ID: 915450664

View in Genome Browser
Species Human (GRCh38)
Location 1:156002834-156002856
Sequence CAGGTACAAGAAGCCATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 359}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915450661_915450664 20 Left 915450661 1:156002791-156002813 CCTTGAACACAGGGTGGCTACAA 0: 1
1: 0
2: 1
3: 10
4: 145
Right 915450664 1:156002834-156002856 CAGGTACAAGAAGCCATGCTGGG 0: 1
1: 0
2: 0
3: 30
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915450664 Original CRISPR CAGGTACAAGAAGCCATGCT GGG Intronic
900228248 1:1542878-1542900 TGGGGACCAGAAGCCATGCTGGG + Intronic
900295738 1:1948381-1948403 CAGATGCATGCAGCCATGCTTGG + Intronic
900737616 1:4308994-4309016 CAGGAACAAGAAGCCATCTCTGG - Intergenic
901330185 1:8401615-8401637 CAGGTGCATGATGCCATGCCTGG - Intronic
901631798 1:10651614-10651636 CAGGGACACGAGGCCAGGCTGGG + Intronic
901756972 1:11447250-11447272 CAGGGACCTGAAGCCATGCTGGG - Intergenic
902447901 1:16478682-16478704 CAGGTAGAAGAGGCCAGGTTAGG + Intergenic
902467802 1:16628906-16628928 CACGTAGAAGAGGCCAGGCTAGG + Intergenic
902506775 1:16943819-16943841 CAGGTAGAAGAGGCCGAGCTAGG - Intronic
902884115 1:19392852-19392874 AAGGTACAAGAGCACATGCTGGG + Intronic
902897831 1:19491389-19491411 CAGGTACATGACACCATGCCTGG - Intergenic
903061435 1:20671471-20671493 CAGGTACATGCTGCCATGCCTGG + Intronic
903693195 1:25188930-25188952 CAGGCACATGCTGCCATGCTTGG - Intergenic
903897438 1:26617422-26617444 CAGGTACATGACACCATGCCTGG + Intergenic
904266955 1:29323704-29323726 CAGGTGCAAGAAGGCCTTCTTGG - Exonic
905691502 1:39946568-39946590 CAGGTACAAGCCACCATGCCTGG - Intergenic
907249571 1:53129224-53129246 AACGTACCAGGAGCCATGCTGGG + Intronic
908397120 1:63735856-63735878 CAGGCGCAAGCCGCCATGCTCGG + Intergenic
908439922 1:64143240-64143262 CAGGTATAAGCCACCATGCTTGG - Intronic
908604180 1:65776481-65776503 CAGGTACCAGAAGCCAAGAAGGG - Intergenic
909593788 1:77381479-77381501 CATGTACAAGACACCATGCTTGG + Intronic
910014335 1:82502662-82502684 CAGAGACAAGAGGGCATGCTGGG + Intergenic
910185050 1:84529997-84530019 CAGGCACACGCAGCCATGCCCGG + Intergenic
910305647 1:85760320-85760342 CAGGTACAAGCCACCATGCCCGG + Intronic
910751947 1:90640703-90640725 CAGTACCAAGAAGCCATCCTAGG - Intergenic
911847653 1:102774781-102774803 CTGGTACAAGAAGGCATTCAGGG + Intergenic
914224498 1:145708693-145708715 AAGGTACAAAAAGCCAGGCATGG + Intergenic
915450664 1:156002834-156002856 CAGGTACAAGAAGCCATGCTGGG + Intronic
916261446 1:162846426-162846448 CAGGTGCACGCAGCCATGCCCGG + Intronic
916700202 1:167285227-167285249 CATGTACCAGATACCATGCTAGG - Intronic
916807241 1:168270506-168270528 CAGGTACCATAACCCATGCTGGG + Intergenic
917881396 1:179340215-179340237 CAGGCACAAGCAACCATGCCTGG - Intronic
918080421 1:181203621-181203643 CTGGTGGAAGAAGGCATGCTTGG - Intergenic
918288786 1:183085503-183085525 CAGGTGCAAGCCACCATGCTTGG + Intronic
919739884 1:200975049-200975071 CTGGTTCCAGGAGCCATGCTGGG + Intronic
920406945 1:205722216-205722238 CAGGCACATGCAGCCATGCCCGG + Intronic
920703513 1:208235352-208235374 CAGGTATAAGAAGCGAAACTAGG - Intronic
921318945 1:213918710-213918732 AAGGCATATGAAGCCATGCTGGG + Intergenic
922313075 1:224414700-224414722 CAGGTATGAGCAACCATGCTGGG - Intronic
923602141 1:235412370-235412392 CAGGTACCAGCAACCATGCCTGG + Intronic
923884471 1:238139530-238139552 CAGATAGAATCAGCCATGCTAGG - Intergenic
923937888 1:238784543-238784565 CAGGTACAAGCCACCACGCTCGG + Intergenic
