ID: 915460634

View in Genome Browser
Species Human (GRCh38)
Location 1:156068594-156068616
Sequence CTGGGAAATCCTGAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915460634_915460637 -9 Left 915460634 1:156068594-156068616 CCCTCTTCCTCAGGATTTCCCAG 0: 1
1: 0
2: 4
3: 40
4: 364
Right 915460637 1:156068608-156068630 ATTTCCCAGCACTTCCCCTTTGG 0: 1
1: 0
2: 1
3: 22
4: 249
915460634_915460638 -8 Left 915460634 1:156068594-156068616 CCCTCTTCCTCAGGATTTCCCAG 0: 1
1: 0
2: 4
3: 40
4: 364
Right 915460638 1:156068609-156068631 TTTCCCAGCACTTCCCCTTTGGG 0: 1
1: 0
2: 2
3: 16
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915460634 Original CRISPR CTGGGAAATCCTGAGGAAGA GGG (reversed) Intronic
901459108 1:9381107-9381129 CTGGGATCTGCTGAGGAAGGTGG - Intergenic
901527255 1:9831380-9831402 GAGGGAAAGCCTGAGGCAGAAGG + Intergenic
902006692 1:13237894-13237916 CTGGCATATCCTGATGAACAGGG + Intergenic
903122281 1:21224139-21224161 CTGGGAAAAGCTGGGGAAAATGG - Intronic
903286099 1:22277712-22277734 CTGGGAAAGCATGGGCAAGACGG + Intergenic
903360531 1:22774191-22774213 CCAGGAAACCCAGAGGAAGAAGG - Intronic
904165187 1:28549943-28549965 CTTGGAAAGGCTGAGGCAGATGG + Intergenic
906911860 1:49961033-49961055 CTGTGCCATGCTGAGGAAGATGG + Intronic
907091628 1:51730153-51730175 CTGAGAACTCCCAAGGAAGAGGG - Intronic
907736268 1:57115696-57115718 TTGGGAAAGGCTCAGGAAGAAGG + Intronic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
908615940 1:65922755-65922777 CTGGGAAATAGTGAGTAAGGCGG + Intronic
909914684 1:81302600-81302622 CTTTGAAATCCTTAGGGAGATGG - Intergenic
910045120 1:82904125-82904147 CTTTGAAATGCTGAGGCAGAAGG + Intergenic
910126653 1:83849977-83849999 CTAGGAAAGCCAGAGGGAGATGG - Intergenic
910550186 1:88466707-88466729 CTGGGAAATCCTGAACAAATCGG - Intergenic
911047617 1:93641549-93641571 CTGGAAAATGCGGAGGCAGAGGG + Intronic
911145019 1:94542911-94542933 CTGGGAAAACGTGGGAAAGAAGG - Intergenic
911549810 1:99264804-99264826 CTGTGAAATCTAGGGGAAGAGGG - Intronic
911766069 1:101676499-101676521 CTCAGAAATCCTCAGAAAGAAGG - Intergenic
912228783 1:107767934-107767956 CTGGTAAATCATAAGGAAGTAGG + Intronic
912641562 1:111351193-111351215 CTGGGAAGACCAGAGGCAGAGGG + Intronic
913193644 1:116434161-116434183 CTGGAGAAGCCTGAGGGAGATGG + Intergenic
915460634 1:156068594-156068616 CTGGGAAATCCTGAGGAAGAGGG - Intronic
916059811 1:161090522-161090544 CTGGGATAGCCAGAGGAAGAGGG + Intergenic
916269231 1:162921948-162921970 CAGGAAAACCCTGAGGAAGTTGG + Intergenic
916653087 1:166849035-166849057 CTGTGATATCCCGAGGCAGACGG - Exonic
917616207 1:176747319-176747341 CTGGGGAAACCTGATGAAGTAGG + Intronic
917617744 1:176763801-176763823 CTGGGAAGTTCAAAGGAAGAGGG + Intronic
918455650 1:184710453-184710475 TTTAGAAATCCTGAAGAAGATGG - Exonic
919780676 1:201218753-201218775 CGGGGCAGTCCTGAGGGAGATGG + Intronic
920098004 1:203499096-203499118 CTGGGACATCCTGAAGATGCTGG - Intronic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
923079690 1:230641953-230641975 CTGGGAACTCATAGGGAAGAAGG - Intergenic
924308127 1:242712891-242712913 CCAGGAAATCCTGAGTCAGATGG - Intergenic
1062967820 10:1623732-1623754 CTGGGCATTCCTGAGGGTGAAGG - Intronic
1063243451 10:4194402-4194424 CTGAGTAATCCTGAGTAATAAGG - Intergenic
1064901816 10:20303419-20303441 CTGTGTGATCCTGAGAAAGATGG + Intergenic
1065361258 10:24891023-24891045 CTGAGAAATTCTCAGGAAGGTGG + Intronic
1066043881 10:31579725-31579747 CTGTGAACTCCAGAGGCAGAGGG + Intergenic
