ID: 915457153

View in Genome Browser
Species Human (GRCh38)
Location 1:156048497-156048519
Sequence CAGTGCTGCCCGGGAACAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915457153_915457164 17 Left 915457153 1:156048497-156048519 CCACCTGTTCCCGGGCAGCACTG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 915457164 1:156048537-156048559 GTCCGTGTACATGCGGCGGAGGG 0: 2
1: 0
2: 0
3: 1
4: 34
915457153_915457163 16 Left 915457153 1:156048497-156048519 CCACCTGTTCCCGGGCAGCACTG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 915457163 1:156048536-156048558 TGTCCGTGTACATGCGGCGGAGG 0: 2
1: 0
2: 0
3: 2
4: 39
915457153_915457159 -8 Left 915457153 1:156048497-156048519 CCACCTGTTCCCGGGCAGCACTG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 915457159 1:156048512-156048534 CAGCACTGAACATGGGCTCCTGG 0: 2
1: 0
2: 2
3: 27
4: 214
915457153_915457162 13 Left 915457153 1:156048497-156048519 CCACCTGTTCCCGGGCAGCACTG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 915457162 1:156048533-156048555 GGATGTCCGTGTACATGCGGCGG 0: 2
1: 0
2: 0
3: 1
4: 38
915457153_915457161 10 Left 915457153 1:156048497-156048519 CCACCTGTTCCCGGGCAGCACTG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 915457161 1:156048530-156048552 CCTGGATGTCCGTGTACATGCGG 0: 2
1: 0
2: 4
3: 2
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915457153 Original CRISPR CAGTGCTGCCCGGGAACAGG TGG (reversed) Exonic
900188164 1:1342540-1342562 CAGGGCACCCAGGGAACAGGGGG + Intronic
900565080 1:3328170-3328192 CTGTGGTGCCTGGGGACAGGGGG - Intronic
900595935 1:3480199-3480221 CAGCGCTGCCCGGCATGAGGAGG - Intronic
901163350 1:7197511-7197533 CAGAGCTCCCTGGGACCAGGGGG + Intronic
901816367 1:11795741-11795763 CAGTGCAGCATGGGAACAGCTGG - Intronic
902304051 1:15524034-15524056 CCGTGCAGCGCGGGGACAGGGGG + Intronic
902575022 1:17372290-17372312 CAGGGCTGTCCAGGGACAGGTGG - Exonic
903739409 1:25549922-25549944 CAGTGGGGCCTGGGAACATGGGG + Intronic
903781156 1:25820674-25820696 CGGTGCTGCCGGCGAACCGGGGG + Intronic
904536714 1:31204282-31204304 CAGTGCTGTCTGGCTACAGGAGG + Intronic
905517071 1:38569791-38569813 CAGGGCTGCCCAGGGAAAGGAGG - Intergenic
905678469 1:39847652-39847674 TAGTCCTGGCTGGGAACAGGAGG + Exonic
906809600 1:48812414-48812436 CAGTGTTGTCCAGGAGCAGGTGG - Intronic
909464042 1:75953047-75953069 CAGTTTGGTCCGGGAACAGGAGG - Intergenic
910330552 1:86068394-86068416 CAGTGCTTCCCTGGCACAGCGGG + Intronic
912518295 1:110229268-110229290 CAGTGCTGCCCTGGGAGAAGAGG + Intronic
915457153 1:156048497-156048519 CAGTGCTGCCCGGGAACAGGTGG - Exonic
