ID: 915457501

View in Genome Browser
Species Human (GRCh38)
Location 1:156050662-156050684
Sequence CTGTGGGAATGACAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 422}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915457501_915457513 28 Left 915457501 1:156050662-156050684 CCCTCTTCCTGTCATTCCCACAG 0: 1
1: 0
2: 2
3: 41
4: 422
Right 915457513 1:156050713-156050735 AATGTGAGCCTACTAGACTGAGG 0: 1
1: 0
2: 0
3: 3
4: 91
915457501_915457507 -1 Left 915457501 1:156050662-156050684 CCCTCTTCCTGTCATTCCCACAG 0: 1
1: 0
2: 2
3: 41
4: 422
Right 915457507 1:156050684-156050706 GCCCGGCCCTGATCCACTGCTGG 0: 1
1: 0
2: 3
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915457501 Original CRISPR CTGTGGGAATGACAGGAAGA GGG (reversed) Intronic
901842836 1:11964621-11964643 CTGTGGGAGAGACAGAAAGCGGG - Intronic
902741686 1:18442927-18442949 CTGTTGTAAAGACATGAAGAGGG - Intergenic
903515923 1:23911101-23911123 CTCAGGAAAGGACAGGAAGAAGG - Intronic
903651453 1:24924982-24925004 CTGTCTGAATTCCAGGAAGATGG - Intronic
904828851 1:33293970-33293992 CTGTGGGAAAAACAACAAGATGG - Intronic
907524736 1:55047529-55047551 CTGTGAGAAGGACAGGGACAGGG - Intronic
907738210 1:57137215-57137237 ATGTGAGAATGAGAGGAACAAGG - Intronic
907907069 1:58792256-58792278 CTGTGGGAAGGACAGCCAAATGG + Intergenic
907999972 1:59670222-59670244 CTGGGTGAAGGAGAGGAAGAGGG - Intronic
909761892 1:79299055-79299077 CTGTGGGAATGTAAGATAGATGG - Intergenic
909815544 1:79988336-79988358 CTATGGGAAATACAGGAAGGTGG - Intergenic
910596105 1:88982736-88982758 CTGTAGGAATCACGTGAAGAAGG + Exonic
911010075 1:93271507-93271529 GTCTGGAAATGAAAGGAAGAGGG - Intronic
912501901 1:110128358-110128380 CTGTGGCTAGAACAGGAAGAAGG + Intergenic
912745130 1:112239697-112239719 CTGTGGGAGTGACATGCAGTGGG + Intergenic
912932028 1:113972784-113972806 TTGTAAGTATGACAGGAAGAGGG - Intronic
912964752 1:114227900-114227922 GTGTGGGAAGGACAGCAAGCAGG + Intergenic
912977774 1:114345865-114345887 CTGGGGAAAGGACAGGGAGAGGG + Intergenic
913247849 1:116886051-116886073 CTCTGGGGATGACAGGGGGATGG + Intergenic
913334049 1:117692246-117692268 CTGTGGGAAGGACAGAAACCAGG + Intergenic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
916604412 1:166326668-166326690 CTGTGGGAAAGACAGGGACATGG + Intergenic
916658861 1:166902315-166902337 TGTTGGGAAGGACAGGAAGAAGG - Intergenic
919309245 1:195886215-195886237 CTGGGCAAATGACAGGGAGAGGG + Intergenic
920458230 1:206116996-206117018 CGTTGAGAATGACAGGGAGAAGG + Exonic
921430345 1:215058160-215058182 CTGTGAGAAGGACAGAGAGATGG - Intronic
922518864 1:226228649-226228671 CTGGGGGAATGGCAGGGACAAGG - Intergenic
923145796 1:231196888-231196910 CTGAGGGATGGACAGGAAGGGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924441830 1:244092650-244092672 CTGTGGGCATGATAAGGAGAAGG - Intergenic
1063715240 10:8520429-8520451 GTGAGGGAAAGACAGGAGGAGGG - Intergenic
1064061059 10:12137546-12137568 CTGTGGGAGATACAGGTAGATGG - Intronic
1064102284 10:12474105-12474127 CTTTGGGAGTCAGAGGAAGAGGG + Intronic
1064315658 10:14253678-14253700 GTGTGGCAGTGACAGGCAGAGGG + Intronic
1064475012 10:15678648-15678670 GTGTGGGAGTGAGAGGCAGAGGG + Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1066220737 10:33335049-33335071 CTCTGGGAAAGACAGACAGACGG - Intronic
1067249407 10:44574538-44574560 CTGTGGGAGTGAGAGGAGCAGGG + Intergenic
1068972058 10:62969447-62969469 CTGTAAGAATGAAAGAAAGATGG + Intergenic
1069972678 10:72186609-72186631 ATGTTAGAATGACACGAAGATGG - Intronic
1070381427 10:75883705-75883727 GTGAGGGAATGAAAGGAGGAGGG + Intronic
1071032092 10:81196840-81196862 CTTAGGCCATGACAGGAAGAGGG + Intergenic
1071096080 10:81976354-81976376 GGGTGGAAAGGACAGGAAGAGGG - Intronic
1073193798 10:101671612-101671634 CTGAAGCCATGACAGGAAGATGG + Intronic
1073383961 10:103106998-103107020 CTGTGGGAATGAAAGAATAAAGG - Intronic
1073633523 10:105173778-105173800 CTGTGAGAAGAACAGAAAGATGG - Intronic
1074219857 10:111425900-111425922 CTGGGGGAAAAACAGAAAGAAGG + Intergenic
1074325938 10:112450833-112450855 CTGTGGGAAAGTAAGGAAAAGGG + Intronic