1064748018 10:18496931-18496953 CAGGTACGAGACACCATGCCTGG - Intronic
1065019035 10:21487477-21487499 CAGGTACAAGCCACCACGCTTGG + Intergenic
1065220053 10:23487342-23487364 CAGGTACATGCCACCATGCTCGG - Intergenic
1065939020 10:30546944-30546966 CAGGTACAAGCCACCATGCTCGG - Intergenic
1066376602 10:34862906-34862928 CAGGTGCAAGCCGCCATGCCCGG + Intergenic
1068639537 10:59387884-59387906 AAGGCACAAGAAGCCAGTCTGGG - Intergenic
1068799629 10:61125318-61125340 CAAGTACAAGCCGCCATGCCAGG - Intergenic
1069563681 10:69449548-69449570 CAGGCACGAGACACCATGCTTGG + Intergenic
1069576787 10:69536365-69536387 CAGGTACCAGACACTATGCTAGG + Intergenic
1070014539 10:72512845-72512867 CAGGTACATGTCACCATGCTCGG + Intronic
1070702300 10:78612933-78612955 CATGTTCCAGATGCCATGCTGGG - Intergenic
1071776198 10:88790889-88790911 CAGGTGCATGAAACCATGCCTGG - Intergenic
1071812252 10:89196127-89196149 CAGGTGCCCGAAACCATGCTTGG - Intergenic
1072346582 10:94513704-94513726 CAGGCACAAGCCACCATGCTTGG + Intronic
1074187300 10:111108122-111108144 CAGGGGCAAGAAGCAAGGCTGGG - Intergenic
1074500937 10:114024042-114024064 CATGAACTAAAAGCCATGCTCGG + Intergenic
1074834483 10:117276011-117276033 CAGGTGCAAGTGACCATGCTTGG - Intronic
1074933855 10:118158256-118158278 AAGGTACAAGAAGGGATGGTAGG + Intergenic
1077623751 11:3751714-3751736 CAGGTGCAAGCCACCATGCTTGG - Intronic
1078880802 11:15446987-15447009 CAGTTAATGGAAGCCATGCTGGG - Intergenic
1079816233 11:25062305-25062327 CAGTTACAAGCCACCATGCTTGG - Intronic
1080022828 11:27581253-27581275 CAGATACAAAGATCCATGCTTGG - Intergenic
1080248427 11:30205637-30205659 CAGGTGCATGCAGCCATGCCTGG + Intergenic
1081324893 11:41732145-41732167 CAGATCCAAGAAGCCAAGTTAGG - Intergenic
1082957514 11:58885935-58885957 CAGGTAGAAGACACCATGCTTGG - Intronic
1082964168 11:58948359-58948381 CAGGTAGAAGACACCATGCCTGG - Intronic
1082973105 11:59044000-59044022 CAGGTAAAAGACACCATGCCTGG - Intergenic
1083087914 11:60169160-60169182 CAGGTACCACAACACATGCTGGG + Intergenic
1083738642 11:64695884-64695906 CAGGAACAAGAAGGGAAGCTGGG - Intronic
1084150061 11:67283958-67283980 TAGGTACAAGAGGCCAGGCAAGG - Intronic
1085095163 11:73754775-73754797 CAGGTACATGCCGCCATGCCTGG - Intronic
1085276758 11:75305320-75305342 CAGGCATAAGAAACCATGCCTGG + Intronic
1087829025 11:102798880-102798902 CAGGTGCATGACTCCATGCTTGG - Intergenic
1088031284 11:105253929-105253951 CAGGTACAAGATGTCATGCAGGG - Intergenic
1088692881 11:112342834-112342856 CAGGCACAAGATGCCATGCCTGG + Intergenic
1089840653 11:121414441-121414463 CACTTACAAGGACCCATGCTTGG + Intergenic
1090782207 11:130017409-130017431 CAGGTGCACGCTGCCATGCTTGG + Intergenic
1091282802 11:134391524-134391546 AAGGTCCTAGAAGCCATTCTGGG - Exonic
1092341711 12:7682182-7682204 CAGGTACATGACACCATGCCTGG + Intergenic
1093685408 12:22048444-22048466 AAGCTGCTAGAAGCCATGCTAGG - Intronic
1093723930 12:22480945-22480967 CAGGCACAAGCAGCCACGCCTGG + Intronic
1094466295 12:30756416-30756438 CAGGCACATGCCGCCATGCTCGG - Intergenic
1095092742 12:38122001-38122023 CAGGTGCAAGCCGCCATGCCTGG + Intergenic
1095674929 12:44905400-44905422 CAGCTACAAGAACTTATGCTTGG - Intronic
1097036183 12:56125931-56125953 CAGGTACATGCCACCATGCTCGG + Exonic
1097171061 12:57113046-57113068 CTTGTCCAACAAGCCATGCTAGG + Intronic
1097211330 12:57372926-57372948 CAGGCACAAGCCCCCATGCTTGG - Intronic
1098383535 12:69895066-69895088 GAGGTAAAAGGACCCATGCTGGG + Intronic
1099597526 12:84686279-84686301 CAGGCACATGTAGCCATGCCTGG - Intergenic