919168720 1:193927604-193927626 CAGCGCTGGCAGAGAACAGGAGG + Intergenic
919983263 1:202655832-202655854 CAGTGCAGCCCTGGACCAGTGGG - Intronic
920337463 1:205254777-205254799 CTGTGCTTCCCGGGATCAGGAGG - Intronic
921170443 1:212542814-212542836 CACTGCTCTACGGGAACAGGTGG - Intergenic
922749352 1:228063408-228063430 CAGGGCTGCCCTGGAGCAGTGGG - Intergenic
923685044 1:236147861-236147883 CAGTTCAGCCTGGGAACATGGGG + Intronic
924613025 1:245589404-245589426 CAGTGCCGCCTGGGGACAGATGG - Intronic
1066302208 10:34107216-34107238 CAGGGCTGTCCCAGAACAGGCGG - Intergenic
1066508098 10:36066232-36066254 CAGTGGGGGCCAGGAACAGGTGG + Intergenic
1069916245 10:71789069-71789091 CAGTGGTGCCTGGCAACAGCAGG - Intronic
1070250355 10:74767682-74767704 CAGAGCTGCCAGGTGACAGGTGG - Intergenic
1072612070 10:97024159-97024181 CTGTCCTGCCCAGAAACAGGTGG - Intronic
1075446721 10:122518451-122518473 CACTGCTGCCCTGGACCAGCTGG + Intergenic
1077058308 11:606529-606551 CACTGCTGCCCAGCATCAGGAGG - Exonic
1077942276 11:6855696-6855718 CAGTTTGGCCTGGGAACAGGAGG + Intergenic
1080707250 11:34707903-34707925 CAGTGCTGCCCTGTCACAGCAGG - Intergenic
1080840046 11:35975796-35975818 GAGAGCTGCCCAGGAACAGGAGG + Intronic
1081742085 11:45447991-45448013 CAGGACTGCCCAGGGACAGGGGG + Intergenic
1082784497 11:57309473-57309495 CAGTGCTGACCTGGAAGATGGGG - Exonic
1083816544 11:65135455-65135477 CAGTGCAGCCCAGGACCAGTGGG - Intergenic
1084324864 11:68394363-68394385 CGGAGCTGTCCAGGAACAGGGGG + Intronic
1084641282 11:70427672-70427694 CAGTGCTGCCCAAGCACAGTGGG - Intronic
1088771133 11:113036909-113036931 CATTGCTTGCCAGGAACAGGTGG + Intronic
1089066466 11:115665782-115665804 CAGTGCTCCCTGGGCACTGGAGG - Intergenic
1093130193 12:15382444-15382466 CAGGGAGGCCCTGGAACAGGAGG + Intronic
1095356162 12:41278106-41278128 GAGTACAGCCAGGGAACAGGAGG - Intronic
1096771692 12:53939481-53939503 CGGTGGTGCCCGGGATCAGCGGG + Exonic
1100857828 12:98773813-98773835 CAGTGCTGCACAGCTACAGGTGG - Intronic
1101136680 12:101750972-101750994 CAGGGTTGCCTGGGAACTGGAGG - Intronic
1106590104 13:31091538-31091560 CAGTGCTGCAAGGGGAAAGGAGG + Intergenic
1107560037 13:41550393-41550415 CAGAGCTGCCCTGAAGCAGGAGG + Intergenic
1113443128 13:110345427-110345449 CACTGCTTCCCAGGAACAGCAGG - Intronic
1114820251 14:26009718-26009740 CAGTGCTGCCCTGTAACAGCTGG + Intergenic
1119364097 14:74077019-74077041 CAGCACTGCCCAGGAAAAGGTGG + Intronic
1119768548 14:77205960-77205982 CAGTCCTGCCAGAGAAGAGGTGG - Intronic
1122623843 14:103074275-103074297 CAGTGCTGTCCTGGGACTGGAGG + Intergenic
1123123116 14:105927198-105927220 CAGTGCTGGCTGAGGACAGGCGG - Intronic