1074589292 10:114797580-114797602 CTGCAGGAAAGACAGGAAGGTGG - Intergenic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1075495836 10:122917686-122917708 CTGTGGAGATGACAGGAAGCTGG - Intergenic
1076151185 10:128163169-128163191 CTGTGGGAATAAAAGGCGGACGG - Intergenic
1077147689 11:1053300-1053322 CTGTGGGAACTGCAGGAAGGAGG - Intergenic
1077306407 11:1870523-1870545 GTGTGGGGGTGTCAGGAAGAGGG + Intronic
1077959078 11:7053932-7053954 GTGGGGGAATGAGGGGAAGAGGG - Intronic
1079333419 11:19551701-19551723 CTGTAGAAATGAGAGGAAGCAGG - Intronic
1080982063 11:37419862-37419884 CTGTGGAAATGGCAGCAACAAGG + Intergenic
1082029799 11:47595741-47595763 CTGTGGGGAGGACAAGAAGCAGG + Intergenic
1083194429 11:61075706-61075728 CGGTGGGAGTGATAGGAAGATGG + Intergenic
1084406825 11:68979109-68979131 CTGTGGGAAGGAAAGGGGGAGGG + Intergenic
1084805542 11:71576597-71576619 CTGTGGGAATGGCAGGTGGTGGG + Intergenic
1084903801 11:72330434-72330456 CTTTGAGTATGACAAGAAGAAGG + Intronic
1085214647 11:74818175-74818197 CCCTGGGAAGGAAAGGAAGAGGG + Intronic
1085475355 11:76785427-76785449 CTGTGGGAATAACCCGGAGAAGG + Intronic
1085824155 11:79825571-79825593 CTGTGGGTCTTACAGAAAGAAGG - Intergenic
1087549220 11:99626120-99626142 CTGTAGAAATTGCAGGAAGAAGG + Intronic
1088097594 11:106118152-106118174 GTGTGTGAATAACAGCAAGAAGG - Intergenic
1088151045 11:106745829-106745851 CTGTGCTAATGACAGCCAGAGGG + Intronic
1088400974 11:109422546-109422568 GTCTGGGAAGGACAGAAAGAAGG + Intronic
1089321226 11:117627956-117627978 CTGTGGGAAATACAGGGAAATGG - Intronic
1089915960 11:122156566-122156588 ATCTGGGAAGGACAGGAGGAAGG + Intergenic
1091149515 11:133314614-133314636 GTGTGGGAAAGACATGAATATGG - Intronic
1091563864 12:1633711-1633733 CTGGGAGAATGTCAGGCAGAAGG - Intronic
1091681821 12:2532890-2532912 CTGGGGGCATGACAGGAAGTGGG - Intronic
1091965620 12:4738829-4738851 CTGTGGCAATGACAAGAAGAAGG + Intronic
1092283495 12:7115107-7115129 CTGTGGGAAAGACAGACACACGG - Intergenic
1092728125 12:11504421-11504443 CTGTGGGGAGGACAGGGAGCTGG + Intergenic
1092913749 12:13171375-13171397 GTGTGGGAATGGCAGGAAGCGGG + Intergenic
1092949961 12:13492626-13492648 CTTTGGAAATGGCAGGAAGAAGG + Intergenic
1093816288 12:23552280-23552302 TTGTGGTAATGACAGGAAGCTGG + Intronic
1095366464 12:41412285-41412307 CTGTTGGAAAGACAGCACGAAGG + Intronic
1096462960 12:51832772-51832794 CAGTGGGGATGTCAGCAAGAAGG - Intergenic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096574668 12:52545185-52545207 CTGAGGGAATGAGAGAATGAGGG - Intronic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1097998139 12:65912775-65912797 CTGTGGGCCAGAGAGGAAGAGGG - Intronic
1098367114 12:69715586-69715608 ATCTGGGAATGAGAGGAAGGAGG + Intergenic
1099374629 12:81884257-81884279 CTGAGGGAATCAAAGGAAGAGGG + Intergenic
1099706146 12:86155096-86155118 ATGTGAGAATTACGGGAAGAGGG + Intronic
1100665838 12:96752144-96752166 CTATGTGAATGGCAGGATGATGG - Intronic
1102368612 12:112361773-112361795 CTGTGGGATTTAAAGGAGGATGG - Intronic
1103382486 12:120505337-120505359 CTGTGGGAATGACATGTACGTGG + Intronic
1104685700 12:130782723-130782745 CCCTGGGAAGGCCAGGAAGAGGG - Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1105895574 13:24714862-24714884 CAGACAGAATGACAGGAAGAGGG + Intergenic
1106414362 13:29534059-29534081 CTTTGGGGGTGACAGGGAGATGG - Intronic
1106896657 13:34310121-34310143 CAGTGGGAAGAACAGGTAGAAGG + Intergenic
1107278532 13:38705843-38705865 CTGTGAGAAAGACAGGAGAAAGG - Intronic
1107284660 13:38777805-38777827 CTGTGGGAAAAACTGGAAAAGGG - Intronic
1107598466 13:41988294-41988316 CTGTGGTTATGGCAGGTAGAAGG - Intergenic
1107681790 13:42859364-42859386 CTGTGTGCAAGACAGGAAAAGGG + Intergenic
1108186143 13:47890353-47890375 CAGTGTGCATGACAGGAAGCTGG - Intergenic
1109855675 13:68124223-68124245 CTGTTGGAAAGACAGGGAAATGG + Intergenic
1110884831 13:80619624-80619646 CTGAGGCAATGGCAAGAAGAGGG - Intergenic
1111791535 13:92862942-92862964 CTGTGTAAATGACAAAAAGAAGG + Intronic
1111925857 13:94462748-94462770 CTGTTGGAAAGACAGTGAGAGGG + Intronic
1111997104 13:95175957-95175979 CTGTGGGAAGGACAGCAGGCAGG - Intronic
1112764852 13:102730109-102730131 TTGTGGGACTTACAGGAAGGTGG + Exonic