1099988743 12:89699985-89700007 CAGGTACACGACACCATGCCTGG + Intronic
1100836097 12:98568614-98568636 CAGGTACATGCAACCATGCCCGG - Intergenic
1101746774 12:107547726-107547748 GAGCTACAAGAAGCCGAGCTGGG - Intronic
1102238936 12:111311739-111311761 CAGGTGCAAGCCACCATGCTTGG + Intronic
1102687868 12:114738223-114738245 CAGGTACAAACCACCATGCTTGG - Intergenic
1102893455 12:116579965-116579987 CAGGTACGAGCCACCATGCTGGG - Intergenic
1103287983 12:119818943-119818965 CAGGTACACGATGCCAGGCAAGG + Intronic
1103734240 12:123048989-123049011 CAGGTACATGCCACCATGCTGGG - Intronic
1104194398 12:126519105-126519127 CAGGTACAAGCCACCATGCCTGG + Intergenic
1105060699 12:133147756-133147778 CAGGTGCATGACGCCATGCCTGG + Intronic
1106830731 13:33579442-33579464 CAGGTACACAAAACCATGCAGGG + Intergenic
1107803176 13:44129725-44129747 CTGTCACAAGGAGCCATGCTGGG - Intergenic
1109659725 13:65441795-65441817 CAGGTACATGGAGGCAGGCTGGG - Intergenic
1109876936 13:68417190-68417212 CAGGTGCATGATGCCATGCCTGG + Intergenic
1112020155 13:95364473-95364495 CAGGCACAAGCCGCCATGCCTGG + Intergenic
1115572020 14:34675692-34675714 CAGGCACAAGACACCATGCTTGG - Intergenic
1116473032 14:45307006-45307028 CATGTATAAGAACCTATGCTAGG + Intergenic
1117355684 14:54921603-54921625 CAGGCACAAGCCGCCATGCCTGG + Intergenic
1117530504 14:56656274-56656296 CAGGCACACGACACCATGCTTGG - Intronic
1118785839 14:69044736-69044758 CAGGTCTAAGAGGCCAAGCTAGG - Intergenic
1120202898 14:81556921-81556943 CAGGTATGAGCAACCATGCTTGG + Intergenic
1120301103 14:82708200-82708222 CAGGTGCAAGCCACCATGCTTGG - Intergenic
1121296514 14:92830173-92830195 CAGGTACCTGCAACCATGCTCGG - Intronic
1123066229 14:105620844-105620866 CAGGAACAAGCAGCCACTCTGGG - Intergenic
1123070370 14:105639896-105639918 CAGGAACAAGCAGCCACTCTGGG - Intergenic
1123074962 14:105663556-105663578 CAGGAACAAGCAGCCACTCTGGG - Intergenic
1123089606 14:105736684-105736706 CAGGAACAAGCAGCCACTCTGGG - Intergenic
1123095399 14:105764844-105764866 CAGGAACAAGCAGCCACTCTGGG - Intergenic
1124367136 15:29080107-29080129 CTGGTATATGAAGGCATGCTGGG - Intronic
1125836549 15:42756753-42756775 CAGGTACAGGCCACCATGCTTGG - Intronic
1127140592 15:55971480-55971502 CAGGTGCACGCTGCCATGCTTGG - Intronic
1127160595 15:56180772-56180794 CAGGTGCAAGCCACCATGCTCGG - Intronic
1127313525 15:57773278-57773300 CAGGAACAAGACACCATGCCTGG + Intronic
1127908590 15:63396394-63396416 AAGCTGCTAGAAGCCATGCTAGG - Intergenic
1129229877 15:74191210-74191232 CCAGGACAGGAAGCCATGCTTGG + Exonic
1130445223 15:83994737-83994759 CAGGTACAAGCCACCATGCCTGG + Intronic
1131132027 15:89906335-89906357 CAGGTATGAGAAGCCATGCAGGG - Intronic
1132001565 15:98185694-98185716 CAGGTACATGACACCATGCCTGG + Intergenic
1132131813 15:99288820-99288842 CAGGCACGTGAAGCCATGCCTGG + Intronic
1132173946 15:99692903-99692925 AAGGAACAGGAAGACATGCTCGG + Intronic
1133627195 16:7581851-7581873 CAGGCACAAGCCACCATGCTTGG + Intronic
1133927790 16:10207300-10207322 CAGGTACATGCAACCATGCCTGG + Intergenic
1134042604 16:11080010-11080032 TAGGAACAAGATGCCATGATAGG - Intronic
1135295376 16:21275141-21275163 CAGGGACAAGAAGCCAGTCCTGG + Intronic
1136489074 16:30593567-30593589 CAGGTACATGCCACCATGCTTGG + Intergenic
1137671993 16:50284437-50284459 CAGGCACACAAAGCCAGGCTGGG - Intronic
1138020340 16:53474133-53474155 CAGGTACATGCTGCCATGCCTGG + Intronic
1138565309 16:57828573-57828595 CTGGGACAAGAACCCAGGCTGGG - Intronic
1139298854 16:65926824-65926846 CAGGTACATGCCACCATGCTTGG - Intergenic