1123967979 15:25477949-25477971 CAGGGCTGCACGTGACCAGGGGG - Intergenic
1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG + Intronic
1128555844 15:68631145-68631167 CAGTGCTCCCAGGGAACACCTGG + Intronic
1129665213 15:77575769-77575791 CTGTGCTGCCCGGGTTCATGTGG + Intergenic
1130441257 15:83956179-83956201 CAGTGCTGCCCTGTCACAGTGGG - Intronic
1131074550 15:89486995-89487017 CAGTGCAGCCCGGGACTCGGTGG + Intronic
1131272985 15:90957977-90957999 CAGTCCTGGCTGGGAGCAGGTGG - Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133470321 16:6068919-6068941 CAGTTTGGCCCGGGAACAGGAGG + Intronic
1134274121 16:12760507-12760529 CAGTGCACCCCGGGAACACCAGG - Intronic
1136050776 16:27648409-27648431 CAGTGCTGGCCCGGATGAGGAGG + Intronic
1139424809 16:66873129-66873151 CAGGGCTTCCCCGGAAAAGGTGG + Intronic
1139489819 16:67280128-67280150 CAGGGATGCCTGGGAAGAGGAGG + Exonic
1139546422 16:67651987-67652009 GAGTGCAGCCCGGGATCAGCTGG + Exonic
1140315147 16:73889193-73889215 CAGTGCTACCTGGGGACAGATGG + Intergenic
1140942039 16:79730951-79730973 GAGTGCTGCCCTGGAAAATGAGG + Intergenic
1141575193 16:84959065-84959087 CAGAGCTGCCCGAGGCCAGGAGG + Intergenic
1141832918 16:86519730-86519752 CAGACCTGCCGGGGAACACGGGG - Intergenic
1142974594 17:3636081-3636103 CCGTGCTGCGCGGGCAGAGGCGG - Exonic
1143114639 17:4575754-4575776 CCGTGCGGCCCGGTATCAGGTGG + Intergenic
1146277626 17:31525267-31525289 CAGGGCTGCCCCAGGACAGGGGG - Intronic
1147119913 17:38329860-38329882 CAGCGCTGCCCAGGGACTGGAGG + Exonic
1150490797 17:65573119-65573141 CAGTTGTGCCTGGGAACATGGGG + Intronic
1151663315 17:75531241-75531263 AAGTGCTGCCTGGGACCAGGTGG + Intronic
1151727299 17:75892496-75892518 GAGTTCTGGGCGGGAACAGGAGG + Exonic
1152816048 17:82408633-82408655 CAGTGCGGCCATGGAAGAGGCGG - Intronic
1154396171 18:13991589-13991611 CAGTGCTTACCAGGAACAGAGGG + Intergenic
1156481707 18:37440439-37440461 CAGGGCTGCCCTGGGACAGCGGG - Intronic
1159292322 18:66439441-66439463 CAGTGGGGGCCAGGAACAGGTGG + Intergenic
1160362236 18:78293744-78293766 GCGTGCTGCCAGGGAAGAGGTGG + Intergenic
1160566601 18:79789986-79790008 CCGTGCTCCCCGGGACAAGGAGG - Intergenic
1160705959 19:530456-530478 CAGTGATGCCCGGAATCAGCTGG + Intergenic
1160732576 19:647984-648006 GGGTCCTGCCCTGGAACAGGCGG + Exonic
1161035450 19:2082016-2082038 CAGGGCAGCCTGGGCACAGGTGG + Intronic
1161127691 19:2567869-2567891 GCGTGGTGCCCGGGAACAGATGG - Intronic
1161625221 19:5322549-5322571 CAGTGCTTGCGGGGAGCAGGTGG - Intronic
1167122527 19:47527155-47527177 CAGTGCTGACTGAGGACAGGGGG + Intronic
926012585 2:9420652-9420674 CAAGGCTGTCCGGGAGCAGGAGG + Intronic
927153453 2:20208741-20208763 CAAGGCTGCTCAGGAACAGGTGG + Intronic