1114260867 14:21035187-21035209 CTGTGGGTGTGACAGGAGTAAGG - Intronic
1114325246 14:21582300-21582322 CTCTGGGACTGACTTGAAGAGGG + Intergenic
1115528990 14:34308746-34308768 CTGTGTGAAGGAAAGGAAAAAGG - Intronic
1116023088 14:39484910-39484932 CATTGGGAATGACAGCAAGTGGG + Intergenic
1117270613 14:54139718-54139740 CTGTTGGAATGAGAGAATGATGG - Intergenic
1117349390 14:54866642-54866664 CTGAGTGAGTCACAGGAAGATGG + Intronic
1120828184 14:88974164-88974186 ATGTGGGCATTCCAGGAAGAGGG + Intergenic
1121739656 14:96242589-96242611 TGGTGGGAATGACAGGTGGAAGG - Exonic
1122404383 14:101491275-101491297 GTGTGGGAACCAGAGGAAGATGG + Intergenic
1122587205 14:102817170-102817192 CTGGGGGAATTACAGGGAAAGGG + Intronic
1123104903 14:105836826-105836848 CTGGGGGAAGCACAGGAAGGAGG + Intergenic
1125882649 15:43207737-43207759 CTATGGATATGACAGGAATAGGG + Intronic
1126742733 15:51794303-51794325 CAGTGGAAAAGACAGGAAGAAGG - Intronic
1127467626 15:59259599-59259621 CTGTAAGAAAGACACGAAGATGG + Intronic
1128697927 15:69782225-69782247 CTGTGGACATGAGAGGGAGATGG + Intergenic
1128706063 15:69838120-69838142 CTGAGAGAGTGACAGGAAGGGGG - Intergenic
1128775212 15:70315231-70315253 TTTTGGGAATGACAGGAAGCAGG - Intergenic
1128811795 15:70578398-70578420 GTGTGGGAAGGAGAGGAGGAGGG - Intergenic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129663142 15:77564600-77564622 CTGTGGGATTTGCAGCAAGAGGG - Intergenic
1130147588 15:81286148-81286170 CTGTGGGAATGTCTGGAGGTAGG + Intronic
1130353531 15:83110739-83110761 CTGTGGGGATGAGCTGAAGAAGG - Intronic
1130440180 15:83945354-83945376 GGGTGGGAAGGACAGGTAGAAGG + Intronic
1131237973 15:90713533-90713555 TTGAGGAAATGACAGGAAAATGG + Intergenic
1131780059 15:95846315-95846337 CTCTGGGAACCACAGGGAGAAGG + Intergenic
1133098093 16:3461239-3461261 TTGTGGGAGTGATAGGAAGGGGG + Intronic
1133437094 16:5789089-5789111 CTGTGTGAGAGAGAGGAAGAGGG - Intergenic
1133661094 16:7918585-7918607 CTCTGGGAATCCCATGAAGAAGG - Intergenic
1135691004 16:24537838-24537860 CTGTGTGAATGAAAGGGCGAGGG - Intronic
1137372174 16:47917731-47917753 CTTTGGGCATGCCAGGAAAAGGG + Intergenic
1137721188 16:50628408-50628430 CTGTGGGACTTACAGGCAGGAGG + Intronic
1137724558 16:50648215-50648237 CTGTGAGAAGGACAGGAATGAGG - Intergenic
1138424930 16:56925235-56925257 ATGTGGAAATGAAAGGAACATGG - Intergenic
1139209496 16:65063423-65063445 GTGTGGAAATGACAGAAAAATGG + Intronic
1139597582 16:67967446-67967468 CTGTGGGTATCACAGGGTGAAGG - Intronic
1140404703 16:74700921-74700943 GTGTGGAAAGGACAGGAGGAAGG - Intronic
1140656688 16:77148416-77148438 CTGTGGGAAAGATAGAAAGATGG + Intergenic
1141053923 16:80798441-80798463 CAATGGGAATGCCATGAAGATGG + Intronic
1141717045 16:85732879-85732901 CTCTGGGGCCGACAGGAAGACGG + Intronic
1142534551 17:605445-605467 CTGAGGGACAGAAAGGAAGATGG + Intronic
1142851196 17:2705633-2705655 CTCTGGGAATGAAAGGGGGAGGG - Intronic
1143157935 17:4850529-4850551 CTGTAGGAAGAACAGGTAGAGGG - Intronic
1143485595 17:7251978-7252000 GAGGGGGAAAGACAGGAAGAGGG - Exonic
1144360496 17:14487280-14487302 ATGTGGGAGGGACAGGAAGGGGG + Intergenic
1144517431 17:15928399-15928421 CTGTGCGGATGCCAGGGAGACGG + Intergenic
1144629869 17:16865547-16865569 CTGTCTGAATGCCAGGAGGAGGG - Intergenic
1144651561 17:17010570-17010592 CTGTCTGAATGCCAGGAGGAGGG + Intergenic
1144725167 17:17498223-17498245 CTGTGGGAGGCACAGGAAGGCGG - Intergenic
1144794455 17:17881615-17881637 CTGTGGGCTTGACAGGCAGATGG - Intronic
1145827930 17:27891217-27891239 GTGTGGGAAGGACAGCAGGAGGG - Intronic
1146581533 17:34042556-34042578 GTGTGGGAAGGACAGGAGGGAGG + Intronic
1146722625 17:35133794-35133816 TTGGGGGGATGACAGGCAGATGG - Intronic
1147884388 17:43675061-43675083 CTGTGGGCATGATAGGATGATGG + Intergenic
1148785530 17:50144384-50144406 CTGTGGCGTGGACAGGAAGATGG - Intronic
1149336522 17:55641670-55641692 CTGTGGGAGGGAAAGAAAGAAGG - Intergenic
1150649477 17:67000585-67000607 CTCTGGGACTGACCGGAGGAGGG + Intronic
1151696924 17:75722488-75722510 CTGAGGGAAGGACAGCAGGAGGG + Intronic
1151889558 17:76944080-76944102 CTGCGGGAATGACAGCAGGGAGG - Intronic
