:155008633-155008655 GCTTTCTTCCAAATGGGACTTGG + Intergenic
1045168254 8:99631352-99631374 GCCTTCCTTTGAATGGTTCTCGG + Intronic
1049228658 8:141470696-141470718 GGCTCCGTCCGAATGGGCCTGGG + Intergenic
1057809711 9:98248440-98248462 GCCTTCTTCCCACTGGTGGTGGG - Intronic
1061579780 9:131529940-131529962 GCCTTCTTCCCACAAGTCCTTGG + Intronic
1062290641 9:135792794-135792816 GCTTCCTTCAGAAAGGTCCTCGG - Exonic
1190343437 X:49315736-49315758 GACTTGGTCCGGATGGTCCTTGG + Intronic
1190622738 X:52304403-52304425 GCCTTCTTCAGAATTGTTTTTGG + Intergenic
1200007047 X:153093708-153093730 GCCCTCCTCCAAATGCTCCTTGG + Intergenic
1200409839 Y:2850252-2850274 GCCTTGTGCCCAAAGGTCCTCGG - Intronic