ID: 915431410

View in Genome Browser
Species Human (GRCh38)
Location 1:155869693-155869715
Sequence TTGTATTAGAAGAGGGACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 116}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915431403_915431410 -9 Left 915431403 1:155869679-155869701 CCTGTCCTCCCTCTTTGTATTAG 0: 1
1: 1
2: 1
3: 15
4: 209
Right 915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG 0: 1
1: 0
2: 0
3: 10
4: 116
915431398_915431410 20 Left 915431398 1:155869650-155869672 CCATAGACACTTCCCCTCTCTCC 0: 1
1: 1
2: 1
3: 30
4: 402
Right 915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG 0: 1
1: 0
2: 0
3: 10
4: 116
915431399_915431410 8 Left 915431399 1:155869662-155869684 CCCCTCTCTCCATTTCTCCTGTC 0: 1
1: 0
2: 15
3: 118
4: 1304
Right 915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG 0: 1
1: 0
2: 0
3: 10
4: 116
915431402_915431410 -1 Left 915431402 1:155869671-155869693 CCATTTCTCCTGTCCTCCCTCTT 0: 1
1: 0
2: 19
3: 273
4: 2042
Right 915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG 0: 1
1: 0
2: 0
3: 10
4: 116
915431397_915431410 26 Left 915431397 1:155869644-155869666 CCTTTGCCATAGACACTTCCCCT 0: 1
1: 0
2: 1
3: 15
4: 202
Right 915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG 0: 1
1: 0
2: 0
3: 10
4: 116
915431401_915431410 6 Left 915431401 1:155869664-155869686 CCTCTCTCCATTTCTCCTGTCCT 0: 1
1: 1
2: 14
3: 166
4: 1492
Right 915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG 0: 1
1: 0
2: 0
3: 10
4: 116
915431400_915431410 7 Left 915431400 1:155869663-155869685 CCCTCTCTCCATTTCTCCTGTCC 0: 1
1: 0
2: 12
3: 186
4: 1674
Right 915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG 0: 1
1: 0
2: 0
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915431410 Original CRISPR TTGTATTAGAAGAGGGACGA GGG Intronic
901499229 1:9641350-9641372 TTGTATCAGAAGCAGGACTAGGG + Intergenic
905745995 1:40417820-40417842 TTATTTTGGAAGAGGGAAGAAGG - Intronic
908291710 1:62673880-62673902 TTGTACTGGAAGAGGGAGGGAGG + Intronic
908916224 1:69129638-69129660 TTTTATTAAAAGAGGGGTGAGGG + Intergenic
911820658 1:102415680-102415702 TTGTCTTACAAGAGGAAAGAAGG + Intergenic
915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG + Intronic
919392314 1:197002620-197002642 TTGTATGTAAAGATGGACGATGG + Exonic
1071167525 10:82823717-82823739 TTGTCTGAGATGAGGGAAGAGGG - Intronic
1072419659 10:95279426-95279448 CTGTATTAGAAGAGTCAAGAAGG - Intronic
1075173562 10:120138448-120138470 TTGGCTTTGAAGAGGGAGGAAGG + Intergenic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1081655079 11:44851648-44851670 ATGTATGAGAAGAGAGAGGAGGG - Intronic
1081729763 11:45362180-45362202 TTGTATTCTAAGAGTGATGAGGG - Intergenic
1083994988 11:66267401-66267423 TACCACTAGAAGAGGGACGAGGG - Exonic
1084743998 11:71155982-71156004 TTTTATCAGAAGAGGGACTCTGG + Intronic
1089691761 11:120191260-120191282 TTGTCTTTGAAGCGGGAGGAGGG + Intergenic
1091424709 12:377010-377032 TTGTTTTAGAAAAGGGAGGAAGG - Intronic
1091858338 12:3756778-3756800 TGGTATAAGAAGAGGCAGGAAGG + Intronic
1095732209 12:45518591-45518613 TTTTACTAGAAGAGGGAAGCCGG + Intergenic
1097331656 12:58338310-58338332 TTTTGATAGAAGAGGGAAGAAGG - Intergenic
1101136314 12:101747378-101747400 TTGTTTTGGAAGAGGAATGATGG - Intronic
1106527433 13:30553891-30553913 TTGACATAGAAGAGGCACGAAGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1109349114 13:61154085-61154107 TTGTCTTAGAAGATGGAGGAAGG + Intergenic