1152255574 17:79237498-79237520 CTGTGGGTGAGACAGGCAGATGG - Intronic
1153486376 18:5602829-5602851 CTTTAGGACTGACAGGAAAATGG + Intronic
1153982008 18:10318139-10318161 CTCAGGTCATGACAGGAAGAAGG + Intergenic
1154339887 18:13494015-13494037 CTGTGGGATGGCCAGGAAGGCGG - Intronic
1155612630 18:27684185-27684207 GGGTGGGAATGAATGGAAGAGGG - Intergenic
1155864143 18:30942853-30942875 CTTTTGGAGTGACAGCAAGATGG - Intergenic
1156240658 18:35250818-35250840 CAATGGGAATGAGAGCAAGAAGG - Intronic
1156527442 18:37779668-37779690 GGGTGGGAATTTCAGGAAGAAGG + Intergenic
1156988755 18:43380647-43380669 CTGTGTTGAGGACAGGAAGAAGG - Intergenic
1157230719 18:45913292-45913314 ATGTGGGAAAGACTGGAATAAGG - Intronic
1157253091 18:46113640-46113662 CTGTGAGAATGACAAGATGTTGG - Intronic
1157452318 18:47798261-47798283 CTGTGGGGAGGAGAGAAAGAAGG - Intergenic
1157858698 18:51122746-51122768 CTGAAGGAAGGACTGGAAGAAGG + Intergenic
1158400168 18:57114692-57114714 CTGTGTGGATGACAGTAAGCAGG + Intergenic
1159468564 18:68818528-68818550 GAGTGGTAATGACAGGAGGAAGG - Intronic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1161183287 19:2899953-2899975 CTGTGGGAAGGACAGGAGGCTGG + Intergenic
1162211126 19:9093187-9093209 TTATAGGAATGACAGGGAGATGG - Exonic
1162527797 19:11216779-11216801 CTGTGGGACTGAGAGGAAAGGGG - Intronic
1162867635 19:13560843-13560865 CTGTGGGAAAGAGATGATGAGGG - Intronic
1163527514 19:17830653-17830675 GTGTAGAAAGGACAGGAAGAGGG + Intronic
1163747305 19:19056055-19056077 CTGTGGGAGGGACAGGGACAGGG - Intronic
1164590712 19:29505331-29505353 CTGGGGGAGGGACAGGAGGAGGG + Intergenic
1165031738 19:33002547-33002569 CTGTGACAATGACAGAACGAGGG - Intronic
1166076930 19:40419167-40419189 CTGAATGAAGGACAGGAAGAAGG + Intergenic
1166284268 19:41814164-41814186 GTGTGGGAAGGACTGGCAGATGG - Intergenic
1167539205 19:50074603-50074625 ATGAGTGAATGACAGGAGGAGGG - Intergenic
1167630502 19:50623255-50623277 ATGAGTGAATGACAGGAGGAGGG + Intronic
1168497894 19:56869516-56869538 CTGGGGAAATGAAAGGAAGTGGG - Intergenic
925751286 2:7091995-7092017 CAGGGGTAAGGACAGGAAGAGGG - Intergenic
926219321 2:10924623-10924645 ATGTGGGAATTACAGCAAGGAGG + Intergenic
926316364 2:11713146-11713168 CTTTGGGGAAGACATGAAGATGG + Intronic
927158488 2:20236187-20236209 GGGTGGGGATGACAGGAAGCTGG + Intergenic
927391428 2:22599762-22599784 CGGTGTGAAGGACAGGGAGAAGG - Intergenic
927702101 2:25275362-25275384 CTGTGGGAAGGAGAGGAAGTGGG - Intronic
928106106 2:28471566-28471588 CTGTGAGGGTGACAGGAAGAGGG + Intronic
929631237 2:43464934-43464956 CTGTTGGCATGACAAGAACAGGG + Intronic
930120272 2:47755170-47755192 CTATGGGAATCCCAGGCAGAAGG - Intronic
930451773 2:51550032-51550054 CTATGGGAATAACAGGAAAAAGG - Intergenic
931812936 2:65872655-65872677 CTGGGGGAATGATATGATGAGGG + Intergenic
931921016 2:67015835-67015857 CTGTGGGGCAGACAGGAAGTGGG + Intergenic
932576792 2:72966784-72966806 CTGTGGGCCTGGCAGCAAGAAGG - Intronic
933167901 2:79095493-79095515 AGGTGGGAAGGACAGGAGGAGGG + Intergenic
933514178 2:83279570-83279592 CTGTCAGAATGACAGGAAAGAGG - Intergenic
933690479 2:85175729-85175751 AGCTGGGAATGACAGGAAGAGGG + Intronic
936053009 2:109239806-109239828 CTGTGGGGATGAAAGGCAGGTGG - Intronic
936399472 2:112154656-112154678 CTATGGGATGGACAGGAAGCCGG - Intronic
937266246 2:120616349-120616371 CTCTGGAAAGGACAGGAAAAGGG + Intergenic
937562138 2:123239258-123239280 CAGAGGAAAAGACAGGAAGATGG + Intergenic
938107932 2:128545961-128545983 CTGTGGAAAAAACAGGAACAGGG + Intergenic
939440923 2:142248312-142248334 TTGTGGCAATGACAAAAAGATGG + Intergenic
939891320 2:147739800-147739822 CTGTGGATTTGACAGGAAGCTGG - Intergenic
941415817 2:165219788-165219810 TGGTGGGGATGACAGGAAGCAGG + Intergenic
941995973 2:171602431-171602453 CTGAGGGATTGGCTGGAAGATGG - Intergenic
942563101 2:177241021-177241043 CCCTGAGAATGACAGGAAGGTGG + Intronic
945090540 2:206172584-206172606 CTGTGGAAAGGAGAGGGAGAGGG + Intergenic
945436356 2:209822991-209823013 CAGTGTGAATCACAGAAAGAAGG - Intronic
947052575 2:226062741-226062763 GTGAGGGAATGAGAGGGAGAGGG + Intergenic
947103256 2:226644149-226644171 CTGTGGGAGAGAAAGGGAGAGGG - Intergenic
