ID: 915449776

View in Genome Browser
Species Human (GRCh38)
Location 1:155996557-155996579
Sequence GAGGTTATACACTTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915449776_915449779 -8 Left 915449776 1:155996557-155996579 CCTTCCTCCAAGTGTATAACCTC 0: 1
1: 0
2: 0
3: 12
4: 185
Right 915449779 1:155996572-155996594 ATAACCTCCACAGATTGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 110
915449776_915449784 29 Left 915449776 1:155996557-155996579 CCTTCCTCCAAGTGTATAACCTC 0: 1
1: 0
2: 0
3: 12
4: 185
Right 915449784 1:155996609-155996631 TTAGACATTCTACTGGGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 117
915449776_915449783 23 Left 915449776 1:155996557-155996579 CCTTCCTCCAAGTGTATAACCTC 0: 1
1: 0
2: 0
3: 12
4: 185
Right 915449783 1:155996603-155996625 GATTTCTTAGACATTCTACTGGG 0: 1
1: 0
2: 0
3: 19
4: 205
915449776_915449782 22 Left 915449776 1:155996557-155996579 CCTTCCTCCAAGTGTATAACCTC 0: 1
1: 0
2: 0
3: 12
4: 185
Right 915449782 1:155996602-155996624 AGATTTCTTAGACATTCTACTGG 0: 1
1: 0
2: 0
3: 11
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915449776 Original CRISPR GAGGTTATACACTTGGAGGA AGG (reversed) Intronic
910843736 1:91585933-91585955 GAGCTTAAACACAGGGAGGAGGG + Intergenic
915449776 1:155996557-155996579 GAGGTTATACACTTGGAGGAAGG - Intronic
915818302 1:158993675-158993697 GAGGGTAGAGAGTTGGAGGAGGG - Intergenic
916617507 1:166457856-166457878 GAAGAAATCCACTTGGAGGAGGG + Intergenic
919641359 1:200047974-200047996 GACGACACACACTTGGAGGAAGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920523468 1:206647307-206647329 GTTGTTATTCAGTTGGAGGAGGG + Intronic
920843049 1:209570954-209570976 GAGGTCATACTGTTGGAGGGTGG - Intergenic
921605094 1:217142398-217142420 GAGGTAATACATTTGAAGGAAGG + Intergenic
1064055809 10:12096211-12096233 AAGGAAATAAACTTGGAGGAGGG - Intronic
1070170959 10:73932399-73932421 GAGGTTAGCCACTTGGGGTAAGG - Intergenic
1072272565 10:93791130-93791152 GAGGTAATAGACATGGAGGAGGG - Intronic
1074092968 10:110280360-110280382 GAGGGTATACAGTTGGGGTAAGG + Intronic
1074322436 10:112415732-112415754 GGGGTTATAAACATGGAAGATGG + Intronic
1076449280 10:130545106-130545128 GAGGATGTACACTAGGTGGAGGG + Intergenic
1077845303 11:6016234-6016256 GAGATTTTACTCATGGAGGAAGG - Intergenic
1078967778 11:16366883-16366905 GAGCTTATTCACTTCGATGAAGG - Intronic
1079436344 11:20455960-20455982 AGGTTTATAAACTTGGAGGAAGG + Intronic
1079599702 11:22295686-22295708 GAGGTCATGCACATTGAGGAAGG + Intergenic
1081751802 11:45516573-45516595 GAGCTTTTACTCATGGAGGAAGG - Intergenic
1083091850 11:60208022-60208044 GAGGTTATGCCCTTTGAGAAAGG + Intronic
1086091004 11:83004687-83004709 GTGGGGATATACTTGGAGGAAGG - Intronic
1086203769 11:84234259-84234281 AAGGAAATACACTTGGAGGCTGG - Intronic
1087793092 11:102427999-102428021 GAGGATATAAACTTGCTGGAAGG + Intronic
1088566998 11:111183043-111183065 GAGCTTCTAGACATGGAGGAAGG - Intergenic
1090257968 11:125299065-125299087 GAGCTTTTACTCTTGGTGGAAGG + Intronic