1066672705 10:37857413-37857435 CTGGGAGAGCCCGAGGGAGACGG - Exonic
1067220649 10:44341751-44341773 CTGAGGTACCCTGAGGAAGAGGG - Intergenic
1067976486 10:51031527-51031549 ATGGGAAAGAATGAGGAAGAAGG + Intronic
1068287884 10:54962858-54962880 ATGAGAAATACTCAGGAAGAAGG + Intronic
1068365229 10:56039818-56039840 CTGGGAAATACTCAGGAAATGGG - Intergenic
1069273869 10:66565558-66565580 TAGGGAAAACCTGAGGCAGAGGG + Intronic
1070508848 10:77141162-77141184 CTGGGCTATCCAGAGGAAGATGG + Intronic
1070605484 10:77895265-77895287 AAGGGAAATCCTGGGGAGGAAGG - Intronic
1070681345 10:78451489-78451511 ATGGGATATCCTGACCAAGAGGG - Intergenic
1072172263 10:92876710-92876732 CTGGGAACTGCAGAGGAAGAAGG - Intronic
1073067722 10:100773519-100773541 CTTGGAAACCCTGAGGCGGACGG + Intronic
1073231290 10:101972982-101973004 CTAGGAAATGGTGAAGAAGAAGG - Intronic
1073679112 10:105682911-105682933 CTGGTAAAGTGTGAGGAAGAAGG + Intergenic
1073726000 10:106231716-106231738 CTTTGAAATCTAGAGGAAGAAGG - Intergenic
1074206704 10:111289004-111289026 CTGGTAAATCCTGAGAGAGCTGG + Intergenic
1074475509 10:113770218-113770240 CTGGGAAATCTTTTGGCAGAGGG - Intronic
1074693797 10:116029850-116029872 CTGGGAAGCCCTGAGGAGCAGGG - Intergenic
1074952418 10:118351140-118351162 CTGGGAAAAGCACAGGAAGAAGG - Intergenic
1075055587 10:119215955-119215977 CTGGGAAGACATCAGGAAGAAGG + Intronic
1075549156 10:123379430-123379452 CTGGGGAATGCAGAGGGAGAGGG - Intergenic
1076516294 10:131046631-131046653 CTGGGGTCTCCTGGGGAAGAAGG + Intergenic
1077328916 11:1975457-1975479 CTGGGAAACCCTGAGCCAGAGGG + Intronic
1077598670 11:3557018-3557040 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
1080167741 11:29260488-29260510 ATTGGAATTCCTGAGAAAGAAGG - Intergenic
1080792040 11:35530071-35530093 CTGGGAAAGCCAGAGGAAACAGG + Intronic
1081192384 11:40119834-40119856 CTGGGAGAACCTGATAAAGAAGG - Intronic
1081596975 11:44466293-44466315 CTCAGAAACCCTGTGGAAGAAGG - Intergenic
1082869673 11:57932414-57932436 CTGGGAACCCCTGAGGAGCAGGG + Intergenic
1083341638 11:61962119-61962141 CTGGGGCATGGTGAGGAAGACGG + Intronic
1083407520 11:62468594-62468616 CTGAGAAATCAGGAGAAAGAGGG + Intronic
1084254745 11:67932890-67932912 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
1084540324 11:69782365-69782387 CTGGGAGACCCTGAGGAGGAGGG - Intergenic
1084818128 11:71662997-71663019 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
1085029262 11:73259713-73259735 CTGGGCAGTCCAGTGGAAGAGGG - Intergenic
1085265419 11:75235330-75235352 CTGGGCACAGCTGAGGAAGAGGG + Intergenic
1085283527 11:75345692-75345714 CTGGGAAGTCCTGAGGGACAGGG - Intronic
1085775232 11:79359632-79359654 CTGGGAAGTGCTGAGGTCGAAGG + Intronic
1086350014 11:85935519-85935541 CTGGCAGATCCTGAGGAAGGAGG + Intergenic
1088281900 11:108143516-108143538 CTGTTAAGTCCTTAGGAAGAAGG - Intronic
1088960424 11:114658440-114658462 CTGGGCACTCATGAGAAAGATGG + Intergenic
1089248224 11:117137852-117137874 CTGAAAATTCCTGAGGAAGATGG + Intergenic
1089258487 11:117206709-117206731 CTGAAAATTCCTGAGGAAGATGG - Exonic
1090126794 11:124094474-124094496 CTGGGAATCCCTGAGACAGAGGG - Intergenic
1090272397 11:125397368-125397390 CCAGGCAAGCCTGAGGAAGATGG - Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091178365 11:133581358-133581380 CTGGTTAATTCTGAGGATGATGG + Intergenic
1202811895 11_KI270721v1_random:30636-30658 CTGGGAAACCCTGAGCCAGAGGG + Intergenic
1091394595 12:146244-146266 ATGGGAATTCCTCAGGAATAAGG - Intronic