947348432 2:229218155-229218177 CTGTGAGAGTGACTGGAATATGG + Intronic
947404672 2:229762496-229762518 ATGTGAGAAGGGCAGGAAGAAGG - Intergenic
947856875 2:233330098-233330120 GTGTGGGAACAACAGGCAGAAGG - Intronic
948127993 2:235578904-235578926 CTGTGTGACTGACAGCTAGAGGG - Intronic
948381398 2:237552314-237552336 CTTTGGGGAAAACAGGAAGAGGG - Intronic
948532245 2:238616675-238616697 CCGTGGGCATTCCAGGAAGAAGG - Intergenic
948554326 2:238796793-238796815 ATGTGAGAATGTCAGGAAGAAGG - Intergenic
948811143 2:240479031-240479053 CACTGGGAATGAGAGGAAGGAGG - Intergenic
949043716 2:241860767-241860789 CAGTGGGACTGAGAGGAGGAGGG - Intergenic
1168860976 20:1045943-1045965 GTGTGGGAAGGACAGATAGATGG + Intergenic
1168990972 20:2095436-2095458 TGGTGGGAAACACAGGAAGAGGG - Intergenic
1169080622 20:2796052-2796074 CTGTGGGAAGCACAGGACGATGG - Exonic
1169385762 20:5148174-5148196 CTGTTGCAATGGCAGGAAGGGGG - Intronic
1169666808 20:8046762-8046784 CTTTGTGAATGAAAGGAAGGAGG - Intergenic
1169831344 20:9828864-9828886 ATGGGGGAAGGAAAGGAAGAAGG - Intronic
1170329569 20:15193716-15193738 CTGGGGAAATGAGAGGATGAGGG - Intronic
1170455922 20:16532637-16532659 CTGTGGGAATGGGAGGAATCTGG - Intronic
1172097637 20:32468057-32468079 CTGGGGGCATGCCAGGATGAGGG + Intronic
1172189962 20:33056021-33056043 CTGTGGGAAGGGCAGGATGGAGG - Intronic
1172600271 20:36178352-36178374 CAATGGGACTGGCAGGAAGAAGG - Intronic
1172639484 20:36432209-36432231 CGGTGGCAATGGCAGCAAGAAGG + Exonic
1173086597 20:39925208-39925230 CTGTGGGAGAGAGAGGAAGGTGG + Intergenic
1173249500 20:41357204-41357226 CTGTGGGAAGGGGAGGGAGAGGG + Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174383202 20:50170905-50170927 CAGAGGGAACGAAAGGAAGAGGG + Intergenic
1175610448 20:60347013-60347035 CTGTAGGCATCACAGGGAGAAGG + Intergenic
1176916271 21:14629465-14629487 CTGTGAGAATAAAATGAAGAAGG + Intronic
1178689322 21:34738265-34738287 AAGTGGGAAAGGCAGGAAGAAGG - Intergenic
1178808561 21:35860075-35860097 CTGTTGGATGGATAGGAAGAAGG + Intronic
1178923411 21:36755553-36755575 CAGTGGGAATGACGTGAACATGG - Intronic
1179145158 21:38761601-38761623 CTCTGGGAATGACAAGAGGATGG - Intergenic
1179297923 21:40079784-40079806 ATGTGGAAATGATAGGAAGGTGG + Intronic
1179324157 21:40323184-40323206 AGGAGGGAAGGACAGGAAGAAGG - Intronic
1179718400 21:43301867-43301889 ATGCGGGAATCACAGGGAGATGG + Intergenic
1179784231 21:43720390-43720412 CTGGGAGGAGGACAGGAAGAGGG + Intronic
1180014009 21:45071262-45071284 CCCTGGGCATGACAGGAAGGGGG + Intergenic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1181487570 22:23241316-23241338 GGGGGGGAATGGCAGGAAGAGGG - Intronic
1181674793 22:24444645-24444667 CTTTGGGAAGGGCAGGGAGAGGG - Intergenic
1182234730 22:28866358-28866380 CTGAGGGAATAGCAGGATGAGGG + Intergenic
1182582873 22:31325651-31325673 CACTGGGATTGACAGGTAGATGG - Intergenic
1183362937 22:37392077-37392099 CTGTTGCACTGACAGCAAGAAGG - Intronic
1183367070 22:37412552-37412574 CTGGAGGAGTGCCAGGAAGAAGG - Intronic
1183412173 22:37661231-37661253 CTATGGGAGTGACAGCAGGATGG - Intronic
1183646680 22:39131289-39131311 CTGGGGGAAAGAAAGGCAGATGG + Exonic
1184144353 22:42600183-42600205 CAGTGAAAATGACAGGAAAATGG + Intronic
1184742689 22:46438228-46438250 CTGTGGGGATGAGAGGCAGCTGG + Intronic
949184976 3:1179508-1179530 CTGTGGGAAACACTGGAACACGG - Intronic
949515037 3:4800074-4800096 CTGTAGGGATGACTGGAAGCAGG + Intronic
950762192 3:15241253-15241275 CTGTGGGCGTGACAAAAAGATGG - Intronic
950970926 3:17187081-17187103 CTGTAGGAATTAGAGAAAGAAGG + Intronic
952043855 3:29293671-29293693 ATCTGGGAAAGACAGGGAGATGG - Intronic
952736327 3:36695073-36695095 ATGTGAGAATGACAGGGACAGGG + Intergenic
954132804 3:48568856-48568878 CTGTGGGAGTGACCAGGAGAGGG + Intronic
954266219 3:49472169-49472191 CTGGTGGAGTGGCAGGAAGAGGG + Intronic
954418192 3:50404423-50404445 CTGCTGGAATGAGAGGCAGAGGG + Intronic
954748727 3:52802020-52802042 CTGTTGGAATGAAAGCAAGAAGG - Intronic
955004148 3:54953762-54953784 CTGTGGGAATCACTGGGAGTGGG + Intronic
955005194 3:54962012-54962034 CTGGTGGATTTACAGGAAGAGGG - Intronic
955058416 3:55475658-55475680 GTGTTAGAATGACAGCAAGAAGG + Intronic