1091176877 11:133566833-133566855 GAGGTCATGCCCTAGGAGGAAGG + Intergenic
1091453210 12:586580-586602 GAGCTTATGCACTTTGAGGTTGG - Intronic
1097312790 12:58139495-58139517 TAGGGTATACACCTGGAGGAAGG - Intergenic
1097376621 12:58851128-58851150 CAGTTTATAGACTTGGAAGATGG - Intergenic
1097922434 12:65090622-65090644 GAGGTTAAACAGGTGAAGGAGGG + Intronic
1099646490 12:85364016-85364038 GAGAATAAACACTTGTAGGAAGG - Intergenic
1100310274 12:93388366-93388388 GAGCTTATATTCTTGGAGGTGGG - Intronic
1104181833 12:126389163-126389185 GAGGTTATAGCTTTGGAGAAAGG - Intergenic
1104702995 12:130921415-130921437 GAGCTTTTACTCATGGAGGACGG + Intergenic
1104955187 12:132461288-132461310 GAGGTTGTCCAATTGGAGGAAGG - Intergenic
1105345055 13:19564020-19564042 GAGGTTGTCCAGTTGGAAGATGG + Intergenic
1109211366 13:59538981-59539003 GAGTCTATGCACTTGGGGGAGGG - Intergenic
1110935350 13:81280856-81280878 GAGGTTATATACTTTGCTGAAGG - Intergenic
1111078597 13:83271964-83271986 AAGGTTATATATTTGGAGAAAGG - Intergenic
1111655037 13:91141329-91141351 GAAGAAATACACTTGGAGAAGGG - Intergenic
1114082344 14:19211846-19211868 GAGGTTTTACACATGGCAGAAGG - Intergenic
1114546936 14:23509916-23509938 GGGGTTGTACACTGGGAGCATGG + Intergenic
1114925735 14:27395417-27395439 GAGGTTCTATATATGGAGGAAGG + Intergenic
1115146784 14:30236049-30236071 GAGGTTTTACTCATGGTGGAAGG + Intergenic
1116798687 14:49419312-49419334 CAGGTTCTACATTGGGAGGAAGG - Intergenic
1117092056 14:52261334-52261356 GAGCTTTTACTCATGGAGGAAGG - Intergenic
1117242734 14:53851285-53851307 GAGGTTAGACAGTTGGGAGAAGG - Intergenic
1119387112 14:74264396-74264418 GAGGTTATAAACTTGCTGGCTGG - Intergenic
1119992708 14:79217250-79217272 GAGGTTTTACTCATGGTGGAAGG + Intronic
1126018909 15:44379745-44379767 GAGGTTGTCCAGTTGGAAGATGG - Exonic
1126675523 15:51156774-51156796 GATGAAATACACCTGGAGGAGGG + Intergenic
1126697659 15:51339977-51339999 GAGCTTTTACTCATGGAGGAAGG + Intergenic
1130717063 15:86345308-86345330 GAGGTTAAACACCAGGGGGATGG - Intronic
1130770718 15:86920949-86920971 GAGGTTTTGCAATTGGAGAAAGG + Intronic
1131330265 15:91491411-91491433 GAGGTTCTACTTTTGGAGGAAGG + Intergenic
1131842474 15:96452149-96452171 AGGGTTATATACTAGGAGGATGG - Intergenic
1137341745 16:47614122-47614144 GAGGTTTTCCTCATGGAGGAAGG + Intronic
1139805023 16:69557629-69557651 GAGCTTTTACTCATGGAGGAAGG + Intergenic
1139837360 16:69849991-69850013 CTGGTTATAAACTAGGAGGAAGG + Intronic
1140916080 16:79494558-79494580 GAGGTTATAGACCTTGAGGTGGG - Intergenic
1141377580 16:83546180-83546202 CACGCTCTACACTTGGAGGATGG - Intronic
1144219555 17:13087836-13087858 CAGGTTATCCACCTGCAGGATGG - Intergenic
1144464785 17:15488615-15488637 GAGTTTCTACAGGTGGAGGAGGG - Intronic
1147424711 17:40341084-40341106 GAGGGGATACCCCTGGAGGAGGG - Intronic
1150642802 17:66961017-66961039 CAGGTTTCACACCTGGAGGATGG - Intergenic
1155119347 18:22802661-22802683 GAGGCTCAACACTTAGAGGAGGG - Intronic
1155307577 18:24493661-24493683 AAGGTTATACACTTGTATGTAGG - Intergenic
