ID: 915458376

View in Genome Browser
Species Human (GRCh38)
Location 1:156054828-156054850
Sequence GCGGCCCGCGGGAGGCACCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915458365_915458376 16 Left 915458365 1:156054789-156054811 CCCGGAGCAGGCCAACGGGACTA 0: 1
1: 0
2: 0
3: 5
4: 55
Right 915458376 1:156054828-156054850 GCGGCCCGCGGGAGGCACCTCGG 0: 1
1: 0
2: 0
3: 9
4: 133
915458369_915458376 5 Left 915458369 1:156054800-156054822 CCAACGGGACTACGGGAAGCAGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 915458376 1:156054828-156054850 GCGGCCCGCGGGAGGCACCTCGG 0: 1
1: 0
2: 0
3: 9
4: 133
915458361_915458376 26 Left 915458361 1:156054779-156054801 CCCAGGGCGTCCCGGAGCAGGCC 0: 1
1: 0
2: 2
3: 8
4: 147
Right 915458376 1:156054828-156054850 GCGGCCCGCGGGAGGCACCTCGG 0: 1
1: 0
2: 0
3: 9
4: 133
915458362_915458376 25 Left 915458362 1:156054780-156054802 CCAGGGCGTCCCGGAGCAGGCCA 0: 1
1: 0
2: 2
3: 10
4: 146
Right 915458376 1:156054828-156054850 GCGGCCCGCGGGAGGCACCTCGG 0: 1
1: 0
2: 0
3: 9
4: 133
915458366_915458376 15 Left 915458366 1:156054790-156054812 CCGGAGCAGGCCAACGGGACTAC 0: 1
1: 0
2: 0
3: 1
4: 45
Right 915458376 1:156054828-156054850 GCGGCCCGCGGGAGGCACCTCGG 0: 1
1: 0
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915458376 Original CRISPR GCGGCCCGCGGGAGGCACCT CGG Exonic
900971004 1:5992400-5992422 GCCACCCGCGGGAGGAGCCTCGG + Exonic
901443672 1:9293711-9293733 TGGGCCCGCGGGAGGAACCGCGG + Intronic
901597924 1:10399499-10399521 GGGGCCCGCGGGAGGCGCGGAGG + Intronic
906678662 1:47710362-47710384 CCAGCCCGCCGCAGGCACCTAGG - Intergenic
910089092 1:83441145-83441167 GAGGGCCGGAGGAGGCACCTGGG - Intergenic
910221487 1:84893215-84893237 GCGGTGCGAGGGAGGGACCTAGG + Intergenic
911586280 1:99695013-99695035 GCGGCCCGCGGGCGGCAGGTTGG + Intergenic
912363311 1:109112852-109112874 GCTGACCACGGGAGGCCCCTGGG + Intronic
915458376 1:156054828-156054850 GCGGCCCGCGGGAGGCACCTCGG + Exonic
915636485 1:157190448-157190470 GCAGCCCGCTGGAGTCAGCTGGG + Intergenic
918071934 1:181139638-181139660 ATGCCCCGCAGGAGGCACCTGGG - Intergenic
921155159 1:212433228-212433250 GCGGCCCGCGGCGGGCGCCCTGG + Intronic
922787763 1:228291620-228291642 GAGGCCCTCTGGAGACACCTGGG - Intronic
1065024187 10:21525991-21526013 GCGGCCCGCGCGAGGGATCCTGG - Intergenic
1065214675 10:23438797-23438819 GCGGTCCGTGGGAGTCACGTGGG + Intergenic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1075129536 10:119726214-119726236 GCGGCCCGCGGGCGGCGCACGGG - Exonic
1075684285 10:124353233-124353255 GGGGCCGGCGGGAGGGAGCTGGG - Intergenic
1076064741 10:127440296-127440318 GCGGCCAGTGGGAGGCATCTGGG - Intronic
1076241923 10:128915270-128915292 GGGGGCCGTGGCAGGCACCTGGG + Intergenic
1076675876 10:132147516-132147538 GGGGCACCCGGGAGCCACCTGGG + Intronic