1091786524 12:3246360-3246382 CTGGGAAAAGGTGGGGAAGAGGG - Intronic
1091956538 12:4648725-4648747 CTGGTGAGTCCGGAGGAAGAAGG - Exonic
1092424810 12:8366365-8366387 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
1094535766 12:31321948-31321970 CTGGGAAATCCTGACTCATAGGG - Intronic
1095090481 12:38099686-38099708 CTGGGAAATGGTGAGTAAGGGGG + Intergenic
1095567586 12:43644481-43644503 CTGGGGAAACCTTGGGAAGAGGG - Intergenic
1095782265 12:46072908-46072930 ATGTGGAATCCAGAGGAAGATGG + Intergenic
1095912432 12:47442299-47442321 CATGAAAATGCTGAGGAAGAAGG + Intergenic
1096801740 12:54115018-54115040 CTGGGAAACCCTGAAAAAGAGGG + Intergenic
1098306028 12:69103518-69103540 CAGGGAACTTCTTAGGAAGATGG - Intergenic
1098747509 12:74258728-74258750 CTGAGAAATCATGGGGAAAAAGG - Intergenic
1099348786 12:81538515-81538537 ATTGGAAATGCTGAGGATGAGGG + Intronic
1100185698 12:92136629-92136651 CTGAGACATGCTGAGGAAAAGGG - Intronic
1100709681 12:97242409-97242431 CTAGGAAAGCATGAAGAAGAAGG - Intergenic
1102027096 12:109719807-109719829 CTGTGAGGCCCTGAGGAAGAGGG + Intronic
1104301814 12:127571275-127571297 CTGGTAACCCTTGAGGAAGACGG + Intergenic
1105457489 13:20554833-20554855 GTGGGAAAACCTGAGGACCAAGG - Intergenic
1105669322 13:22594400-22594422 CTGGGAACTGCTGAGGCTGAAGG - Intergenic
1106230328 13:27816526-27816548 CTGAGAACTCCTCAGTAAGATGG + Intergenic
1106501898 13:30336773-30336795 CGGGGAACTGCTGAGCAAGATGG - Intergenic
1107566384 13:41609701-41609723 CATGGAGATCCTGAGAAAGATGG - Intronic
1107877386 13:44802757-44802779 CTGGGAAAGCATGAGCAATATGG - Intergenic
1107990559 13:45815359-45815381 CTGAGGCCTCCTGAGGAAGAAGG + Intronic
1108224939 13:48279492-48279514 CTGGGAGTTCCTGAGCAACATGG + Intergenic
1109133897 13:58624039-58624061 CTGGGCCAACCTGAAGAAGATGG - Intergenic
1110623033 13:77620839-77620861 ATAGGAAATCCTTAAGAAGATGG - Intronic
1111942011 13:94619824-94619846 CTGGGAAGGCCTGAGGCAGGAGG - Intronic
1112968311 13:105226747-105226769 CTGATAAATACTGAGGAAGGGGG - Intergenic
1114079649 14:19192644-19192666 CTGGGAAATCCTGTGCCAGCAGG + Intergenic
1117539112 14:56729474-56729496 CTGGGAAATTCTAAGGTAGAAGG + Intronic
1117991821 14:61441278-61441300 TTGGGAAAACCCTAGGAAGAAGG + Intronic
1118422984 14:65628043-65628065 CTGGGAAAACCTTATGAAGATGG + Intronic
1118550122 14:66940704-66940726 CTGAGGAATCCAGAGGCAGACGG - Intronic
1118986048 14:70755685-70755707 ATGGGTAAGCCTGAGGAAGAAGG + Intronic
1120038873 14:79729699-79729721 CTGGGAGAAGCTGAGGAAGGAGG - Intronic
1120056240 14:79927448-79927470 CTGGGATGCCTTGAGGAAGAAGG - Intergenic
1120119990 14:80667431-80667453 GTGGGGAATCCAGAGTAAGAAGG + Intronic
1120345146 14:83278856-83278878 CTGTGAAGTACTGAGGAAGGGGG + Intergenic
1122180319 14:99949886-99949908 TTGGGAAATGCTGTGGGAGAAGG + Intergenic
1124479294 15:30063847-30063869 CTGAGGTTTCCTGAGGAAGAAGG + Intergenic
1124578475 15:30930273-30930295 CTGGGGAGCGCTGAGGAAGAGGG - Intronic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126535644 15:49760108-49760130 CAGGGAAATCATGAAGAAAATGG + Intergenic
1126864560 15:52922855-52922877 CTGGGAAAAGCCCAGGAAGATGG + Intergenic
1127568886 15:60221296-60221318 CTAAAAGATCCTGAGGAAGACGG + Intergenic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1129167636 15:73787757-73787779 CTGGGAAGTCCTGAGGGAAGAGG + Intergenic
1129191829 15:73941950-73941972 CTGGCACATCCTGGGGAACAAGG + Intronic
1130103529 15:80912119-80912141 CTGGGAAAGACTGGGAAAGATGG + Intronic