1155379520 18:25204059-25204081 GAGCTTTTACTCTTGCAGGAGGG - Intronic
1155667951 18:28334393-28334415 GACTGTATACACCTGGAGGAAGG - Intergenic
1155734681 18:29205873-29205895 CAGGTGATACACATGCAGGATGG - Intergenic
1155925841 18:31653767-31653789 CAGGTAACACACTTGGAGAAAGG - Intronic
1159695491 18:71552139-71552161 GAGCTTATACTCATGGTGGAAGG - Intergenic
1159909834 18:74135209-74135231 GAGGTTGTACGCTTGGATGAAGG - Intronic
1161068573 19:2249723-2249745 GTGGTCCTACACCTGGAGGAAGG + Exonic
1165286532 19:34847209-34847231 GAGGTTTGACACTTGGAGTAAGG - Intergenic
1166303461 19:41924756-41924778 GGTGTTATGCACGTGGAGGAAGG + Intronic
1202674554 1_KI270710v1_random:30377-30399 GAGGGTATACATTTGTAGAAGGG + Intergenic
925058674 2:874413-874435 GGCTTTATAAACTTGGAGGAGGG - Intergenic
925854759 2:8118730-8118752 GAGGCTATATACATGGAGGCTGG + Intergenic
926238580 2:11068164-11068186 GAGGTTATGTACTTACAGGAGGG + Intergenic
926349066 2:11978763-11978785 GTGGACATTCACTTGGAGGATGG + Intergenic
926729333 2:16024080-16024102 GAGGTTACACACTTGGACTCTGG + Intergenic
926861400 2:17313599-17313621 GAGGTGGTACGTTTGGAGGAGGG + Intergenic
927232819 2:20842227-20842249 TAGTTTAGACTCTTGGAGGAGGG - Intergenic
928592378 2:32830834-32830856 GAGGATAGAGACTGGGAGGAGGG + Intergenic
929255122 2:39802310-39802332 GAGATTTTACTCATGGAGGAAGG + Intergenic
930174980 2:48292677-48292699 GAGGTTATGGTCTTGAAGGAGGG - Intergenic
931814248 2:65885154-65885176 TTGGTTATACATTTGTAGGAAGG + Intergenic
932786288 2:74607168-74607190 GTGGTCAAACAGTTGGAGGAAGG - Exonic
935535887 2:104294252-104294274 GGGGTTCTACACTTGGAAGAAGG - Intergenic
935645240 2:105329427-105329449 GTGGCTATACACTTGGGGGCAGG - Intronic
938017487 2:127879420-127879442 GAGGTTTTACTCATGGCGGAAGG - Intronic
938494242 2:131784757-131784779 GAGGTTTTACACATGGCAGAAGG + Intergenic
938871092 2:135477411-135477433 GAGGTTATACAACAGGAAGAAGG + Intronic
938937548 2:136140437-136140459 GAGGTTCTACCTTTGGAGGGTGG + Intergenic
939493229 2:142900814-142900836 GATGTTATTAACTTGGAGCATGG + Intronic
940391939 2:153142352-153142374 GATGATAAACACATGGAGGAAGG + Intergenic
945529355 2:210931277-210931299 AAGCTTATACACAGGGAGGAGGG - Intergenic
947389313 2:229623167-229623189 GAGCTTTTACAATTAGAGGAGGG - Intronic
948552661 2:238784791-238784813 GAGTTTCTAAACTTTGAGGAGGG - Intergenic
1169072999 20:2745175-2745197 GAGATTCTACACTTGTAGCAAGG + Intronic
1170144513 20:13158121-13158143 CATGTAATACACTTGGAAGATGG + Intronic
1173430186 20:42980972-42980994 GAGGTTAAAAAGTTGGAGAAAGG - Intronic
1176637386 21:9259808-9259830 GAGGGTATACATTTGTAGAAGGG - Intergenic
1180498432 22:15910824-15910846 GAGGTTTTACACATGGCAGAAGG + Intergenic
1183275938 22:36897814-36897836 GAGCTTTTACTCATGGAGGAAGG - Intergenic
954590601 3:51778527-51778549 GAGATTAGACTCATGGAGGAGGG - Intergenic
954766471 3:52922073-52922095 GAGGTTATACAGCTTGAGCAAGG - Intronic
959159775 3:102708962-102708984 GAGTTTATAGACTCGAAGGAGGG - Intergenic
961964546 3:130888654-130888676 GAGTATATGCACTTGGGGGAGGG - Intronic