1109383069 13:61590469-61590491 TTGTTTTAGATGAGGAATGAAGG - Intergenic
1111002147 13:82198330-82198352 TTGTAATAGAAGATGGAGGATGG + Intergenic
1111726432 13:92015446-92015468 TTGTAGGAGAAGAGGGACCTGGG - Intronic
1111787970 13:92815414-92815436 TTGTATTAGAGGAAGAGCGAGGG + Intronic
1113201400 13:107870125-107870147 TTGGATTTTAAGAGGGACTAGGG + Intergenic
1115530611 14:34323580-34323602 TTCTACTAGAAGACGGAGGAAGG - Intronic
1117086157 14:52203540-52203562 TTTTATTAGAAGGGAGACAATGG + Intergenic
1120325417 14:83018651-83018673 TTATATTAGAGGAGGGAGGGTGG - Intergenic
1123413541 15:20078965-20078987 TTGTAGTATAAGAGGAAGGAAGG + Intergenic
1123522883 15:21086077-21086099 TTGTAGTATAAGAGGAAGGAAGG + Intergenic
1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG + Intronic
1126874698 15:53028612-53028634 TTGGATTAGAAGAGTGGCAATGG - Intergenic
1134340377 16:13339539-13339561 TTTTATTAAAAGAAGCACGAGGG - Intergenic
1139608808 16:68039978-68040000 TTGTAGTATAAGAGGAAGGAAGG + Intronic
1140183725 16:72747246-72747268 TTTAATTAGAAGAGGAACAAAGG + Intergenic
1143813131 17:9488607-9488629 TTGTCTTTGAAGACGGAGGAAGG + Intronic
1146115151 17:30130038-30130060 TTCTATTAGAAGTGGGGAGATGG + Intronic
1148577599 17:48722772-48722794 TTTTATGGGAAGAGGGAGGAAGG - Intergenic
1149262330 17:54893540-54893562 TGGTATTAGAAGAGAAAAGAAGG + Intergenic
1150612472 17:66744965-66744987 TTGTAGGAGAAGAGGGAGGCTGG - Intronic
1152307587 17:79530331-79530353 ATTTATTCGCAGAGGGACGAGGG - Intergenic
1154103241 18:11496472-11496494 TTGTATCATAAGAGGGAGAAGGG - Intergenic
1155666527 18:28315987-28316009 GTGTATTAGATGAGGCACAATGG + Intergenic
1156553861 18:38045832-38045854 TGGAATTAGAAGAGGGACCAGGG + Intergenic
1161646054 19:5454130-5454152 TTGTCCCATAAGAGGGACGAGGG + Intergenic
1165810167 19:38607258-38607280 TTGTATAAGAAGATGGAAGGAGG + Intronic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
929136116 2:38625311-38625333 TTGCATGAGAAGAGGGCTGAAGG - Intergenic
929819067 2:45259013-45259035 TTGTATTAGAACATGGACTCAGG - Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
933076606 2:77935810-77935832 GTGTTTCAGAAGAGGGAGGATGG + Intergenic
934537874 2:95151301-95151323 TTGGCTTTGAAGATGGACGAGGG + Intronic
941584764 2:167343828-167343850 CTGTATTAGAAGGGGAAAGATGG + Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
944256860 2:197631963-197631985 TTTAATTAGAAGAGGGAGAATGG - Intronic
948056220 2:235010914-235010936 TTCTCCTAGAAGAGGGAGGAAGG - Intronic
948056229 2:235010959-235010981 TTCTCCTAGAAGAGGGAAGAAGG - Intronic
948056244 2:235011025-235011047 TTCTCCTAGAAGAGGGAGGAAGG - Intronic
1170488195 20:16841982-16842004 TTGTTTTAGAAGAATGACAAGGG - Intergenic
1172430109 20:34883208-34883230 TTGTAGTTGAAGAGGGAGAAAGG + Intronic
1174628764 20:51938161-51938183 TTGTCTCTGAAGAGGGAAGATGG - Intergenic
1174839278 20:53886362-53886384 TTGAATTACAAAAGGGAGGAGGG - Intergenic
1179326905 21:40355582-40355604 TTGAATTAGAAGAGAGAGCAGGG - Intronic
1179471664 21:41614424-41614446 TTGGCTTTGAAGAGGGAGGAAGG + Intergenic
1179503911 21:41827291-41827313 TTTTTTTAAAAAAGGGACGAAGG + Intronic
1180931119 22:19592640-19592662 TTCTGATAGAAGAGGGACGGTGG - Intergenic
1181021371 22:20105175-20105197 TTCTCTAAGAAGAGGGAGGAGGG + Intronic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
1183318785 22:37151733-37151755 TTGTATATGAAGAGAGATGAGGG + Intronic