1139560099 16:67736459-67736481 CAGGTACAAAAATGCATGGTTGG - Intronic
1140128678 16:72138390-72138412 CAGCCACAGGAGGCCATGCTGGG - Intronic
1140146688 16:72318159-72318181 CAGGTATAAGAAGAGATGCCTGG - Intergenic
1140437219 16:74957356-74957378 CAGGCACAAGGAACCATGCCCGG + Intronic
1140591833 16:76362944-76362966 CAGGTATAAGCTGCCATGCCTGG - Intronic
1141521133 16:84580387-84580409 CAGGTACATAACACCATGCTCGG + Intronic
1141664370 16:85458331-85458353 CAGGTAAATGAGGCCCTGCTTGG + Intergenic
1141768461 16:86074031-86074053 CAGGTGGAAGAGGCCAGGCTGGG - Intergenic
1142280392 16:89144916-89144938 GAGGTGCCAGAAGCCCTGCTGGG - Intronic
1142814395 17:2413922-2413944 CAGGTCCAAGAAGCCAAGACTGG - Intronic
1144342104 17:14318434-14318456 CAGTCTAAAGAAGCCATGCTTGG + Intronic
1145855237 17:28149819-28149841 CATGTACAAGATGCCAATCTAGG - Intronic
1147010279 17:37440815-37440837 CAGGCACAAGCCACCATGCTGGG - Intronic
1147289447 17:39429938-39429960 CAGGTACAGGATACCATGCCTGG - Intronic
1147944821 17:44074988-44075010 AAGGTGCAATAAGCCAGGCTAGG - Exonic
1148672715 17:49423196-49423218 CAGGTACACGCCACCATGCTTGG + Intronic
1150111344 17:62503200-62503222 CAGGCACATGCCGCCATGCTTGG + Intronic
1150646659 17:66982831-66982853 CAGGCACAAGCCACCATGCTTGG + Intronic
1151798337 17:76362013-76362035 AGGGTACCAGAAACCATGCTGGG + Intronic
1152176389 17:78790566-78790588 CAGGTACAAGCCACCATGCCTGG + Intronic
1152796567 17:82310527-82310549 CAGGGACCAGAGGCCATGCAGGG - Intergenic
1153051389 18:905810-905832 TAGGTAAAAGAAACCAAGCTAGG - Intronic
1154069163 18:11137603-11137625 CAGGTACACGGACCCCTGCTAGG - Intronic
1154315412 18:13300142-13300164 CAGGAACCGGAAGCCAGGCTGGG - Intronic
1154992704 18:21611676-21611698 CAGGTACAGTAAGCAATGCTAGG + Intergenic
1155171313 18:23268616-23268638 CAGATTCCAGAAGCCCTGCTAGG - Intronic
1155827857 18:30470994-30471016 CATGTACTAGGAACCATGCTAGG - Intergenic
1155978805 18:32159759-32159781 CAGGTGCAAGCCACCATGCTCGG + Intronic
1156252881 18:35368592-35368614 CAGGTACACGTTGCCATGCCTGG + Intronic
1156307215 18:35888298-35888320 CAGGTGCATGACACCATGCTTGG - Intergenic
1157256155 18:46141421-46141443 GAGGAACAAGGAGCCATGTTGGG - Intergenic
1157291073 18:46410210-46410232 GAGGTGCAAGAAGCCAAGCTTGG - Intronic
1158369711 18:56786384-56786406 CAGGTGCACGCAGCCATGCCCGG - Intronic
1158705324 18:59787415-59787437 CAGGTGCAAGCCACCATGCTTGG - Intergenic
1159713160 18:71788942-71788964 CAGGTGCAAGCCACCATGCTTGG - Intergenic
1161476341 19:4487906-4487928 CAGGAGGAAGAAGCCAAGCTAGG - Intronic
1162290591 19:9777187-9777209 CAGGTGCAAGCCACCATGCTTGG - Intronic
1162647625 19:12061464-12061486 CAGGCACATGCAGCCATGCCTGG - Intergenic
1163599444 19:18239881-18239903 CAGGTGCAAAGCGCCATGCTCGG - Intronic
1164541814 19:29127159-29127181 CAGGGCCACGATGCCATGCTGGG + Intergenic
1167510042 19:49891021-49891043 GAGATAGAAGAAGCCATCCTCGG + Exonic
1168356281 19:55702102-55702124 CAGGTGCATGCAGCCATGCCCGG + Intronic
924984190 2:253778-253800 CAGGTCCAAGAACCCTTTCTTGG + Intronic
925214384 2:2081880-2081902 CAGGTGCGCGATGCCATGCTTGG + Intronic
925416709 2:3675245-3675267 CAGGTACACATAGCCATGCCTGG - Intronic
926267375 2:11336963-11336985 CAGGCACAAGCCGCCATGCCTGG - Intronic
926330617 2:11822306-11822328 CAGGTGCAAGCTGCCATGCCTGG - Intronic
926367565 2:12146923-12146945 CAAGTTCAAGAGGCCATGGTGGG - Intergenic
926906414 2:17809815-17809837 TAGGTACAAGATGCAAGGCTTGG - Intergenic
927119279 2:19940222-19940244 CAGGCACAGGCCGCCATGCTTGG - Intronic
927947063 2:27141563-27141585 CAGGGACAAGCCACCATGCTCGG + Intergenic