962066286 3:131984638-131984660 TAGGTGATACAGTTGGAAGATGG - Intronic
962209269 3:133463351-133463373 AAGGAAATACACTTGGAAGAGGG + Intronic
967156264 3:186695264-186695286 GAAGTTGAACACTGGGAGGATGG - Intergenic
1202749508 3_GL000221v1_random:145212-145234 GAGGGTATACATTTGTAGAAGGG + Intergenic
972246134 4:37246434-37246456 GACGATATACTCTTGGGGGACGG + Intronic
973177462 4:47225297-47225319 GAGGATATGCATTTGGTGGAGGG + Intronic
973318016 4:48781156-48781178 GAAGTCCTACACTTTGAGGATGG - Intergenic
976541181 4:86278756-86278778 GAGGTTATGAATTTGGGGGAAGG - Intronic
977039572 4:91999954-91999976 GAGTTAATACCCTTGGAGGAAGG - Intergenic
977248043 4:94657505-94657527 AATGTTTTTCACTTGGAGGATGG + Exonic
977557949 4:98503708-98503730 GAGTTTATCCAGTTGTAGGAAGG - Intronic
980599333 4:134998951-134998973 GAGGTTATATCCAGGGAGGATGG - Intergenic
983013018 4:162572933-162572955 GAGGTTTTACTCTTTGAGCATGG - Intergenic
984303040 4:177948752-177948774 AAAATTATAGACTTGGAGGAGGG + Intronic
1202752280 4_GL000008v2_random:18230-18252 GAGGGTATACATTTGTAGAAGGG - Intergenic
986760087 5:10872231-10872253 GAGGTGATGCACTTTGTGGATGG - Intergenic
988426421 5:31070669-31070691 GAGACTATACACATGAAGGAAGG + Intergenic
988647429 5:33109470-33109492 GAGCTTATACTCATGGTGGAAGG - Intergenic
989309018 5:39991774-39991796 GAGGTTATAGATTTTGTGGAAGG + Intergenic
990226113 5:53656411-53656433 GATTGTATACAGTTGGAGGAGGG + Intronic
991297071 5:65092907-65092929 GAGGCTCTACACTTGGGAGAGGG + Intergenic
991556694 5:67902673-67902695 AAGTTTAGAGACTTGGAGGAGGG - Intergenic
991600875 5:68350373-68350395 GAGGTTTTACTCATGGCGGAGGG + Intergenic
992091171 5:73318410-73318432 GTGGTTATGCACTTTGAAGATGG - Intergenic
993282751 5:85949131-85949153 GAGGGTAGAAGCTTGGAGGAGGG - Intergenic
993527601 5:88985542-88985564 GTGGTTGTACACTTGTAGAAGGG + Intergenic
993528601 5:88998322-88998344 GGGGTTATGCACTGGAAGGAGGG - Intergenic
993795046 5:92256602-92256624 TGGGTAATACCCTTGGAGGAAGG - Intergenic
994163708 5:96585312-96585334 GAGGTAGTAAACTTGGAGGTGGG - Intronic
995683595 5:114746568-114746590 GAGCTTATACTCATGGAAGAAGG - Intergenic
998270564 5:140702774-140702796 TAGGTTATAGTCTTGGAAGAAGG - Intronic
1002340225 5:178511603-178511625 GAGGTTAAACTCTGGAAGGAAGG + Intronic
1004038324 6:11947243-11947265 GAGGTCATCCACTAGGAGAAAGG + Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1007482320 6:42158281-42158303 GAGGTTAGTCACTTGGAGGCTGG + Intronic
1011106288 6:83785432-83785454 AAGGTTACAGACTTGTAGGATGG - Intergenic
1011740972 6:90360370-90360392 GAGCTTTTACACTTGAAGAAAGG - Intergenic
1012805479 6:103887366-103887388 GAGATTAAACACCTGAAGGAAGG + Intergenic
1014722793 6:124938645-124938667 GAGAGTATTCACTTAGAGGAAGG - Intergenic
1016740847 6:147527298-147527320 GAGCTTTTACTCTTGGTGGAAGG + Intronic
1017257665 6:152352265-152352287 GCTGTTAAATACTTGGAGGAAGG - Exonic
1020334113 7:7048617-7048639 GAGGTTATAAACTAGGTGGCGGG - Intergenic
1020467064 7:8492630-8492652 TATGTTATACACATGGAAGATGG + Intronic