928277868 2:29919582-29919604 CTGTGCTGGCCAGGAACAAGAGG + Intronic
929923481 2:46190514-46190536 CAGCGCTCCCCTGGAACAGGTGG - Intergenic
931620941 2:64208665-64208687 CAGCGCTGCATGGGAGCAGGAGG + Intergenic
933800084 2:85953670-85953692 CAGAGGTGCCTGTGAACAGGAGG - Intergenic
934990261 2:98915443-98915465 CAGGGATGCCCGGGGACTGGTGG + Intronic
935533164 2:104260806-104260828 CAGTGCTGGCCTGGAAAATGGGG - Intergenic
936165183 2:110114758-110114780 CAGTGCTGTCCCTGAGCAGGGGG - Intronic
937929617 2:127193837-127193859 CAGTGCTGCCAGGGAACGGCCGG - Exonic
941951180 2:171159795-171159817 CTTTGCTGCCCGGGACCTGGAGG - Intronic
943099651 2:183472184-183472206 AAGTGCTGCCCTGTCACAGGTGG - Intergenic
945928839 2:215834028-215834050 CAGTTCTTCCTGGGAACAGCTGG - Intergenic
946277458 2:218642336-218642358 CTTTGCTGCCCGGGAGCGGGTGG - Exonic
947156290 2:227164987-227165009 CGGGGATGCCCCGGAACAGGTGG + Intronic
948361254 2:237422082-237422104 AAGTTCTTCCCGGGAACTGGAGG + Intronic
948620940 2:239234218-239234240 CAGCGATGCCCAGGAACAGTGGG - Intronic
1169314887 20:4582236-4582258 GAGTGATCCCAGGGAACAGGAGG - Intergenic
1170327734 20:15175821-15175843 CAGTGGGGGCCAGGAACAGGCGG + Intronic
1170516794 20:17138332-17138354 CAGGGCTGCCCTGGTGCAGGTGG + Intergenic
1171847836 20:30288505-30288527 CAGAGATGCCCGGGAAGACGGGG - Intergenic
1174050243 20:47762685-47762707 CTGTGATGCCAGGGTACAGGGGG + Intronic
1175856065 20:62121878-62121900 CGGGGCTGCCCGGGAACACCCGG + Intergenic
1175892617 20:62322244-62322266 GAGTGCTGGCCGGTCACAGGAGG - Intronic
1176067895 20:63208780-63208802 CAGAGCTGCCCAGGCACAGCAGG + Intronic
1176139198 20:63537732-63537754 CAGAGCTGCGGGGGCACAGGTGG + Intergenic
1176158880 20:63638475-63638497 CAGGGCTGCCCTGGGAGAGGAGG + Intergenic
1178534927 21:33403409-33403431 CGCTGCTGCTCGGGAAGAGGCGG + Exonic
1179791659 21:43759441-43759463 CACTGCTGCCCCGACACAGGTGG - Exonic
1180958015 22:19749862-19749884 CACAGCTGGCCTGGAACAGGTGG - Intergenic
1182444890 22:30384335-30384357 CAGTCGTGCCCAGGAGCAGGTGG - Exonic
1182753725 22:32661568-32661590 CAGGGCTGCCCAGAAACATGTGG + Intronic
1183784462 22:40021536-40021558 CTGGGCTGCCCGGCAACAGCGGG + Exonic
1183887848 22:40899941-40899963 CAGTGCAGCCTGGGAACAAAGGG - Intronic
1184645445 22:45892446-45892468 CAGGGAAGCCCGGGAGCAGGGGG - Intergenic
1184711105 22:46250035-46250057 CAGCGCTGCCCGAGGTCAGGGGG + Intronic
1184818899 22:46893774-46893796 CAGTGCTGCCGAGGAGGAGGAGG - Intronic
1184823849 22:46933639-46933661 CAGTGCCACCCTGGCACAGGGGG - Intronic
1185280296 22:49966970-49966992 CAGGGCTGCCCGGGAAGCGGTGG + Intergenic
