ID: 915447931

View in Genome Browser
Species Human (GRCh38)
Location 1:155984753-155984775
Sequence TCTCTGGTGACAGGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 386}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915447921_915447931 27 Left 915447921 1:155984703-155984725 CCCAATACTCCATCTTGAGGACA 0: 1
1: 0
2: 0
3: 10
4: 163
Right 915447931 1:155984753-155984775 TCTCTGGTGACAGGGGAGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 386
915447922_915447931 26 Left 915447922 1:155984704-155984726 CCAATACTCCATCTTGAGGACAA 0: 1
1: 0
2: 0
3: 14
4: 157
Right 915447931 1:155984753-155984775 TCTCTGGTGACAGGGGAGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 386
915447924_915447931 18 Left 915447924 1:155984712-155984734 CCATCTTGAGGACAAGGTATATT 0: 1
1: 0
2: 2
3: 15
4: 129
Right 915447931 1:155984753-155984775 TCTCTGGTGACAGGGGAGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915447931 Original CRISPR TCTCTGGTGACAGGGGAGGC TGG Intronic