1130894573 15:88160170-88160192 CTGGGGAACCCAGAGGAAGGAGG + Intronic
1131484361 15:92808206-92808228 ATGGGAAATTCTGAGGACGGTGG - Intronic
1132321332 15:100927572-100927594 CTGGGAACCCCTGAGAATGAGGG + Intronic
1133373427 16:5263669-5263691 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
1134814931 16:17198129-17198151 CTGGGAACTCACGAGGCAGAAGG - Intronic
1135003981 16:18801869-18801891 CTGCGAAAGCCAGACGAAGAGGG - Intergenic
1135734412 16:24919275-24919297 CTGGGACATCTTGGGGGAGAGGG - Intergenic
1136293514 16:29289570-29289592 CTGGGACCTCCTGAGGAGGGTGG + Intergenic
1140426553 16:74866184-74866206 CCGGGGAAATCTGAGGAAGATGG - Intergenic
1141050007 16:80752885-80752907 GAGGGAATTCCTCAGGAAGAAGG + Intronic
1141447617 16:84072179-84072201 CTGTGAAAACCTGAGGCTGAGGG + Intronic
1142099394 16:88263576-88263598 CTGGGACCTCCTGAGGAGGGTGG + Intergenic
1203145851 16_KI270728v1_random:1797217-1797239 CTGGGAAGTTCTGGGGAAGTGGG + Intergenic
1143865792 17:9922263-9922285 CTTGGAAAAGATGAGGAAGAGGG + Intronic
1144038693 17:11389483-11389505 CTGGTGAATGCTGAGGAATATGG - Intronic
1144239506 17:13296289-13296311 CTTGGAAATATTGAAGAAGATGG + Intergenic
1144768152 17:17744178-17744200 CTGGGAATTAATGACGAAGAGGG - Intronic
1145138641 17:20433568-20433590 TTGAGAAATCCTGATCAAGAGGG - Intergenic
1146140817 17:30366546-30366568 CTGGGAAATCCTAAGTGGGAGGG - Intergenic
1146461286 17:33047890-33047912 CTTTGAACTCCTGAGGTAGATGG - Intronic
1146609011 17:34288315-34288337 CTGGGAAATACTGTTGAAAATGG - Exonic
1147129727 17:38399989-38400011 CTGGGAGTTCCTGAGGAAGGGGG + Exonic
1147570279 17:41566271-41566293 CTGGACAATCCTGAGGTAGAAGG + Intronic
1150634460 17:66903272-66903294 CTGGGAACTCGAGATGAAGATGG + Intergenic
1151531841 17:74711601-74711623 CTGGGCACGTCTGAGGAAGAGGG - Intronic
1151637522 17:75361418-75361440 CAGGGAAATCCTCAGAAAAATGG + Intronic
1152241912 17:79165410-79165432 CTGGGAAAGCCTGGGAAGGAGGG + Intronic
1152509253 17:80774142-80774164 CTGTGACATCCTGAGAAAGCGGG + Intronic
1153325092 18:3810512-3810534 CTGTGAATTACTGAGGAGGAAGG + Intronic
1153433408 18:5042726-5042748 TTGGGAATTCCTGAGGAATGGGG - Intergenic
1153538048 18:6124009-6124031 CTGGTAAATGGTGATGAAGATGG + Intronic
1156484261 18:37455005-37455027 CTGGGCATCCCTGAGGGAGAAGG - Intronic
1156495017 18:37519964-37519986 CTGGGAAAACGGGAGGGAGAAGG + Intronic
1156726947 18:40139999-40140021 CTAGGAATTCCTTAGGAAGCTGG - Intergenic
1157640453 18:49207605-49207627 CTGAGGTTTCCTGAGGAAGAAGG + Intronic
1158187000 18:54781648-54781670 CTGGGAACTCCTGCAGAAAAAGG - Intronic
1159691739 18:71496497-71496519 CTGGGAAATCCAGAGGCAAAAGG - Intergenic
1159878419 18:73834978-73835000 CTGGGAAACCCTGAATAACAAGG + Intergenic
1160715503 19:574712-574734 CTGGCAAAGCCTCTGGAAGAAGG - Intronic
1162105499 19:8367323-8367345 CTGGGAAATGCGGTGGAAGGGGG + Intronic
1162249564 19:9430811-9430833 CTGGGAAAGCCTGAGGGATAAGG + Intronic
1162458875 19:10802652-10802674 CTGAGAAGTCCTGAAGGAGAGGG - Intronic
1162649301 19:12073948-12073970 ATGGGAACTTCTTAGGAAGAGGG + Intronic
1162813890 19:13181588-13181610 CTGGGAAGGCCTGGGGAAGGGGG + Intergenic
1163141693 19:15353689-15353711 CTGGGAAATCATTAGAAAGGAGG - Exonic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1165458155 19:35926950-35926972 CTGGGAGTGCCTGAGGAACAGGG + Intergenic
1165576134 19:36820658-36820680 CTTGGAAAGGCTGAGGCAGATGG + Intronic
1165810854 19:38610917-38610939 CTGGGAAATTCTGAGGCACTAGG + Intronic
1166411987 19:42561618-42561640 CTGGGATCTCCTGGGGAGGATGG - Intergenic