949728038 3:7073416-7073438 CAGTGCTGCCTTGAAACAAGAGG - Intronic
950496705 3:13338173-13338195 CAGTGCTGACCTGGAACAGCTGG - Intronic
950932201 3:16801447-16801469 CAGTTCTTCCTGGGCACAGGAGG + Intergenic
953031658 3:39183866-39183888 CAGTGGAGGCCAGGAACAGGTGG + Exonic
953718919 3:45338536-45338558 CAGAGATGCCTGGGAAAAGGTGG - Intergenic
954145476 3:48632280-48632302 AGATGCTGCCCGGGTACAGGTGG - Exonic
955220043 3:57015893-57015915 CAGTGCTGCTTGGGAATTGGTGG - Intronic
958971043 3:100610575-100610597 CAGAGCTGGCCTGGAAAAGGAGG + Intronic
959490650 3:106984727-106984749 CAGTGCTACTCAGAAACAGGTGG - Intergenic
962288380 3:134107412-134107434 CAGTGTTGCCAGAGAAAAGGAGG - Intronic
964767483 3:160192673-160192695 CAGTGGTGGCCTGGAACAGCTGG + Intergenic
968005237 3:195238159-195238181 CAGTGCTGCCCAGTCACACGAGG - Intronic
968627010 4:1630267-1630289 CTGAGCTGCCCGTGACCAGGGGG + Intronic
968661950 4:1802313-1802335 CAGTGGTGCCCCAGGACAGGAGG + Intronic
969569505 4:8000358-8000380 CAGTCCTGCCAGGGAGCATGTGG - Intronic
969704257 4:8783512-8783534 CTCTGCAGCCCGGGAACTGGGGG - Intergenic
970518322 4:16857563-16857585 CAGGGCAGTCCGGGGACAGGAGG - Intronic
970611018 4:17725345-17725367 CAGTGCTGCCTGGGAAAAAGAGG + Intronic
974389119 4:61242150-61242172 AAGTGCTGCCCAGGAAAAAGTGG - Intronic
975717845 4:77222387-77222409 CAGTGCTTACAGAGAACAGGGGG - Intronic
980901736 4:138911529-138911551 CAGTGCTGCACGGATACAGAAGG + Intergenic
983229172 4:165112599-165112621 CAGGCCTCCCCGGGCACAGGCGG + Intronic
985659860 5:1151689-1151711 CAGTGCAGCCCGGGAGGCGGGGG + Intergenic
986689806 5:10305009-10305031 CAGTCCTGCCCCAGCACAGGAGG - Intronic
991582623 5:68172680-68172702 CAGTGATGCCCTGCAACATGTGG - Intergenic
993618163 5:90137414-90137436 CAGTGGGGGCTGGGAACAGGTGG - Intergenic
995557428 5:113344161-113344183 CAGTGCTGCCCTGTCACAGCAGG + Intronic
997146204 5:131436318-131436340 CAGAGCTGCCCCGGAATAGGTGG - Intronic
1001776955 5:174336294-174336316 AGGTGCTGCCCAGGATCAGGAGG + Intergenic
1002320339 5:178371674-178371696 CAGGGCTGCCCTGTCACAGGAGG - Intronic
1006671393 6:35731817-35731839 CGGGGCTGCCCGGGAAGGGGCGG - Intergenic
1007748686 6:44058819-44058841 CAGTCCTGCCCGGAGGCAGGGGG + Intergenic
1009847022 6:69146606-69146628 CAGTGGTAGCTGGGAACAGGTGG - Intronic
1017015228 6:150094499-150094521 CACTGCTTTCAGGGAACAGGGGG - Intergenic
1017509798 6:155104190-155104212 CAGAGCTGGCCAGCAACAGGCGG - Intronic
1018214004 6:161509245-161509267 TAGTGTTGCCCAAGAACAGGAGG - Intronic
1018724993 6:166605029-166605051 CAGTGAAGCCCTGGAACGGGAGG - Intronic
1022909090 7:34882868-34882890 CTGAGCTGCCCGAGACCAGGGGG - Intergenic
