ID: 915449488

View in Genome Browser
Species Human (GRCh38)
Location 1:155994726-155994748
Sequence ATGGCACAGGGCCCATTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915449488_915449496 17 Left 915449488 1:155994726-155994748 CCTACAAATGGGCCCTGTGCCAT 0: 1
1: 0
2: 1
3: 10
4: 107
Right 915449496 1:155994766-155994788 AACAGGATGAGCAGATCTACAGG 0: 1
1: 0
2: 0
3: 9
4: 116
915449488_915449495 0 Left 915449488 1:155994726-155994748 CCTACAAATGGGCCCTGTGCCAT 0: 1
1: 0
2: 1
3: 10
4: 107
Right 915449495 1:155994749-155994771 CAGGTATGTTGGGTACAAACAGG 0: 1
1: 0
2: 1
3: 5
4: 98
915449488_915449493 -10 Left 915449488 1:155994726-155994748 CCTACAAATGGGCCCTGTGCCAT 0: 1
1: 0
2: 1
3: 10
4: 107
Right 915449493 1:155994739-155994761 CCTGTGCCATCAGGTATGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 110
915449488_915449497 24 Left 915449488 1:155994726-155994748 CCTACAAATGGGCCCTGTGCCAT 0: 1
1: 0
2: 1
3: 10
4: 107
Right 915449497 1:155994773-155994795 TGAGCAGATCTACAGGAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915449488 Original CRISPR ATGGCACAGGGCCCATTTGT AGG (reversed) Intronic
900846791 1:5110375-5110397 ATGGAGCAGGGACCTTTTGTTGG + Intergenic
905815196 1:40944620-40944642 CTGGCACAGCGCCTATTTGTTGG + Intergenic
906566538 1:46805071-46805093 CTGGCACAATGCCCATGTGTTGG + Intronic
909931793 1:81505324-81505346 CTGGCACTGGGCCCATTTGAAGG + Intronic
911899018 1:103477422-103477444 AAGGCAAAGGATCCATTTGTAGG + Intergenic
915449488 1:155994726-155994748 ATGGCACAGGGCCCATTTGTAGG - Intronic
917890115 1:179428514-179428536 ATGGCCCAGGGACCCCTTGTGGG + Intronic
918393341 1:184089368-184089390 ATGGCTAAGGCCCTATTTGTTGG + Intergenic
920403971 1:205695327-205695349 ATTGGAGAAGGCCCATTTGTGGG - Intergenic
1063326458 10:5108269-5108291 GTGTCACAGGGCCCACTTGGGGG - Intronic
1071165204 10:82798471-82798493 ATAGCACAGAGCTAATTTGTAGG + Intronic
1073192418 10:101661239-101661261 CTGGCCCAGAACCCATTTGTGGG - Intronic
1074830325 10:117243499-117243521 ATGGCACAGGGCTCCTGTTTTGG + Intronic
1079292693 11:19202370-19202392 ATGGCACATGACTCATTTGCAGG - Intronic
1084273426 11:68040543-68040565 AGGGCCCAGGGCCCCTCTGTGGG - Intronic
1086319580 11:85630749-85630771 ATGGCACTGGGCTCCTTGGTCGG - Intronic
1089533757 11:119148875-119148897 ATGGCAAAGGGCCGACTTGGAGG - Intergenic
1090069017 11:123527358-123527380 AGGGAACAGGGCCCTTTAGTGGG + Intronic
1096941592 12:55352380-55352402 TTGGCACAGGGCTTATTTGTTGG - Intergenic
1099184295 12:79500646-79500668 ATGTCACTGGTCCCATTTCTAGG + Intergenic
1101829941 12:108249241-108249263 ATAGCAAAGGACCCATTTGTAGG - Exonic
1103853192 12:123946650-123946672 CTGGCACCAGGCCCATTCGTGGG - Intronic
1107083129 13:36396254-36396276 ATGGGACAGGGCCTGGTTGTAGG - Intergenic
1107342052 13:39417822-39417844 CAGACACAGGGCCCATTTGATGG - Intronic
1108517912 13:51220468-51220490 ATTGCACCTGGCCCATTTTTTGG - Intergenic
1109746192 13:66625951-66625973 ATGGCACCTGGCCTATATGTTGG + Intronic
1120800353 14:88681468-88681490 ATAGAACTGAGCCCATTTGTAGG - Intronic
1122152786 14:99733759-99733781 ATGGCAGCGGGCACATGTGTGGG - Intergenic
1124590617 15:31050159-31050181 ATGACTCAGGGCCCCTCTGTGGG + Intronic