1166718513 19:44984436-44984458 CAGGGAAGCCCTGTGGAAGAAGG + Intronic
926301635 2:11608969-11608991 CTGGGATGTACTCAGGAAGAGGG - Intronic
927871192 2:26625065-26625087 CTGGGACATACTGTGGTAGATGG + Intronic
928269353 2:29842422-29842444 CTGGTAAAGCCTGAGAATGATGG - Intronic
929305355 2:40355212-40355234 CTGGAAAATGCTGATGCAGAGGG + Intronic
930182100 2:48370482-48370504 CAGAGAAATCCTGAAGGAGAAGG - Intronic
930214429 2:48680070-48680092 CTGGGGAATTGTGAGGAAGTAGG + Intronic
930567417 2:53039241-53039263 CTGTGAAATCCTGAGTCATAGGG - Intergenic
931233132 2:60390968-60390990 CTGGGAAGTGCAGAGGAATATGG - Intergenic
931620568 2:64205774-64205796 CTGGGAGTTCCTGAGGAAAGGGG + Intergenic
931811559 2:65859274-65859296 GTGGGAAAGCCAGAAGAAGAAGG - Intergenic
933687671 2:85156329-85156351 GTGGTCATTCCTGAGGAAGAGGG - Intronic
934690823 2:96357573-96357595 CTGTGAACTCCAGAGGTAGAAGG - Intronic
935015533 2:99178620-99178642 CTGGGAAAGCCTCACAAAGAAGG + Intronic
935416704 2:102826782-102826804 CTGGGAAAACTTGAGGGAGCGGG + Intronic
935429506 2:102960054-102960076 CTGGGAAGTCCAGATCAAGATGG + Intergenic
935950801 2:108326543-108326565 CGGGGAAGCCCTGGGGAAGAAGG - Intergenic
937421903 2:121764167-121764189 CATTGAAAACCTGAGGAAGATGG + Intronic
938321827 2:130371224-130371246 CTGGGGAGTCCGGAGGAAGAGGG - Exonic
938404784 2:131025402-131025424 CTGGGAAACCCTCAGGGATATGG - Intronic
938677941 2:133657787-133657809 CTAGGAAAGGCTGAGGGAGAAGG + Intergenic
939990553 2:148874627-148874649 CTGGGAAAGTCTGAGGAAGGAGG + Intergenic
941658985 2:168175096-168175118 CTGTGGAATCCTCAGGAGGAAGG - Intronic
942776874 2:179592237-179592259 CTTGAACATCCAGAGGAAGAGGG - Intronic
942801733 2:179883530-179883552 CTGGGAAATCCTGTGTTAGAGGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945452094 2:210005394-210005416 CTGGGGAATACTGTGGAAGGTGG + Intronic
946100514 2:217316300-217316322 CTGGGAGATACTGAAGAAAATGG + Intronic
946740792 2:222799171-222799193 ATGGGAAATCCTGAAGTATATGG - Intergenic
946951412 2:224879306-224879328 CTGGGATGTTCTGACGAAGAAGG + Intronic
1168954802 20:1827454-1827476 CTGATAGATCCTGAGGAAGGCGG - Intergenic
1169464624 20:5826815-5826837 CTGTGAAAGCCTGGGGAAGAGGG + Intronic
1169671503 20:8107502-8107524 ATGGGAAATACTGGGGAAGGAGG - Intergenic
1169838707 20:9909923-9909945 CTGGGAATTCCTTTGCAAGATGG + Intergenic
1170304536 20:14923753-14923775 CTAGGAAACCCTGAGGCACAAGG - Intronic
1170838167 20:19902649-19902671 CTGGGTAATTCTAAGGAAGGTGG + Intronic
1170931982 20:20777059-20777081 CTGGCAGATCCTGGGGAAAAGGG + Intergenic
1171794962 20:29559448-29559470 CTGGGAAACCCTGAAAAAGAGGG - Intergenic
1171853487 20:30324817-30324839 CTGGGAAACCCTGAAAAAGAGGG + Intergenic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1174772156 20:53310501-53310523 TTGTGAAATCCTGATGCAGAGGG - Intronic
1174886247 20:54338591-54338613 CTGGATAATCCTGTAGAAGATGG - Intergenic
1175153805 20:56955665-56955687 CTGGAACATTCTGAGGAAGAGGG + Intergenic
1175648175 20:60693799-60693821 CTGGGACATCCTGGGGCAGGAGG + Intergenic
1176251473 20:64123252-64123274 CTGGGAAAGCCTGGAGAACACGG + Intergenic
1176251507 20:64123494-64123516 CTGGGAAAGCCTGGAGAACACGG + Intergenic
1176251521 20:64123598-64123620 CTGGGAAAGCCTGGAGAACACGG + Intergenic
1178472531 21:32906139-32906161 CTGAGGTTTCCTGAGGAAGAAGG + Intergenic
1178742813 21:35218659-35218681 CTGTGAAATTCTGTGCAAGATGG + Intronic
1179258224 21:39736233-39736255 CTGGGAATCCCTGAGGAAAGGGG - Intergenic