928656802 2:33460655-33460677 CAGGCACAAGCCGCCATGCCCGG + Intronic
932666999 2:73706062-73706084 CAGGTACACGCCGCCATGCCCGG + Intergenic
932933999 2:76079877-76079899 CAGACACAGGGAGCCATGCTTGG + Intergenic
933589408 2:84215290-84215312 CAGGAACAAGCCACCATGCTCGG - Intergenic
934865328 2:97804518-97804540 CAGGTACATGCCACCATGCTTGG - Intronic
935662905 2:105485246-105485268 CAGGTACACAAAATCATGCTTGG + Intergenic
936474354 2:112826809-112826831 CAGGCATAAGCAGCCATGCCTGG - Intergenic
938155515 2:128936253-128936275 AAGCTACAATAAGCCATGATTGG + Intergenic
938649263 2:133364891-133364913 CAGGTACATGCCACCATGCTCGG + Intronic
938892633 2:135721204-135721226 CAGGTACAAGCCACCATGCTTGG - Intronic
939497907 2:142946224-142946246 CAGGTACAAGCGACCATGCCTGG + Intronic
940916994 2:159266914-159266936 CAGGTGCAAGCCACCATGCTTGG + Intronic
943619896 2:190137563-190137585 CAGGGACAGTAAACCATGCTAGG - Intronic
944784393 2:203053656-203053678 CAGGTACATGCCACCATGCTTGG + Intronic
945461876 2:210118567-210118589 CAGGTACGAGCCACCATGCTTGG - Intronic
946438945 2:219678976-219678998 CAGCTACCAGGAGCCCTGCTCGG + Intergenic
948350741 2:237338623-237338645 CAGGTGCATGCAGCCATGCCTGG - Intronic
948498082 2:238367677-238367699 CAGGTGCAGGAGGCCATGCGTGG - Intronic
948557585 2:238824247-238824269 CATGTAGCAAAAGCCATGCTGGG + Intergenic
948731922 2:239970170-239970192 CAGGGACAAGAACCAAAGCTAGG + Intronic
948757733 2:240169047-240169069 CACGCCCAAGAGGCCATGCTGGG - Intergenic
1169548712 20:6679159-6679181 CAGGTATAAGAGGCCCTACTTGG - Intergenic
1170010635 20:11718870-11718892 CAGGTACAATCAGCCATTTTAGG - Intergenic
1170048527 20:12113691-12113713 CAGTTTCAGGAGGCCATGCTAGG + Intergenic
1171019545 20:21572926-21572948 CAGGTGCAAGTTGCCATGCCTGG + Intergenic
1172078935 20:32323599-32323621 CAGGTACGAGCCACCATGCTCGG - Intronic
1172251800 20:33484797-33484819 CAGGTATGAGCTGCCATGCTTGG + Intergenic
1172953108 20:38734813-38734835 CAGGTACACGCCACCATGCTCGG - Intergenic
1173182910 20:40818093-40818115 CAGGCACAAGATCCCATGCTAGG + Intergenic
1173292073 20:41723943-41723965 CAGGTACACGCCGCCATGCCTGG + Intergenic
1174639283 20:52029198-52029220 CAGGTACAACAAGCCAGGCATGG - Intergenic
1174713289 20:52729601-52729623 CAGGTTCATGCTGCCATGCTTGG + Intergenic
1175478637 20:59295623-59295645 AAGGTCCAAGGAGCCATGTTGGG + Intergenic
1178094089 21:29195572-29195594 CAGGTGCCAGACGCCGTGCTAGG + Intronic
1178311780 21:31535877-31535899 CAGGTGCCAGCAGCCATGCCAGG + Intronic
1179199753 21:39205627-39205649 CAGGTACATGCTGCCATGCCTGG - Intronic
1179573094 21:42289608-42289630 TAGGTCCCAGAAGCCATGCCAGG - Intronic
1180745597 22:18086613-18086635 CAGGTGCATGAAGCCAAACTTGG + Intronic
1181147581 22:20859448-20859470 AAGGTGCAAGAATCTATGCTAGG - Intronic
1181332226 22:22102018-22102040 TAGGCACATGAAGCCATGCCTGG - Intergenic
1182339339 22:29606718-29606740 CAGCTGGAAGAAGCCATTCTAGG + Intronic
1182404201 22:30110526-30110548 CAGGCACAAGCCGCCATGCCTGG + Intronic
1182678630 22:32060710-32060732 CAGGTACATGCCACCATGCTTGG + Intronic
1183110145 22:35642777-35642799 CAGCTAGAAGAATCCATGTTAGG - Intergenic
1183153260 22:36054211-36054233 CAGGTACATGCCACCATGCTTGG + Intergenic
1183746019 22:39692051-39692073 CTGGTCCATGAAGCCACGCTGGG - Intergenic
1183808473 22:40233477-40233499 CAGGCACATGAAACCACGCTGGG - Intronic
1183968942 22:41461496-41461518 CAGGTACACGCCGCCATGCCCGG + Intronic
1184073553 22:42161938-42161960 CAGGTACACGCCACCATGCTTGG + Intronic