955406759 3:58630610-58630632 CTGTGGGAAGGAGTGGAGGAAGG - Intergenic
955520767 3:59773329-59773351 CTGTGGGAGTCACAGAAAGGGGG + Intronic
956528975 3:70196336-70196358 CTGTTGTAATTACAGGAACATGG + Intergenic
957409896 3:79826091-79826113 GTGTGGGAATGAGAGGCAGTGGG + Intergenic
958984245 3:100761948-100761970 CTGTTTGAATAACTGGAAGATGG - Intronic
960670586 3:120152085-120152107 CTGAGGGAAAGACAGAGAGATGG - Intergenic
961746132 3:129064560-129064582 CTTTGGCAATGAGAGGAAGAGGG - Intergenic
962526173 3:136239566-136239588 CTGAGTGAATGAGAGAAAGAGGG - Intergenic
962962931 3:140328015-140328037 CCATGGGAATCACAAGAAGATGG + Intronic
963747325 3:149138012-149138034 CTGGGGGAATTTTAGGAAGATGG + Intronic
963788218 3:149556679-149556701 CTTTGGGAAGGAAAGGAATAAGG + Intronic
963873371 3:150444507-150444529 CTGTTGGCAAGAAAGGAAGAAGG + Intronic
964877380 3:161383231-161383253 CTGTGGGAAATATAGGTAGAGGG + Intergenic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
968456572 4:703599-703621 GTTTGGGCATGAGAGGAAGAGGG + Intergenic
968819362 4:2837922-2837944 CAGTGAGAATGGCTGGAAGATGG - Exonic
968842918 4:3021273-3021295 CTCTCAGAATGACAGGAAGAGGG - Intronic
970465179 4:16315307-16315329 CTGATGGAGTGTCAGGAAGAAGG - Intergenic
970645319 4:18114059-18114081 CTGGGAGAATGACAGAAAAAGGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
975616318 4:76251408-76251430 CTGAAGGAAAGAAAGGAAGAAGG - Intronic
977193272 4:94026823-94026845 GTGTGGCACTGACATGAAGATGG + Intergenic
977292831 4:95181763-95181785 CTGTGGGAAAGAAAGAAGGATGG + Intronic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978714152 4:111821793-111821815 GTGTGGGAGTGAAAGGAAAAGGG - Intergenic
978874209 4:113619330-113619352 CTGTGGTAAAGACAGTGAGAGGG - Intronic
979529805 4:121757795-121757817 CTGTGGGAATGACATAAGGATGG + Intergenic
979744136 4:124188755-124188777 CTGTGGAATTGAAAGGAAAATGG - Intergenic
980167440 4:129246247-129246269 CAGAGGGAATGACAAGAAAAAGG - Intergenic
981092114 4:140742747-140742769 GAGTGGGAAAGACAGGAGGAGGG - Intronic
981487348 4:145301326-145301348 CTTTGGGAATGATAGTAAGTGGG + Intergenic
982722045 4:158869249-158869271 CTGTGGGGATGACAACAAGAAGG + Exonic
983068753 4:163243755-163243777 TTGTGGGAAGGACAGCAAGCAGG + Intergenic
983497622 4:168461097-168461119 CTCTGGGAAGGAGAGTAAGAGGG - Intronic
983539332 4:168891608-168891630 AAGTGGGAAAGAAAGGAAGAAGG + Intronic
983885037 4:172971143-172971165 CTATGGGGGTGACAGAAAGAGGG - Intronic
984133290 4:175905110-175905132 CTGTGGAAGTGACAAGATGAAGG + Intronic
985515553 5:343172-343194 CTCTCGGAGTGACAGGAACATGG + Intronic
985986874 5:3523314-3523336 CTATGGAGATGGCAGGAAGATGG - Intergenic
986168662 5:5297569-5297591 ATGGGGGAAAGACAGGAACATGG - Intronic
986206396 5:5628804-5628826 CTGAGGGAAGGACAAGGAGATGG - Intergenic
986455715 5:7915884-7915906 CTGTGGGAAGCCCAGGTAGAAGG + Intergenic
986841926 5:11707331-11707353 CTGTGTGCATGAGAGGAGGATGG - Intronic
987393988 5:17403769-17403791 CTGGGACAATGTCAGGAAGATGG - Intergenic
987685496 5:21194736-21194758 CTGAGTGAAAGACAGAAAGAAGG + Intergenic
988841343 5:35086851-35086873 GTGTGGGGATGGCAGAAAGATGG - Intronic
989100890 5:37822073-37822095 CTGTGGGCCTGAGAGGGAGATGG + Intronic
990800502 5:59596938-59596960 CAGTGGCAATTACAGGGAGAAGG + Intronic
990954400 5:61329317-61329339 CTGTGGGAGTTACAGGAAAGAGG + Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991122301 5:63030741-63030763 CTGGTGGAATGACAGGATGTAGG + Intergenic
991125705 5:63067493-63067515 CTGGGGGACTGAAAGGGAGAGGG - Intergenic
992134250 5:73727216-73727238 CTGTGGGAATACTAAGAAGATGG + Intronic
993820004 5:92602447-92602469 CTGTCTGTAAGACAGGAAGAGGG - Intergenic
994097772 5:95862613-95862635 CTGTGGGAATAAAAAGCAGAGGG - Intergenic
994208405 5:97061243-97061265 TTGGGGGAATGACAGTGAGAAGG - Intergenic
996471900 5:123871096-123871118 CTTAGGGAATGACAGGAATAGGG - Intergenic
996652200 5:125892629-125892651 CTATGGGAAGGAAAGGAAAAAGG + Intergenic
996743838 5:126828150-126828172 GTGAGGGATAGACAGGAAGATGG - Intronic
996759264 5:126970804-126970826 TTTTGGAAATGACAGGAAGTAGG - Intronic