1024248530 7:47488858-47488880 CAATGGTGCCTGGGGACAGGGGG + Intronic
1024393720 7:48843124-48843146 CAGTGCTTCCCGGCAGCACGCGG - Intergenic
1024401531 7:48929291-48929313 CAGTGCTTCCCGGCAGCACGCGG + Intergenic
1025036284 7:55594286-55594308 CTGTGCTGCCTGGGACCAGGAGG + Intergenic
1026381442 7:69803657-69803679 GAGGCCTCCCCGGGAACAGGTGG - Intronic
1026942245 7:74293831-74293853 CAGCCCTGCCCCGGGACAGGAGG + Intronic
1029743369 7:102503540-102503562 GAGTGCTGCCAGGGAACCGCCGG + Intronic
1029761358 7:102602701-102602723 GAGTGCTGCCAGGGAACCGCCGG + Intronic
1047499106 8:125429131-125429153 CAGGGCTGCCCGGGTGCAGGCGG + Intergenic
1048444272 8:134481644-134481666 CTGTGCTGCCAGGGGACAGGAGG - Intronic
1049053026 8:140214117-140214139 CAGAAATGCCCGGCAACAGGAGG - Intronic
1049386796 8:142346977-142346999 CAGTGCTGTCTGGGGGCAGGAGG - Intronic
1049705618 8:144040731-144040753 CAGTGCCGCCCAGGAACAAGTGG + Exonic
1049762121 8:144336479-144336501 CAGTGCCGCCCCTGGACAGGCGG + Intergenic
1050145101 9:2559408-2559430 CAGTGCTGCCCTGTTACAGTGGG + Intergenic
1052999366 9:34569048-34569070 CAGTCTTGCCTGAGAACAGGAGG - Intronic
1053785969 9:41653151-41653173 CAGAGATGCCCGGGAAGACGGGG - Intergenic
1054159085 9:61661046-61661068 CAGAGATGCCCGGGAAGATGGGG + Intronic
1054174684 9:61867084-61867106 CAGAGATGCCCGGGAAGACGGGG - Intergenic
1054478859 9:65592051-65592073 CAGAGATGCCCGGGAAGATGGGG + Intergenic
1054662854 9:67713709-67713731 CAGAGATGCCCGGGAAGACGGGG + Intergenic
1056965833 9:91162132-91162154 AATTGCTGCCTGAGAACAGGTGG + Intergenic
1061836885 9:133335491-133335513 CAGTGCTGTCTGGGCCCAGGAGG - Intronic
1062048716 9:134436401-134436423 CAGTTCTGCCCTGGCACTGGAGG - Intronic
1062098638 9:134716337-134716359 CAGTGCTGCCAAGGGTCAGGTGG + Intronic
1062157824 9:135063542-135063564 CAGAGCTGCCCAAGACCAGGGGG - Intergenic
1062309936 9:135930148-135930170 CAGTGCATCCGGGGAGCAGGTGG - Intergenic
1062540951 9:137041361-137041383 CAGTGCTTCCCGGAAAGTGGAGG + Intronic
1188668272 X:32851786-32851808 CAGTGCTGCCCTGTCACAGTGGG + Intronic
1189500970 X:41558223-41558245 GAATTCTGCCAGGGAACAGGAGG + Intronic
1192192111 X:68997251-68997273 CACAGCTGGCAGGGAACAGGTGG - Intergenic
1192230073 X:69258475-69258497 CAGTGCTGACCGGGACCCCGAGG + Intergenic
1192380680 X:70613429-70613451 CAGTGCTGCCCTGTCACAGCAGG + Intronic
1195056272 X:101148462-101148484 CAGTCCTGCCTGGGTAGAGGTGG + Intronic
1198623339 X:138538834-138538856 AGGTGCTGCTCGGCAACAGGGGG + Intergenic
1199115320 X:143985358-143985380 CAGTGCTGTCCTGGAAAAGCAGG - Intergenic
1200098323 X:153674414-153674436 CAGTGTGGCCGGGGAAGAGGTGG - Intronic