1128148467 15:65346177-65346199 GGGGCACAGTGCCCATTAGTGGG - Intronic
1129295454 15:74597629-74597651 CTGGCACTGGGCCCATTTGAAGG + Exonic
1129885882 15:79036622-79036644 AGGGCACAGGGGCCAGTTGATGG + Intronic
1131319951 15:91378073-91378095 ATGGCAAAGATCCCAATTGTTGG + Intergenic
1133477554 16:6138167-6138189 ATGACTTAGGGCCCATTTGATGG + Intronic
1134651396 16:15911682-15911704 ATAGCACAGGGCACAATTTTGGG + Intergenic
1135059979 16:19263200-19263222 TTGGCACAGGGCTCCTTTTTGGG - Intronic
1137427565 16:48392401-48392423 ATGGCTCATGGCCCCTTTCTGGG - Intronic
1140802302 16:78499581-78499603 CTGGCCCAGGGCCCCTTTGCCGG + Intronic
1141843084 16:86586983-86587005 ATGCCACTGGGTGCATTTGTAGG + Intergenic
1142033283 16:87848958-87848980 ATAGCACAGGGCCCACCTGGGGG + Intronic
1144829081 17:18121695-18121717 ATGGCACAGGGCCCAGGAGCTGG - Exonic
1151420073 17:73991241-73991263 TTGGCACTGGGCCCACCTGTTGG - Intergenic
1153813088 18:8769183-8769205 ATGCCCAAGGGCCCATCTGTAGG + Intronic
1155095076 18:22547903-22547925 ACTGCACAGGGCCCATGTGATGG - Intergenic
1156104456 18:33641446-33641468 ATAGGAAAGGGCCCAATTGTAGG + Intronic
1156921989 18:42533259-42533281 ATGGCAGGGGGCCCATCTCTTGG - Intergenic
1163695616 19:18761898-18761920 AGGGCCCAGGGCCCAGGTGTGGG - Intronic
1164570653 19:29372159-29372181 ATGGCACAGGGCTCCATTCTCGG + Intergenic
1168504869 19:56925056-56925078 ATGGCACTGGCCCCATTTCAAGG - Intergenic
928106242 2:28472299-28472321 AAGCCACAGGGCCCATGTGTGGG - Intronic
929686595 2:44040354-44040376 ATGGCAAAAGGCACAGTTGTGGG + Intergenic
933969590 2:87459539-87459561 ATGGCACAGGGGGAATTTGCAGG - Intergenic
935872500 2:107466418-107466440 AAGACAGAGGGACCATTTGTTGG + Intergenic
938228148 2:129635598-129635620 AAAGCACAGGGCCCCTTTCTGGG + Intergenic
941658738 2:168172313-168172335 ATGTCACAGGACACATCTGTTGG + Intronic
942914586 2:181288407-181288429 ATGGCCCAGTGCCTCTTTGTTGG + Intergenic
944265787 2:197724798-197724820 ATACCACAGGTCCCATTTGATGG + Intronic
945683283 2:212938704-212938726 TTGGCTTAGGGCCCATTTGTAGG - Intergenic
945683370 2:212939446-212939468 TTGGCTTAGGGCTCATTTGTAGG + Intergenic
946900583 2:224368054-224368076 GTGGCTCTGGGTCCATTTGTTGG - Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1170443106 20:16398486-16398508 ATGGCACAGGGAAGACTTGTGGG - Intronic
1173205051 20:40986220-40986242 ATGGCCCAGGGACCATTTTGGGG + Intergenic
1173205236 20:40987643-40987665 ATGGCCCAGGGACCATTTTGGGG - Intergenic
1174513146 20:51071116-51071138 ATGAAACAGGGCTCCTTTGTGGG + Intergenic
1178150514 21:29788983-29789005 AGGCCACATGGCCCATTGGTTGG + Intronic
1182838307 22:33362588-33362610 TGAGCACAGAGCCCATTTGTAGG - Intronic
1183187514 22:36300443-36300465 AGGGCCCAAGCCCCATTTGTAGG + Intronic
1184206225 22:43005437-43005459 TTGGCACCTGGCCCTTTTGTTGG - Intronic
1184333788 22:43841536-43841558 AGGGCTGAGGGGCCATTTGTGGG - Intronic
949415970 3:3814397-3814419 ATGGCAAGGGACCCATTTATGGG - Intronic
950500231 3:13359027-13359049 ATGGCTCAGGGCCCATCTTGAGG + Intronic
951403256 3:22261753-22261775 AGGCCACAGAGCCCATCTGTTGG + Intronic
951888363 3:27546437-27546459 CTGGCAAAGTGCCCATTTATGGG - Intergenic