1180501120 22:15930056-15930078 CTGGGAAATCCTGTGCCAGCAGG - Intergenic
1181641307 22:24201100-24201122 CCAGGAAATCCTGAGGAAGAGGG - Intergenic
1181734427 22:24870584-24870606 ATGGGAAATGCTGAGGATGTGGG - Intronic
1181759688 22:25049571-25049593 CTGGAAACTCAAGAGGAAGAAGG - Intronic
1181889390 22:26048448-26048470 CTGGGGAATTCTGAGGAACGGGG + Intergenic
1181977090 22:26737827-26737849 CTGGGGAAGGCTGGGGAAGAGGG - Intergenic
1182519783 22:30878809-30878831 ATGGGAAAACCTGGGGAGGAAGG + Intronic
1183019387 22:35015008-35015030 CTGGGAAGTCCTGAGGTTGGAGG - Intergenic
1183677810 22:39309558-39309580 CTGGGAATTTCTGAGCAAGTGGG - Intergenic
1184223389 22:43114987-43115009 CTGCAAAATCCTGAGAATGAGGG - Intronic
1184256990 22:43292966-43292988 CTGGGGAAGCCTGGGGAGGAGGG + Intronic
1184340314 22:43882214-43882236 CGGGGACATCTTGAGCAAGAGGG - Intronic
1184584032 22:45435645-45435667 GAGGGAAATCCTTGGGAAGAAGG + Intergenic
1185026693 22:48418052-48418074 CTGGCAAATCGGGAGGGAGAGGG + Intergenic
1185221437 22:49630911-49630933 CTGGGGGCTCCAGAGGAAGAGGG - Intronic
950141682 3:10620298-10620320 CTGGGAACTCTGGAGGAAGACGG + Intronic
951254607 3:20433561-20433583 CTGGGGATTCCTGGGCAAGATGG - Intergenic
951482013 3:23171005-23171027 CTGAGAAAGGCTGAGAAAGAAGG + Intergenic
951743511 3:25950684-25950706 CATGGAAATCCAGAGGGAGAGGG + Intergenic
952789763 3:37190444-37190466 ATGTGTAATCCTGAGGAAAAAGG + Intergenic
953234953 3:41098007-41098029 CAGGGAAAATCTGAGCAAGAAGG - Intergenic
953680799 3:45036550-45036572 CCGGGATGTCCTGAGGAAGAAGG - Intergenic
954152228 3:48663264-48663286 GTGTGAAATCCTGGGGTAGAGGG + Intergenic
954243839 3:49315416-49315438 CTGGGAAATGCTGAGCACTAGGG + Intronic
954448021 3:50557092-50557114 CTGGGGGATCCTGAAGAAAAGGG - Intergenic
954643503 3:52116462-52116484 CTGAGGAATCCTGTGGCAGAAGG + Intronic
955026847 3:55175958-55175980 CTGGGAAATGCTTTGGAAAATGG - Intergenic
955756469 3:62229641-62229663 CTGAGAAATCCAAAGAAAGATGG - Intronic
956813874 3:72890153-72890175 TTGGGAAAGGCTGAGGCAGATGG - Intronic
957068827 3:75549473-75549495 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
958017714 3:87961145-87961167 TTGGGAAATCCTGGGTAAAAAGG - Intergenic
960035981 3:113103509-113103531 CTTGGCAGTCCTGAGGTAGAAGG + Intergenic
960105787 3:113795161-113795183 CTTGGAAATCCTGAAAGAGAAGG + Exonic
961130681 3:124464124-124464146 CTCAGATATCCTGAGGGAGATGG - Intronic
961284585 3:125790854-125790876 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
966093986 3:176175829-176175851 CTGGGAAATAGTGAGGAATGGGG - Intergenic
967069215 3:185947343-185947365 ATGGGGAAACTTGAGGAAGAAGG + Intergenic
967082760 3:186065429-186065451 ATGGGAAATGCTGAGGAAATAGG - Intronic
968691375 4:1992076-1992098 GTGGGAAATCCTGGGGATGAGGG + Intronic
968902210 4:3437060-3437082 CAGGGAAATGCTGGGCAAGAAGG + Intronic
968920507 4:3519945-3519967 TTGGGAAAGTCTCAGGAAGACGG - Intronic
968926292 4:3550136-3550158 CTGGGCACTCCTTGGGAAGAGGG + Intergenic
969013157 4:4084010-4084032 TTGGGAAAGGCAGAGGAAGAGGG - Intergenic
969561446 4:7950686-7950708 CTGGGCTGTCCTGAGGAGGATGG - Intergenic
969740688 4:9023782-9023804 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
969800030 4:9556618-9556640 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
970497392 4:16640497-16640519 CTGAGAAATAATGATGAAGAAGG - Intronic
971585526 4:28401308-28401330 CTGGAAAACCCTGGGGAAGACGG + Intronic
972160665 4:36222931-36222953 CAGGGAATTTATGAGGAAGAAGG - Intronic