1076807785 10:132867799-132867821 GGTGCCCGCGGGAGGCACAGCGG - Intronic
1077062744 11:625032-625054 CCGGCCAGCGGGAGCCCCCTTGG - Exonic
1079071470 11:17351631-17351653 GCCGCTCGCGAGAGGCACCGGGG + Intergenic
1084386218 11:68844069-68844091 CCGGCCTGCAGGTGGCACCTAGG - Intronic
1084716645 11:70878513-70878535 GCAGCCCGAGGGAGGTCCCTGGG - Intronic
1085348854 11:75785410-75785432 GCAGGCCTCGGGAAGCACCTGGG - Intronic
1089386470 11:118071462-118071484 GGGGCCAACAGGAGGCACCTTGG - Intergenic
1094624096 12:32106712-32106734 GCGCCCGGCGGGAGGCGCCTCGG + Intergenic
1098347811 12:69524498-69524520 GCGGCCCCCAGGAGGTACCTGGG + Intronic
1103510059 12:121467630-121467652 GCGCGCCGCGGGATGCACATGGG + Intronic
1103581422 12:121918458-121918480 GCGACCGGCAGGAGGCACGTCGG + Exonic
1106264877 13:28100752-28100774 GCGGACCGCGGCGGGCACGTGGG - Intergenic
1108541701 13:51452354-51452376 GCGGCCCGCGGGCGGCAGGGTGG - Intronic
1113453804 13:110433038-110433060 GCTGCCAGCGGGAAGCATCTAGG + Intronic
1119322917 14:73742209-73742231 GCAGCCCCCTGGAGGCACGTGGG - Intronic
1119382802 14:74239694-74239716 GCTGCCCGCGGGTGGGAGCTCGG - Exonic
1121312789 14:92944201-92944223 GCACCCCACAGGAGGCACCTTGG - Intronic
1122400042 14:101461654-101461676 GCTGCACGCAGGAGGCAGCTCGG + Intergenic
1124453639 15:29821823-29821845 GCGGGCCGCGGGGAGCCCCTCGG - Intronic
1125069841 15:35540926-35540948 GTGGCCAGGGGGAGGCAACTGGG - Intronic
1125503280 15:40252617-40252639 GCCCTCCGCGGGAGGGACCTCGG - Intronic
1128725628 15:69986587-69986609 GCCGTCCACGGGAGGCCCCTGGG - Intergenic
1128982455 15:72197532-72197554 GCGGGCCCCGGGAGACGCCTGGG + Intronic
1132999006 16:2839913-2839935 GCGGCCCCCCGGAGTCACCCTGG + Intergenic
1133002465 16:2858231-2858253 GGTGGCCGCGGGAGCCACCTGGG - Intergenic
1135521616 16:23182637-23182659 GCGGCCTGGGGAAAGCACCTGGG + Intergenic
1137586082 16:49664645-49664667 ACGGCCCCTGGGAGGCCCCTGGG + Intronic
1138104836 16:54282473-54282495 GCGGGCCGGGGGAGGCAGCAGGG - Intergenic
1138488388 16:57361376-57361398 CTGGCACTCGGGAGGCACCTTGG - Intronic
1141662076 16:85446837-85446859 GCGGGCCCTGGGAGGAACCTCGG - Intergenic
1142205038 16:88778866-88778888 GTGGCCCAGGGAAGGCACCTGGG + Intronic
1142393240 16:89816316-89816338 GCGCCCCGCGGGCGGCGGCTGGG + Intronic
1146053348 17:29568798-29568820 GCAGCCCTCGCGAGGCTCCTGGG + Exonic
1147000627 17:37359423-37359445 GCGGGCCGCGGGCGGGCCCTGGG + Intronic
1147363164 17:39944040-39944062 ACAGCCCCGGGGAGGCACCTGGG - Exonic
1148598252 17:48873918-48873940 GGGGCCTGCAGGAGACACCTTGG - Intergenic
1148896226 17:50840706-50840728 GCGGCCCGAGTCAGGCTCCTCGG - Exonic
1150764717 17:67993851-67993873 GCGGGCGGCGGGAGCGACCTCGG + Intergenic
1151662575 17:75526327-75526349 GAAGCCCGCGGGAGGGACTTCGG + Intronic
1151685213 17:75642248-75642270 GAAGCCCCGGGGAGGCACCTCGG - Intronic