1185418243 22:50721328-50721350 CAGGCACAGGAATCCAGGCTGGG - Intergenic
949577311 3:5351329-5351351 CAGGTACATGCCGCCATGCTTGG + Intergenic
950058179 3:10045461-10045483 CAGGAAGAATAAGCCATGCTAGG - Intronic
950256118 3:11507721-11507743 CAGGGTTAAGAAGCCCTGCTGGG + Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950547488 3:13647128-13647150 CAGGTACACGCCGCCATGCCTGG + Intergenic
952458622 3:33500173-33500195 CAGGCACATGCAACCATGCTTGG + Intronic
953349687 3:42206036-42206058 CAAGTAAAGGAAGCCAGGCTGGG + Intronic
953544711 3:43855945-43855967 CAGGGAGAAGAAGCCTTGCTGGG - Intergenic
954248569 3:49350858-49350880 CAGGTACATGCAACCATGCCTGG + Intergenic
955257032 3:57342928-57342950 CAGGCACAAGCCACCATGCTTGG - Intronic
956139393 3:66130439-66130461 CAGGCACATGCCGCCATGCTTGG - Intergenic
956506960 3:69951355-69951377 CAGGTGCAAGCAACCATGCTGGG + Intronic
956580557 3:70807626-70807648 CAGGTACATGCCGCCAGGCTTGG + Intergenic
956785104 3:72636102-72636124 CAGGTACACGTCACCATGCTCGG + Intergenic
957226547 3:77456000-77456022 CTACTACAAGAAGACATGCTGGG - Intronic
959803834 3:110527589-110527611 AAGGAGCTAGAAGCCATGCTGGG - Intergenic
960079797 3:113529352-113529374 GAGGCACAAGAAGCCTTGGTGGG + Intergenic
960097875 3:113705277-113705299 CAGGTACATGCAACCATACTTGG + Intergenic
961053534 3:123767462-123767484 CAGGTGCAAGCCACCATGCTTGG - Intronic
961552672 3:127678006-127678028 CAGGTAGAGGAAGCCTTGTTGGG + Intronic
961647783 3:128401576-128401598 CAGCTATAAGAAGCCAAGCAGGG - Intronic
961832401 3:129630436-129630458 CAGGTGCAAGCTGCCATGCTTGG + Intergenic
961967077 3:130916271-130916293 CAGGCACATGCAGCCATGCCTGG - Intronic
962416715 3:135189398-135189420 CAGGTCCATGAAGCCAGGCCTGG - Intronic
962455500 3:135561690-135561712 CAGGCACATGCTGCCATGCTCGG - Intergenic
964782551 3:160356662-160356684 CAGGTACATGCTGCCATACTTGG + Intronic
966146337 3:176816502-176816524 CAGTAACAAGTAGCCATGGTGGG + Intergenic
966520236 3:180866548-180866570 CAGGCACAAGACACCATGCCTGG + Intronic
967566240 3:190976788-190976810 GAAGTACAAGAAGCAATGCCAGG + Intergenic
967763762 3:193254717-193254739 CCGATTCCAGAAGCCATGCTAGG - Intronic
969094513 4:4721916-4721938 AAGGTACAATAAGCCATGCAGGG - Intergenic
972181670 4:36474522-36474544 CATGTACAAGATGCCATACTAGG + Intergenic
972296437 4:37743686-37743708 CAGGCACAAGCCACCATGCTTGG - Intergenic
972938944 4:44173097-44173119 CAGCTACATCAAGCCATGTTGGG + Intergenic
974629357 4:64463273-64463295 CAGGTGCACGCTGCCATGCTAGG - Intergenic
975564107 4:75735661-75735683 CAGGTACAAGGCACCACGCTTGG + Intronic
975603041 4:76123653-76123675 CAGGCACAAGCAACCATGCCTGG + Intronic
976383468 4:84427629-84427651 CATGTACCAGAATCCATGCCAGG + Intergenic
976470974 4:85428804-85428826 CACGTACAATAACCAATGCTGGG + Intergenic
977640366 4:99350993-99351015 CAGGTACACGCCACCATGCTTGG - Intronic
978223547 4:106306210-106306232 CAGGAACAAGACACCATGCCTGG + Intronic
978814975 4:112893852-112893874 CAGGTGCATGCCGCCATGCTGGG - Intronic
984316305 4:178136942-178136964 CGGGTACCACAACCCATGCTGGG - Intergenic
987357127 5:17073731-17073753 CAGGCACAAGCTGCCATGCTTGG - Intronic
987499466 5:18689282-18689304 AAGATACAAGAACCCTTGCTTGG + Intergenic
989213769 5:38882868-38882890 GAGGTTAAAGAAGCCATGCAAGG + Intronic
990467427 5:56083332-56083354 CAGGCACACGCCGCCATGCTCGG + Intergenic
990513479 5:56510651-56510673 GAGGCCCAAGAAGCCATCCTGGG - Intergenic
991246585 5:64514660-64514682 CAGCTACAAGAAGGAATACTGGG + Intronic
992402409 5:76423747-76423769 AAGGCACATGAAGCCATGGTGGG + Intronic