972176904 4:36419563-36419585 CAGACAAATCCTTAGGAAGATGG + Intergenic
972646600 4:40973788-40973810 CAGGTGAATCCAGAGGAAGATGG - Intronic
974615289 4:64272043-64272065 TTGGGGAATCCTGATGAAGTTGG - Intergenic
975108327 4:70595022-70595044 CTGGCAAATAGTGGGGAAGAAGG + Intronic
975241396 4:72064246-72064268 CTGAGAGATCCTGAGCCAGAGGG - Intronic
977464845 4:97371185-97371207 ATGGGAAACCCTGAGGTAGCTGG + Intronic
977705508 4:100066301-100066323 CTGGGGAAGCCTCACGAAGATGG + Intergenic
977798392 4:101195896-101195918 CTGGTAAGTCCTGAGGAGGGAGG - Exonic
979206746 4:118046841-118046863 CTGGCAAATCCTGTGGAGGGAGG - Intronic
981290017 4:143063663-143063685 CTGGGCAATTCTTAGGAAGTTGG + Intergenic
983100095 4:163614927-163614949 AAGGGAAACCCTGAGGAAGGTGG + Intronic
983975218 4:173925688-173925710 TTGAGAACTCCTGACGAAGAGGG - Intergenic
984704871 4:182840301-182840323 CTGAGAAATCCTGATGCCGAGGG + Intergenic
985303457 4:188513770-188513792 CTGGGAACTCCTGCTGAAGAAGG - Intergenic
986058113 5:4159787-4159809 CTGCGAATCCCTGAGGAAGCAGG + Intergenic
987565472 5:19578817-19578839 TTGAGAATTCCTGAAGAAGAAGG + Intronic
990318450 5:54606785-54606807 CTGGGAAAATCTGAAAAAGATGG - Intergenic
990445483 5:55890114-55890136 ATGGGAATGACTGAGGAAGAAGG + Exonic
995030121 5:107471091-107471113 CTGGGAAAGCCTGATGAATTGGG - Intronic
995683944 5:114750605-114750627 CTAGGAAATCCTGAGGCAGAAGG - Intergenic
996354580 5:122581605-122581627 CTGGGAAAAAAAGAGGAAGAGGG + Intergenic
996782693 5:127205640-127205662 CGCGGAACTCCTCAGGAAGAAGG + Intergenic
997145011 5:131423064-131423086 CTGGGAAAACCTGGTGAAGAGGG + Intergenic
998789808 5:145753925-145753947 CTTGGAAAGACTGAGGAAGGTGG - Intronic
999121523 5:149213221-149213243 CTTGGAAATCCTGAGGACTCTGG - Intronic
1000462953 5:161545635-161545657 GTGGGAAAGACTGAGGAGGAGGG - Intronic
1000492823 5:161936158-161936180 ATGGGAAACTCTGAGGAAGGGGG - Intergenic
1000978596 5:167792343-167792365 CTGGGACAGCCTGAGGATGAAGG + Intronic
1002301107 5:178257623-178257645 CTGGGAAGTCCAGAGGAGGGAGG - Intronic
1004749222 6:18543705-18543727 CCAGCAAATCCTGGGGAAGAGGG + Intergenic
1005152259 6:22765665-22765687 CTGAGAACTCCTGAGGCAAAGGG - Intergenic
1005328083 6:24721202-24721224 CTGGGACTTCCTGAAGAAGGGGG - Intergenic
1005559674 6:27025765-27025787 CTGGAGTTTCCTGAGGAAGAGGG - Intergenic
1007267279 6:40606222-40606244 ATAGGAAGGCCTGAGGAAGATGG - Intergenic
1010593843 6:77741269-77741291 CTGGGCAAAACTGAGGAACATGG + Intronic
1011726717 6:90216939-90216961 TTGGGAAATCCTGACGGGGAGGG + Intronic
1012114454 6:95277945-95277967 CTGAGAAATTCTGAGGAATTTGG + Intergenic
1012982061 6:105841247-105841269 TTGAGAGCTCCTGAGGAAGAGGG + Intergenic
1015828871 6:137345816-137345838 CTGGGATATCCCGCAGAAGAAGG + Intergenic
1016525144 6:144993110-144993132 CTGCAAAATCCTGGGGAAAATGG - Intergenic
1017434321 6:154401627-154401649 CTTGGAGATTCTGTGGAAGATGG - Exonic
1018219373 6:161562982-161563004 CTGGAAAATACTGAGCAGGAAGG - Intronic
1019618700 7:1979082-1979104 CTCGGCAACCCTGAGAAAGAGGG + Intronic
1019786816 7:2982440-2982462 CTGGGAAATAGGGAGGAAGCCGG + Intronic
1020008983 7:4798403-4798425 CAGAGAAACCCTGGGGAAGAGGG - Intronic
1021596109 7:22318703-22318725 CTGGGAAGCATTGAGGAAGATGG - Intronic
1023980332 7:45065921-45065943 CTGGGACATCCTTAGGGACAAGG + Intronic
1024316157 7:48018691-48018713 CAGGCAAACCCTGGGGAAGAGGG + Intronic
1024840162 7:53576025-53576047 ATCGGTATTCCTGAGGAAGAAGG + Intergenic