953542313 3:43832738-43832760 ATAGCACAGGACCCATTTAAAGG - Intergenic
954720493 3:52558051-52558073 TGGGCCCAGGGCCCATTTCTGGG + Intronic
955860605 3:63325795-63325817 CTTGCACAGGGTCCAGTTGTGGG - Intronic
961110833 3:124281686-124281708 ATGGAACAGGGACAATTTGAGGG - Intronic
963842149 3:150118830-150118852 ATGGCCCAGGGCACATATTTTGG + Intergenic
975715023 4:77197298-77197320 ATGTCAGAGGGCCCGTTTGTAGG - Intronic
979609568 4:122674804-122674826 ATGGAACAAGGCCCCTTTCTGGG - Intergenic
981883731 4:149647814-149647836 ATGGCAAAGGCCACATCTGTAGG - Intergenic
984714332 4:182912820-182912842 AAGGCACAGGCCCCATTGGGAGG + Intronic
985793051 5:1941803-1941825 TGGGCAGAAGGCCCATTTGTAGG + Intergenic
986477226 5:8147555-8147577 CGGGTACAAGGCCCATTTGTAGG + Intergenic
988777379 5:34489741-34489763 ATGTCACAGGGCGCCTTAGTTGG - Intergenic
1000149987 5:158490747-158490769 ATGGCACGTGGCCCATATTTTGG + Intergenic
1001072915 5:168602377-168602399 AGGGCACAGAGCACATTTGAGGG + Intergenic
1003179716 6:3781164-3781186 AGGGCACAGGGCACATTGGAAGG - Intergenic
1006988203 6:38191367-38191389 CAAGCACAGGGCCCATTTGCTGG + Intronic
1008888678 6:56459821-56459843 ATTGCACAGGGCCCTGTTTTGGG - Intronic
1017678410 6:156839056-156839078 ATGGCACAGGACCCACAAGTAGG - Intronic
1023670935 7:42575890-42575912 AAGGCATAGGGCCCCTTTCTTGG - Intergenic
1023937619 7:44750549-44750571 CTGCCACAGGGCCCACTTGCTGG + Intronic
1026458212 7:70591237-70591259 GTGTGACAGAGCCCATTTGTGGG + Intronic
1029273906 7:99393075-99393097 AGGGGACGGGGCCGATTTGTGGG + Intronic
1029465703 7:100723328-100723350 ATGTCACAGGGCCAACTTGAGGG + Exonic
1032481843 7:132253649-132253671 ATGGCCCAGGGCTCACTTCTAGG - Intronic
1035698417 8:1619382-1619404 AAGGCACAGGTCTCACTTGTAGG - Intronic
1047780353 8:128106087-128106109 GTGGCAAAGGGCCCATATTTTGG - Intergenic
1049154893 8:141060389-141060411 CTGGGTCAGGGCCCCTTTGTAGG - Intergenic
1055939429 9:81635491-81635513 ATGGTACAGGGGCCATTTCTTGG - Intronic
1056108241 9:83369140-83369162 ATGACACCTGGCCCATTTCTAGG + Intronic
1056753082 9:89365452-89365474 GTGGCCCATGGCCCATTTGGGGG - Intronic
1058552659 9:106132140-106132162 ATCATACAGGGCCCATTTCTGGG + Intergenic
1061851193 9:133416862-133416884 ATGGCAGAGTGCACATTTTTAGG + Intronic
1062690118 9:137837330-137837352 CTGTGACAGGGCCCAGTTGTGGG - Intronic
1186843180 X:13505569-13505591 ATGGCACAGGAGCCATTTGTAGG + Intergenic
1187226282 X:17377069-17377091 ATGGCACAGAGCCATTTAGTAGG - Intronic
1189751498 X:44227354-44227376 AAGGTGCAGGGACCATTTGTGGG + Intronic
1194844232 X:98783646-98783668 AAGGCAAAGGGCCCTTTTGAAGG + Intergenic
1198157443 X:133975362-133975384 ATGACACATGACACATTTGTTGG - Intronic
1198221418 X:134605759-134605781 ATGGCACAGTCAACATTTGTTGG - Intronic
1199763008 X:150919635-150919657 ATGGCACTGAGCCCATGTGAAGG - Intergenic
1200024678 X:153247306-153247328 ATGGCACAGTGCCCATAGGCAGG - Intergenic
1200131554 X:153850951-153850973 AAGGCAGAGGGCCCATCTGATGG + Intergenic
1200179788 X:154143396-154143418 AGGGGACAGGGCCCGTTGGTTGG + Intergenic
1200900498 Y:8426511-8426533 ATGTCACAATGCCCTTTTGTGGG + Intergenic
1202016399 Y:20411175-20411197 ATGTCTCATGGCCTATTTGTAGG - Intergenic