1021210518 7:17846798-17846820 GAGGTGATACAATTTGAAGAAGG - Intronic
1022857495 7:34329802-34329824 GAGGGAATACACATGGAGCATGG + Intergenic
1024198336 7:47081846-47081868 GAGGGGAGACACTGGGAGGAAGG + Intergenic
1026253297 7:68689548-68689570 GAGTGTATTTACTTGGAGGAGGG - Intergenic
1028342122 7:89734632-89734654 GAGGGTAGAGAGTTGGAGGAAGG + Intergenic
1030934746 7:115571538-115571560 AGGGTTATACATTAGGAGGAAGG - Intergenic
1032849698 7:135783570-135783592 GTGGTTCTTTACTTGGAGGAAGG - Intergenic
1032864793 7:135914732-135914754 GAAGCTGTTCACTTGGAGGAGGG + Intergenic
1033143638 7:138851735-138851757 GAGGTTATGCTCTAGGAGTAAGG - Intronic
1035886807 8:3300000-3300022 GAGGTGACACACGGGGAGGATGG + Intronic
1037062235 8:14528753-14528775 GTGGTTATTAACTGGGAGGAAGG - Intronic
1037100362 8:15036403-15036425 GAGGGTATAGAGTTGGAGGAGGG + Intronic
1038172129 8:25145159-25145181 GAGTTTTTACTCTTGGTGGAAGG + Intergenic
1042652051 8:71053694-71053716 GAGGTTATTCAGTTGAAAGATGG + Intergenic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044691018 8:94878522-94878544 GAGGTTATACTATTTGATGAAGG + Intronic
1046686775 8:117236644-117236666 AAGGTTATAAATTTGAAGGAAGG - Intergenic
1052250275 9:26390095-26390117 GAGCTGAAGCACTTGGAGGAAGG - Intergenic
1052517601 9:29503351-29503373 GAGGAAGTACACTTGGAAGAGGG + Intergenic
1057937491 9:99253107-99253129 GAGCTTTTACTCATGGAGGAAGG + Intergenic
1059616631 9:115958593-115958615 AAGATTATACACTTGGGGGCTGG - Intergenic
1059651749 9:116321875-116321897 GAGGTAATACACTTGCATTATGG - Intronic
1060121402 9:120993871-120993893 GAGTGGGTACACTTGGAGGAAGG + Intronic
1060218459 9:121752258-121752280 GTGGTTGTTCCCTTGGAGGAGGG - Intronic
1060774105 9:126356860-126356882 GAGCTTTTACTCATGGAGGAAGG - Intronic
1203718149 Un_KI270742v1:175303-175325 GAGGGTATACATTTGTAGAAGGG + Intergenic
1203533070 Un_KI270743v1:2926-2948 GAGGGTATACATTTGTAGAAGGG - Intergenic
1186552737 X:10523605-10523627 GAGGCTAATCCCTTGGAGGAAGG + Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1187947654 X:24442030-24442052 GAGCTTTTACTCGTGGAGGAAGG - Intergenic
1188247173 X:27850622-27850644 GTGTTAATACTCTTGGAGGAGGG - Intergenic
1189547401 X:42055957-42055979 GAGCTTTTACTCATGGAGGAAGG + Intergenic
1189594550 X:42549901-42549923 AAGCTTATAATCTTGGAGGAAGG + Intergenic
1189671918 X:43420212-43420234 GAGAGAATACACTTGGAGGAGGG + Intergenic
1190636160 X:52435989-52436011 GAGGTCATTCAAATGGAGGAGGG + Intergenic
1191678112 X:63812784-63812806 GAGGTTATATACTGTGACGAGGG - Intergenic
1192866432 X:75137871-75137893 GAGGGTAGACAATGGGAGGAGGG + Intronic
1194011696 X:88569671-88569693 GAGGGTATACACTTTATGGATGG + Intergenic
1194327794 X:92541371-92541393 GAGTTTGTGCACTTGGGGGAGGG - Intronic
1197862596 X:130986337-130986359 GAGGGTAGAGAGTTGGAGGAGGG - Intergenic
1200135127 X:153871081-153871103 GAGGCTCTGCACTTGGGGGAGGG + Exonic
1200177202 X:154125514-154125536 GAAGCTGTACACTTGGGGGAGGG + Intergenic
1200636508 Y:5660589-5660611 GAGTTTGTGCACTTGGGGGAGGG - Intronic