1152237130 17:79144430-79144452 GAGGCCTGCAGGAGGCAGCTAGG - Intronic
1152335347 17:79697440-79697462 GTGGCCAGGGGGAAGCACCTGGG - Intergenic
1152433074 17:80260432-80260454 CCAGCCCCCGGGAGGCGCCTCGG - Intergenic
1152755106 17:82083940-82083962 GAGGGCAGCGGGAGGCACCGGGG + Intronic
1156341417 18:36213426-36213448 GGGGCCTGCCAGAGGCACCTGGG + Exonic
1160575595 18:79852029-79852051 GCGGACCGCGGCACTCACCTGGG + Intergenic
1160768812 19:821444-821466 GGGGCCCGGGGGAGACGCCTCGG - Intronic
1161350090 19:3786440-3786462 GGGGCGCGCGGGAGGCGCCGGGG - Intronic
1161816269 19:6501857-6501879 GCAGCCCGGGGGAGGCACCGGGG + Intronic
1163703795 19:18800692-18800714 GTGGCCCCTGGGAGGCTCCTTGG - Intergenic
1163848325 19:19649936-19649958 CCGGCCTGCGGGCAGCACCTAGG + Exonic
1165770112 19:38375038-38375060 CCGGGCCGCGGAAGCCACCTCGG + Intronic
1165896573 19:39145230-39145252 GGGCCCTGGGGGAGGCACCTGGG - Intronic
1167145987 19:47681044-47681066 GCTGACCGCGGGGGGCGCCTGGG - Exonic
1167311156 19:48738831-48738853 GGGGCCCGCGGGAGGGGACTGGG - Intronic
1167449080 19:49556535-49556557 GCGGCCCTCGTGAGTCACCTGGG - Exonic
927156275 2:20223560-20223582 CCGGCCCGCAGGAGGGACCCCGG + Intronic
932827997 2:74958949-74958971 CCCGCCCGCGGGAGGCCCCGAGG - Intronic
933902799 2:86861681-86861703 GGGGCGCCCGGGAGGCAGCTTGG - Intronic
935777748 2:106487588-106487610 GGGGCGCCCGGGAGGCAGCTTGG + Intergenic
936370481 2:111898573-111898595 GCGGCCGGCGGGAGGTGCCGAGG - Exonic
937992489 2:127672420-127672442 GGGAGCCGTGGGAGGCACCTGGG - Intronic
947727144 2:232407941-232407963 GCGGGCCGAGGCAGGCACGTCGG - Exonic
948832337 2:240604135-240604157 GCGGCTTGGGGGAGACACCTGGG + Intronic
948900923 2:240956576-240956598 GCTGCCAGCGGGGGTCACCTGGG + Intronic
1174049374 20:47757157-47757179 GGGGCCCCAGGGTGGCACCTCGG - Intronic
1174414273 20:50356846-50356868 GGAGCAAGCGGGAGGCACCTCGG + Intergenic
1175121338 20:56718347-56718369 GCGGCCCGAGGGAGGCGCGCGGG - Intergenic
1175448438 20:59042606-59042628 GCGGCCCGCAGGAGGCTTCTAGG - Intronic
1175873312 20:62218420-62218442 GACGCCCATGGGAGGCACCTGGG - Intronic
1176089583 20:63312959-63312981 GGGGCCCACGGGGGGCCCCTCGG - Intronic
1180559170 22:16601791-16601813 GCGGCCCGGGGGAGGGGCCGCGG + Intergenic
1180854843 22:19039251-19039273 GAGGCCCGGGGGAGCCACCCAGG - Intronic
1184679215 22:46061452-46061474 GCGGGCTGCGGGAGGCTCCAGGG - Intronic
1185302581 22:50090186-50090208 GTGGCTCGCGGGAGGCGGCTGGG + Intronic
1185385159 22:50528562-50528584 GGGGCACACAGGAGGCACCTTGG - Exonic
955753198 3:62203398-62203420 GCGGCCGTCGGGAGGCGCGTGGG - Exonic
961114044 3:124313649-124313671 ACTGCCCGCTGGAGTCACCTGGG + Intronic
961827221 3:129605494-129605516 GCGGGCCGCGGGGGACCCCTGGG + Exonic
968317560 3:197737052-197737074 GCGGCCTGCGGGAGCGGCCTGGG - Intronic
968775158 4:2536100-2536122 GCGGCTCCCGGGATGCACCAGGG - Intronic