994035352 5:95194071-95194093 CAGGTGCAAGCTACCATGCTTGG - Intronic
994183804 5:96796924-96796946 CAGGCACAAGGAACCATGCCTGG + Intronic
994403790 5:99317569-99317591 AAGGTATAAAAAGTCATGCTTGG + Intergenic
995570915 5:113480915-113480937 CAGGTGCAAGCTGCCATGCCTGG + Intronic
995726110 5:115181856-115181878 CAGGTGCCAGAATCCATTCTGGG - Intergenic
996816964 5:127584777-127584799 CAGGTACAAGCCACCATGCTCGG + Intergenic
996991352 5:129636172-129636194 CAGGCACAAGCCACCATGCTTGG + Intronic
997992731 5:138559431-138559453 CATGTCCAAGTAGCCCTGCTTGG + Intronic
998105018 5:139462887-139462909 TAGGCACTAGAGGCCATGCTGGG - Intergenic
999132242 5:149293072-149293094 CAGGGACAAGAGGGCATGGTGGG - Intronic
1001477900 5:172064127-172064149 CAGCTACAGGAAGCCTCGCTGGG + Intronic
1001743137 5:174070018-174070040 CAGGCACAAGCCACCATGCTCGG + Intronic
1003415605 6:5905204-5905226 CTGGGACATGAAGCCCTGCTTGG - Intergenic
1005289435 6:24364413-24364435 CAGGTACAAGTCACCATGCCTGG + Intergenic
1005498523 6:26409939-26409961 CAGGGACAGGAAGACATGCCTGG - Intronic
1007722227 6:43891784-43891806 CAGGTTCAAGAGGCCAGGCGCGG - Intergenic
1008425626 6:51352679-51352701 CAGGTACCAGGAACTATGCTAGG + Intergenic
1011310807 6:85977662-85977684 CAGGCACAAGAACCAATGCCAGG - Intergenic
1012185969 6:96217658-96217680 CAGGTACATGCCACCATGCTAGG - Intergenic
1012447579 6:99322393-99322415 TAGGAACTGGAAGCCATGCTGGG - Intronic
1012844200 6:104368854-104368876 CAGGTGCATGCTGCCATGCTGGG - Intergenic
1012907934 6:105089666-105089688 CAGGTACATGCCGCCATGCCCGG + Intergenic
1013264252 6:108479132-108479154 CAGGCACACAACGCCATGCTTGG + Intronic
1014827412 6:126062020-126062042 CAGGTACACGCTGCCACGCTTGG + Intergenic
1016458941 6:144261983-144262005 CAGGCACAAGTCACCATGCTTGG - Intergenic
1018514601 6:164564895-164564917 CAGTAATAAGAAGCCATTCTGGG + Intergenic
1019543807 7:1563326-1563348 AAAGTACAAAAAGCCAGGCTTGG - Intergenic
1020028301 7:4915126-4915148 CAGGTGCAAGCCACCATGCTTGG - Intronic
1021000713 7:15327365-15327387 CAGCTACCAAAAGGCATGCTTGG + Intronic
1023419802 7:39967282-39967304 CAGGTACATGCCACCATGCTGGG - Intronic
1023558994 7:41452796-41452818 CAGGCACATGACACCATGCTTGG - Intergenic
1023565568 7:41520958-41520980 CAGGATCATGAAGCCATGCATGG - Intergenic
1023711655 7:42999903-42999925 TAGGCACAAGAAGCCTAGCTTGG + Intergenic
1026810705 7:73462092-73462114 CAGGTACAAGCAACCATGCCTGG - Intronic
1028124434 7:87095770-87095792 CAGGGGCAAGAAGGCATGTTTGG + Intergenic
1028468661 7:91180694-91180716 CAGGGAGAAGAACCCATGCCAGG + Intronic
1029242039 7:99169896-99169918 CAGGTACAAGCCACCATGCCCGG - Intergenic
1031746517 7:125505691-125505713 CAGGTCCAGGAAGCCATTCAAGG + Intergenic
1031889091 7:127273635-127273657 CAGGTGCAAGCAACCATGCCCGG + Intergenic
1032112402 7:129087340-129087362 CAGGTGCAAGCCACCATGCTGGG - Intergenic
1032385101 7:131516995-131517017 CAGGTGCAAGCCACCATGCTTGG + Intronic
1033096064 7:138432121-138432143 CAGGCACAAGCCACCATGCTGGG - Intergenic
1033372906 7:140727761-140727783 CAGGCACATGAAGCCACGCCCGG + Intronic
1033731780 7:144187530-144187552 CAGGTACAAGATGTGATGCTTGG - Exonic
1033742629 7:144286113-144286135 CAGGTACAAGATGTGATGCTTGG - Intergenic
1033751274 7:144363501-144363523 CAGGTACAAGATGTGATGCTTGG + Exonic
1034965751 7:155389525-155389547 CAGGTACAAGCGTCCAAGCTGGG + Intronic
1037090653 8:14912851-14912873 CAGTTGCAAGAAGACATGCTTGG - Intronic
1037491278 8:19399353-19399375 CAGGTATAAGCCACCATGCTGGG - Intergenic