997254806 5:132420294-132420316 CCCTGGGAGTGACTGGAAGAAGG - Intronic
997267824 5:132506659-132506681 CTCTTGGAATGAATGGAAGATGG + Intergenic
997502237 5:134385227-134385249 CTGTGGGATGGACAGTAAGTTGG + Intronic
997823042 5:137083170-137083192 CTGTGGCAATGACATGATGAGGG - Intronic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1003122674 6:3330499-3330521 CTTGGGGAGTGACAGGAAGGAGG - Intronic
1003663467 6:8087182-8087204 CTGAGAGAATGACGGGAAGGAGG + Intronic
1004753290 6:18585220-18585242 TTGTTCCAATGACAGGAAGATGG - Intergenic
1007766091 6:44161060-44161082 CTGTGGGAAGCACAGACAGATGG - Intronic
1008093149 6:47312659-47312681 ATGAGGGAATGACAGAAAGTTGG + Intergenic
1008171529 6:48213686-48213708 CTGTAGGAATCACATGGAGAAGG + Intergenic
1008802648 6:55388901-55388923 CTGGGGGAAGAACAGGAAGAGGG - Intronic
1010977674 6:82334548-82334570 ATGTGGAAATGAAAGGAAAAGGG - Intergenic
1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG + Intronic
1013582354 6:111548780-111548802 CTGTGGGATAGAAAGCAAGAAGG + Intergenic
1014535854 6:122611666-122611688 GTGTGGCAATGTCAGTAAGAAGG - Intronic
1015507320 6:134002579-134002601 CATTGGGAATGATAGCAAGAGGG - Intronic
1017011043 6:150064118-150064140 CTGGGGGAATCCCAGGACGAGGG - Intronic
1017889997 6:158630006-158630028 CTGTGGGAATGACACAACGCAGG - Intronic
1017964990 6:159256394-159256416 ATGTGGGAACTACAGGAAGGAGG - Intronic
1019006265 6:168799230-168799252 CTGGGGGATTGACAGGCAGCTGG - Intergenic
1019723355 7:2586903-2586925 CTGTGGGAGTGTTAGGCAGAGGG + Intronic
1020224442 7:6269070-6269092 CAGGAGGAATGGCAGGAAGAAGG - Intronic
1022452704 7:30529961-30529983 CTCTTGAAATGAAAGGAAGATGG - Intronic
1023665456 7:42518296-42518318 CTATAGAAATGAGAGGAAGAAGG + Intergenic
1023897325 7:44444857-44444879 CGCTGGGAATAAAAGGAAGAAGG - Intronic
1024024374 7:45398851-45398873 TTGGGGTCATGACAGGAAGAAGG + Intergenic
1024112856 7:46164097-46164119 CTGTGGGACTGTCAGGAATCTGG + Intergenic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1024993617 7:55254870-55254892 CTGCGGGACTGAGAGGGAGAAGG + Intronic
1026140287 7:67699805-67699827 ATGTGGGAATCAGAGGAAGATGG - Intergenic
1026552765 7:71381953-71381975 TTGTGGGAAAGAAAGGCAGAGGG + Intronic
1028445509 7:90917762-90917784 CTGTGAGAATGCCAGGCAGATGG + Intronic
1029234691 7:99104813-99104835 CAGTGGCAATGACAGCAATAGGG + Intronic
1031986923 7:128169252-128169274 CTGTGAGAATGTCTGGAAGGGGG - Intergenic
1033047843 7:137978692-137978714 CTGGGTGAATGAGAGGAAGGGGG + Intronic
1033242737 7:139694226-139694248 CTGTGAGAGTTACAGGAGGATGG - Intronic
1033461877 7:141553733-141553755 GTATGGGATTCACAGGAAGATGG + Intronic
1033477617 7:141705913-141705935 CTGTGGCAATAAGAGGAAAAGGG - Intergenic
1033493217 7:141864842-141864864 TAGTGGGTATGACAGGAACAAGG - Intergenic
1034122636 7:148641286-148641308 CTTTGAGAATGACAGGAACCAGG - Intergenic
1034278388 7:149834590-149834612 CTGTGGGATTTACAAGAGGATGG - Intergenic
1034424051 7:151004787-151004809 GGGTGGCAGTGACAGGAAGAAGG + Intronic
1034540520 7:151755201-151755223 CTGTGGGTGTGACAGACAGATGG - Intronic
1034587896 7:152112063-152112085 CTTTGGGAAAGGCAGAAAGAGGG + Intronic
1035172289 7:157023664-157023686 CTGTGGGACTGAGAGGGAAAGGG + Intergenic
1035909207 8:3547113-3547135 CTGTGTGAATGGCAGCATGAGGG - Intronic
1036778306 8:11628606-11628628 CTGTGGGAATGATTGCAGGAAGG + Intergenic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1037688908 8:21166503-21166525 CTGTAGGCATGAGAGGCAGATGG - Intergenic
1038202528 8:25427518-25427540 CTGTTGGGATGACAGGAAAAAGG - Intergenic
1038881853 8:31623316-31623338 AAGTGGGAATGAAAGGATGAAGG + Intergenic
1039190759 8:34971602-34971624 CTGTGTCACTTACAGGAAGAAGG - Intergenic
1039898202 8:41731167-41731189 TTGTGGGAGTCACAGGAAAAGGG + Intronic
1040015495 8:42696028-42696050 TTGTGGGAATGCAAGGAGGAAGG - Intergenic
1041125664 8:54635974-54635996 CAGTGGGGAGGAGAGGAAGAGGG - Intergenic
1041368799 8:57137122-57137144 ATGTGGCAAAGAGAGGAAGAGGG - Intergenic
1041741478 8:61162077-61162099 CTCTGGGAAAGACGGCAAGAAGG - Intronic
1042068589 8:64905595-64905617 CTTTGGCCATGACAGGAAGGAGG - Intergenic