969532366 4:7736991-7737013 GCGGCCAGCGGAAGGCTCCAGGG + Intronic
969912059 4:10456700-10456722 GCGGCGAGCGGGACGCGCCTGGG - Intronic
981172069 4:141636663-141636685 GCGCCCCCCGGGAGGGAACTGGG + Exonic
983254132 4:165379270-165379292 GCTGCCTGCGGGTGGCTCCTGGG + Exonic
985633911 5:1026827-1026849 AGGGCACTCGGGAGGCACCTGGG - Intronic
987258182 5:16179238-16179260 GCCGCCTCCGGGAGGCGCCTCGG + Exonic
1002898528 6:1392810-1392832 GCCGGCCGCGGGAGGCCGCTGGG - Intronic
1003868043 6:10381383-10381405 GCGACCCACGGTGGGCACCTGGG - Intergenic
1006372486 6:33653938-33653960 TCGGCCCTCAGGAGGCAGCTGGG - Intronic
1016439046 6:144064654-144064676 CCGGCCCGCGGTAGCCGCCTTGG + Intergenic
1020283709 7:6664301-6664323 GGGCCCCACGCGAGGCACCTCGG - Intergenic
1022094544 7:27130539-27130561 GCCGCCCGCGTGAGGGAGCTGGG + Exonic
1024255490 7:47537274-47537296 GCGGCGCGCGGCTGGGACCTGGG - Intronic
1024529143 7:50376328-50376350 GCAGGCCTCGGGATGCACCTGGG - Intronic
1027305944 7:76897576-76897598 GAGGGCCGGAGGAGGCACCTGGG - Intergenic
1034469775 7:151248964-151248986 GAGGCCCGCGGGAGGCGGCGCGG + Exonic
1038176324 8:25184646-25184668 GCGGCCGGCGGGAGGGACTGGGG + Intergenic
1039445713 8:37630336-37630358 CCGGCCGGCTGGAGGCAGCTTGG + Intergenic
1043873877 8:85463926-85463948 GCGGCCCGGGGGAGGGGGCTCGG - Exonic
1048484058 8:134831698-134831720 GCGGGCGGCGGGAGGCAGGTGGG - Intergenic
1050345266 9:4679795-4679817 TCGGCCCGAGGGAGGCTCCAGGG - Exonic
1053050504 9:34957880-34957902 GCGGCCCGGAGGGGGCGCCTTGG - Intronic
1053555530 9:39133061-39133083 GGTGCCCGCTGGGGGCACCTCGG + Exonic
1053819645 9:41953312-41953334 GGTGCCCGCTGGGGGCACCTCGG + Exonic
1057361192 9:94374906-94374928 GCAGGCCGCGGGGAGCACCTGGG + Exonic
1057662171 9:97013258-97013280 GCAGGCCGCGGGGAGCACCTGGG - Exonic
1058467646 9:105244934-105244956 GCGGCGCACGGGAGGCATCCGGG - Intronic
1060460727 9:123852053-123852075 GGGGCCAGCAGGAGGCACGTTGG - Intronic
1060763506 9:126275802-126275824 GCGCCCTGCGGGAAGCCCCTCGG + Intergenic
1060818560 9:126648733-126648755 GCTGCCCGTTGGAGGCACCAGGG + Intronic
1060985793 9:127818293-127818315 GGGGCCTGAGGGAGGCACCGTGG - Exonic
1061458165 9:130713583-130713605 GAGGCTCGCGGGAGCCACCTTGG - Intergenic
1062293927 9:135813655-135813677 GCGGCCCTTGGTGGGCACCTGGG + Intronic
1185894329 X:3844081-3844103 GCGCCCCTCGGGTGGCACCCAGG + Intergenic
1185899448 X:3882505-3882527 GCGCCCCTCGGGTGGCACCCAGG + Intergenic
1185904565 X:3920934-3920956 GCGCCCCTCGGGTGGCACCCAGG + Intergenic
1187900787 X:24025415-24025437 GCGGGCCGCGGGAGCCGCCCGGG + Intronic
1189473592 X:41333079-41333101 GCGCCCCGCGGGAGGAAACTAGG + Intergenic
1190234421 X:48604807-48604829 GAGGCCATCGGGAGGCGCCTGGG - Intronic
1194136306 X:90147900-90147922 GCGGCCCGCAGGTGGCAGATTGG + Intergenic
1200482063 Y:3717958-3717980 GCGGCCCGCAGGTGGCAGATTGG + Intergenic