1037612976 8:20491935-20491957 CAGGTGCAAGACACCATGCCTGG - Intergenic
1038214833 8:25551936-25551958 CAGGTCCAAAAATCCATGTTAGG - Intergenic
1038809770 8:30828425-30828447 CAGGTACAAGTCACCATGCCTGG - Intergenic
1039592466 8:38760926-38760948 CATGAACCAGATGCCATGCTGGG + Intronic
1039627614 8:39070613-39070635 CAGGTACACGCCACCATGCTTGG - Intronic
1039800752 8:40952445-40952467 CAGATAGAAGAACCCATGGTTGG + Intergenic
1041060250 8:54028401-54028423 CAGGTACATGCCACCATGCTTGG - Intergenic
1042557274 8:70044085-70044107 CAGGTACAAGCCACTATGCTGGG - Intergenic
1044718885 8:95126779-95126801 CAGGTACAAGCCACCATGCCTGG + Intergenic
1044951274 8:97437744-97437766 CAGGTACGAGCTACCATGCTCGG + Intergenic
1047311938 8:123699320-123699342 CAGGTACACACTGCCATGCTCGG + Intronic
1047761492 8:127957973-127957995 CTGGCACCAGAAGCCCTGCTGGG + Intergenic
1047964255 8:130034019-130034041 CAGGCACCAACAGCCATGCTGGG - Intergenic
1048912284 8:139147363-139147385 CAGGTACACGCTGCCATGCCTGG - Intergenic
1049615381 8:143573586-143573608 CAGGTACAGGAAGCATGGCTGGG - Intergenic
1049628273 8:143636382-143636404 CAGGGACAAGACCCCAGGCTCGG - Intronic
1050518018 9:6466121-6466143 CAGGCACAAGCCACCATGCTCGG - Intronic
1051220720 9:14845690-14845712 TACTTACAAGAAGCCATGCATGG + Intronic
1051645145 9:19260672-19260694 CAGGTGTAAGCAACCATGCTCGG + Intronic
1052456437 9:28705192-28705214 CAGGTGCAAGACACCATGCCCGG + Intergenic
1052836111 9:33251340-33251362 AAAGTACCAGAAGCCAAGCTGGG - Intronic
1053426542 9:38013975-38013997 CAGGGACCAGACTCCATGCTGGG - Intronic
1055482947 9:76727855-76727877 CAGGTGCAAGCCACCATGCTTGG + Intronic
1055659629 9:78490027-78490049 CAAGTACCAGATACCATGCTAGG + Intergenic
1056206868 9:84327773-84327795 CAGGTGCAAGCCACCATGCTCGG - Intronic
1057373758 9:94498919-94498941 CAGGCACATGCAACCATGCTCGG - Intergenic
1059190567 9:112321990-112322012 CAGGTACACGCTGCCATGCCTGG - Intronic
1059435313 9:114272366-114272388 CAGGGCCAAAAAGCCATGCAAGG - Intronic
1059756128 9:117295177-117295199 CAGGTACATGCCACCATGCTTGG - Intronic
1060122301 9:121004628-121004650 CAGGTACACGCCACCATGCTTGG - Intronic
1060404550 9:123366806-123366828 CAGGTACATGCCACCATGCTTGG - Intronic
1060644787 9:125268640-125268662 CAGGCACATGACACCATGCTTGG + Intronic
1061195362 9:129104202-129104224 CAGGTCCACGAAGTCCTGCTTGG + Exonic
1062540125 9:137038097-137038119 CAGGCACACGCTGCCATGCTTGG + Intergenic
1186083637 X:5961988-5962010 CAGGTATAAGATGCCATGAAGGG - Intronic
1186309568 X:8302865-8302887 CAGGTGCAAGACACCATGCCTGG + Intergenic
1186495318 X:10008312-10008334 CAGGCACAAGCCACCATGCTCGG - Intergenic
1187687850 X:21833477-21833499 CAGGAAAAAGAAACCATGCTAGG - Intergenic
1188490540 X:30734570-30734592 CAGGTGCACGCAGCCATGCCTGG + Intergenic
1189794456 X:44633967-44633989 CTTGGAAAAGAAGCCATGCTTGG - Intergenic
1190056804 X:47185909-47185931 CAGGCACAAGCAGCCAGGATAGG - Intronic
1192047191 X:67688166-67688188 CATGTACAAGGCACCATGCTAGG + Intronic
1192745391 X:73933379-73933401 CAGGTGCATGACACCATGCTCGG - Intergenic
1193618028 X:83714181-83714203 AAGATATAAGAAGCCATGATTGG - Intergenic
1195400248 X:104453772-104453794 CAGGCAAAAGAAGCAAGGCTGGG - Intergenic
1196676143 X:118422252-118422274 CAGGTACATGCCACCATGCTTGG - Intronic
1196912203 X:120495420-120495442 CAGGTATAAGCTACCATGCTCGG - Intergenic
1198558383 X:137821249-137821271 CAGCTGCGAGAAGCCCTGCTAGG - Intergenic
1199395644 X:147334710-147334732 CAGGTACAAGCCACCATGCCTGG - Intergenic
1202112393 Y:21436167-21436189 CAGGTGCAAGCAACCATGCCAGG + Intergenic