1043273684 8:78366352-78366374 CTTTGGTAATGACAGGTAGTAGG + Intergenic
1043916011 8:85922805-85922827 CTGAGGGAATCAGGGGAAGAAGG - Intergenic
1044282225 8:90369356-90369378 CTAGGAGAGTGACAGGAAGAAGG - Intergenic
1044867632 8:96587836-96587858 ATGTGTGAATCACAGGAAAAGGG + Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045238428 8:100376734-100376756 GAGTGGGAAGGTCAGGAAGAAGG + Intronic
1045322959 8:101095707-101095729 CTGAGGGAAAGACGGGGAGAGGG - Intergenic
1045911829 8:107419085-107419107 CTGTGTGCATGACAGGCTGAAGG - Intronic
1046502471 8:115096410-115096432 CTGTAGGATAAACAGGAAGATGG + Intergenic
1047020086 8:120766106-120766128 CTGTGAAAATGACAAGAAGAGGG + Intronic
1047645090 8:126861774-126861796 TTGGGGGATTGACTGGAAGAGGG + Intergenic
1047914310 8:129565567-129565589 CTGTGGGGATTCCAGGAAGGGGG + Intergenic
1048008408 8:130437769-130437791 CCGTGGGCACAACAGGAAGAAGG - Intronic
1048277830 8:133080588-133080610 CTGTGGGAAAGGGATGAAGATGG - Intronic
1048977379 8:139680484-139680506 CTGGAGGAGGGACAGGAAGATGG + Intronic
1049138138 8:140924319-140924341 CTGTGGGAATAAAATGAAGCAGG - Intronic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049800052 8:144513481-144513503 CTTTGGGGAAGACAGGCAGATGG + Intronic
1050227132 9:3472171-3472193 CTCTGGAATTGACAGGAAGAGGG + Intronic
1051106535 9:13587301-13587323 GTTTAGGAATGACAGGAAGTAGG - Intergenic
1051999041 9:23253929-23253951 TTGTGGGAATGAGAAGAACAGGG + Intergenic
1052014318 9:23447300-23447322 CTGTGGGAGGGAGACGAAGAGGG - Intergenic
1052014329 9:23447354-23447376 TAGTGAGAATGACAGGAAGAGGG - Intergenic
1052203696 9:25812598-25812620 CTGTGGGAGTGACAGCAAGAAGG - Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1055020031 9:71659774-71659796 CTATGGGAATGACAGCACCAAGG + Intergenic
1056959808 9:91113172-91113194 CTCTGAAAATGACAGGAAGATGG + Intergenic
1057050348 9:91918930-91918952 CTGTGGGCATGACAAGGACAGGG - Intronic
1059076124 9:111195753-111195775 TTCTGGGAATGTCAGGGAGAAGG + Intergenic
1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG + Intronic
1059736264 9:117102943-117102965 CTGTGAGAGAGACAGGGAGAGGG + Intronic
1060380238 9:123163125-123163147 AAGTAGGAATGTCAGGAAGAGGG + Intronic
1060586139 9:124787181-124787203 CTGTGAGAACGAGTGGAAGATGG + Exonic
1060875664 9:127081879-127081901 CTGTGGGAATGCCACGCAGATGG + Intronic
1060990322 9:127845271-127845293 CTGTGGGAAGGTGAGGAAGGAGG - Intronic
1061213775 9:129208595-129208617 CTGTGGGGAAGACAGGAAGTGGG - Intergenic
1062582504 9:137234765-137234787 CTGTGGGGCTGAGAGGAAGCTGG - Intronic
1185444310 X:249810-249832 CTCAGGCCATGACAGGAAGAGGG + Intergenic
1185838450 X:3367277-3367299 CTTCGAGGATGACAGGAAGAAGG + Intergenic
1186093659 X:6077049-6077071 ATGTAGGAATGAAAGGAAAAAGG - Intronic
1186344770 X:8680688-8680710 GTGAGAGAATGACGGGAAGAAGG - Intronic
1186666510 X:11722311-11722333 CTGTCCGAAAGCCAGGAAGAGGG + Intergenic
1186848505 X:13555373-13555395 CTTTGGAGATGAGAGGAAGAAGG + Intergenic
1186917074 X:14234385-14234407 CTGGAGGAATGTGAGGAAGAGGG - Intergenic
1187201102 X:17134404-17134426 CTGGGAGAAGGACAAGAAGAGGG - Intronic
1188699499 X:33240737-33240759 CTGTTAGAATGACATCAAGAAGG - Intronic
1192184957 X:68940584-68940606 GTGGTGGAAAGACAGGAAGATGG - Intergenic
1192237025 X:69302499-69302521 CTGTGAGATTGAGAGGATGAGGG - Intergenic
1192313345 X:70034058-70034080 CTGGGAGAATGACAGCAGGAAGG - Intronic
1192576291 X:72245775-72245797 CTGTGGAAATGACAGGGACTGGG + Intronic
1192800128 X:74457762-74457784 GTGTGGGAATGGCAAGTAGATGG - Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196730559 X:118937627-118937649 TTGTGGTTTTGACAGGAAGATGG - Intergenic
1198053145 X:132968366-132968388 CTGAGAAAAGGACAGGAAGAGGG - Intergenic
1199137776 X:144273327-144273349 CTGTCTGAAAGTCAGGAAGAAGG - Intergenic
1199319811 X:146425084-146425106 ATGTAGGAATGTGAGGAAGAAGG + Intergenic
1199941049 X:152628209-152628231 GGGTGGGAATGACAGGAAGGAGG + Intergenic
1199979505 X:152913245-152913267 TTGTGGGCATGACAGGAAGCAGG - Intergenic
1200495881 Y:3882956-3882978 CTCTGGGCATAACAGGAATAAGG - Intergenic
1201237312 Y:11923619-11923641 CTTCGAGAAAGACAGGAAGAAGG - Intergenic