1185086303 22:48742771-48742793 GTGTATTAGAAGAGGAGAGATGG + Intronic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951547432 3:23841901-23841923 TTCTATTAGGAGAGAGATGAAGG + Intronic
954089709 3:48274457-48274479 GTGTATTAGGAGGGGGACTAGGG - Intronic
963386551 3:144602366-144602388 TCGTATTTGAAGATGTACGATGG + Intergenic
964427738 3:156571056-156571078 TTGAATTAGAAGTGAAACGAGGG - Intergenic
967171037 3:186824003-186824025 TTGTGTTAGGAGAGGGCTGAAGG + Intergenic
967612730 3:191526911-191526933 TTGTTCTAGGTGAGGGACGAGGG - Intergenic
969970054 4:11037609-11037631 TTGAATCAGAAGAGGGAAGCAGG + Intergenic
979139693 4:117155536-117155558 TTGTATTCCAAGTGGGAAGAAGG - Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
986384536 5:7218649-7218671 TTTTCTTAGAAAAAGGACGAAGG + Intergenic
989709044 5:44374153-44374175 TTGTCTTTGAAGATGGACAAAGG - Intronic
996326611 5:122281936-122281958 TTGTATAAGGTGAGAGACGAGGG + Intergenic
997422664 5:133781441-133781463 TTGTCTTAGAAGGGGTAGGAAGG + Intergenic
998606759 5:143643244-143643266 TTGTATTAGAAGAGTGTGGTAGG + Intergenic
1003157512 6:3608857-3608879 TGGTACTAGAAGAGGGAGGAAGG + Intergenic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1005092946 6:22078398-22078420 TTGTATTAGGAGAAGCATGATGG - Intergenic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1009766901 6:68089364-68089386 TTGTTGTAGAAGGGGGATGATGG - Intergenic
1011194279 6:84766024-84766046 TTGAATTAAACGAGGGACGAGGG - Intergenic
1015868086 6:137747970-137747992 TTTTCTTAGAAGAGGGAAGCAGG + Intergenic
1015879600 6:137857870-137857892 TTGGATTTGAAGAGGAACCATGG + Intergenic
1017015252 6:150094667-150094689 TTGTCTTGGAAGAAGGACTATGG + Intergenic
1020014882 7:4825100-4825122 TTGTTCTAGAAGAGGGCAGAGGG + Intronic
1021527448 7:21604736-21604758 TTGTGTTTGAAGAGGGATAAGGG + Intronic
1024762226 7:52612435-52612457 TTGTATAAGAAGAGGGAATGAGG - Intergenic
1026132194 7:67629936-67629958 TTGTATGGGAGGAGGGAGGAAGG - Intergenic
1027564786 7:79777983-79778005 TTGTGTTAGAATTGGGATGAAGG - Intergenic
1028583934 7:92434696-92434718 TTGTCTTTGAAGATGGAAGAAGG + Intergenic
1030286546 7:107832743-107832765 TTGTAAGAGATGAGGGACTAAGG + Intergenic
1033389430 7:140912453-140912475 CTGTCTTAGAAGAGGTAAGAGGG - Intronic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1041056147 8:53988580-53988602 TGGTATAAGGAGAGGGATGAAGG + Intronic
1043591269 8:81835942-81835964 TTGTCTCAGATGAGGGACAAGGG - Intronic
1045183252 8:99809712-99809734 TTGTAAAAGAAGTGGGACAAAGG - Intronic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1049856405 8:144864689-144864711 GTGTGGTAGAAGAGGGACTATGG + Intergenic
1052463502 9:28798561-28798583 TGGTTTGAGAAGAGGGAGGAAGG + Intergenic
1055061200 9:72070882-72070904 TTGTATAAGGTGAGAGACGAGGG - Intronic
1059028020 9:110658106-110658128 TTGTATTATAAGAGGAACCAAGG + Intergenic
1185527602 X:791754-791776 TTGCATTTGAACAGGGACGTAGG + Intergenic
1187208172 X:17202670-17202692 TTGTAAGAGAACAGGGACAACGG - Intergenic
1187378533 X:18779265-18779287 GTGTATTGGAAGAGGGATGAGGG + Intronic
1188153782 X:26715410-26715432 TTAAATTAGTAGAGGGACTAGGG - Intergenic
1193142344 X:78041222-78041244 ATTTATTAGAAGAGGGGAGAAGG - Intronic
1193819015 X:86139424-86139446 TAGTAGTAGAAAAGGGAAGAGGG - Intergenic
1193992355 X:88323609-88323631 TAGTATCAGAAGAGGGAAGGTGG - Intergenic
1194701924 X:97124928-97124950 TTGTATTAGGGGAAGGACCAAGG + Intronic
1195115314 X:101691979-101692001 TTCTTTTAGAACAGGGACAATGG - Intergenic
1199539843 X:148946744-148946766 TGGTGTTTGAAGATGGACGAAGG - Intronic