1024926710 7:54623461-54623483 AAAGCAAATCCTGAGGAAGAGGG + Intergenic
1029071809 7:97905647-97905669 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
1029151953 7:98486578-98486600 CTGGGAGATGCTGAGGAACTGGG + Intergenic
1029979115 7:104861759-104861781 CTTGGAGAACCTGGGGAAGAGGG + Intronic
1030349875 7:108472269-108472291 CTGGAGAATCCTGAAAAAGACGG - Exonic
1030887291 7:114954023-114954045 CTGGGAAATCCTGACCTAGAAGG - Intronic
1030967810 7:116015755-116015777 ATGGGAAATAGTGAAGAAGATGG + Intronic
1031177095 7:118367418-118367440 TTGAGAAATTCAGAGGAAGATGG - Intergenic
1032657599 7:133948388-133948410 CAGGGAAATCCAAAAGAAGATGG + Intronic
1033533642 7:142291304-142291326 CTGGGTAATATTAAGGAAGAAGG - Intergenic
1034111304 7:148540384-148540406 CTGAGAACTGCTGAAGAAGAAGG - Intergenic
1034533402 7:151711964-151711986 CTGGGAAACCCAGAGGAGGGCGG - Intronic
1036185945 8:6622409-6622431 CTGGGGAATGCGGAGGAAGCAGG + Intronic
1036245889 8:7116350-7116372 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
1036254899 8:7198116-7198138 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
1036362588 8:8089391-8089413 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
1036458434 8:8930205-8930227 CTTGGAAATAGTGAGGAACATGG + Intergenic
1036895974 8:12635780-12635802 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
1037128103 8:15374233-15374255 CTGGGAAATGCTGAAGAAGAAGG - Intergenic
1037716412 8:21404973-21404995 TTGGGAAAAGCTGGGGAAGAAGG + Intergenic
1037819291 8:22128007-22128029 CTGAGAAATCCTGGGGGAGGAGG - Intronic
1037944191 8:22976193-22976215 CTGGGGACTCCTGGGGGAGAAGG + Intronic
1038207855 8:25485383-25485405 CAGGGAACTCCAGAGTAAGATGG - Intronic
1038408935 8:27343261-27343283 CTGAGAGATCCAGAAGAAGAAGG - Intronic
1038413174 8:27374112-27374134 GTGGTAAATCCTGAGGCTGAGGG + Intronic
1038714500 8:29979833-29979855 CTGGGGAAATCTGGGGAAGAAGG - Intergenic
1039870398 8:41540664-41540686 CTGTGAAACACTGAGGAACATGG - Intronic
1040731122 8:50448187-50448209 CTGTGAAATAGTGAGGAAAAGGG + Intronic
1041110089 8:54475662-54475684 CAGGAAAATACTGAGGAAAAAGG + Intergenic
1042163671 8:65923760-65923782 CTGAGAAATCCTGCTGTAGAGGG + Intergenic
1044190657 8:89313016-89313038 CTGGGAAATTGTTAGGCAGAAGG - Intergenic
1044491103 8:92815827-92815849 CTGGGAAACCCTGATGATTATGG - Intergenic
1044509584 8:93058911-93058933 CTGGGGATTCCTGGGCAAGATGG - Intergenic
1044803912 8:95984990-95985012 TTGGGCAAACCTCAGGAAGAAGG - Intergenic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1048829655 8:138463797-138463819 CTGAGCAATCCTGAGGAGAAGGG + Intronic
1050327848 9:4515073-4515095 ATGGGAAAACCAGAGCAAGAGGG - Intronic
1050347600 9:4707853-4707875 CAGGCAAATCCTGGGAAAGAAGG - Exonic
1052735772 9:32340884-32340906 CTGGGAAATTCTGGAAAAGAAGG + Intergenic
1053791294 9:41688115-41688137 CTGGGAAACCCTGAAAAAGAGGG + Intergenic
1053801220 9:41765542-41765564 CTGGGCACTCCTTGGGAAGAGGG + Intergenic
1054143981 9:61549295-61549317 CTGGGCACTCCTTGGGAAGAGGG - Intergenic
1054153861 9:61626657-61626679 CTGGGAAACCCTGAAAAAGAGGG - Intergenic
1054179642 9:61899809-61899831 CTGGGAAACCCTGAAAAAGAGGG + Intergenic
1054189649 9:61977692-61977714 CTGGGCACTCCTTGGGAAGAGGG + Intergenic
1054463756 9:65480651-65480673 CTGGGCACTCCTTGGGAAGAGGG - Intergenic
1054473647 9:65557777-65557799 CTGGGAAACCCTGAAAAAGAGGG - Intergenic
1054648866 9:67610917-67610939 CTGGGCACTCCTTGGGAAGAGGG - Intergenic
1054657896 9:67681012-67681034 CTGGGAAACCCTGAAAAAGAGGG - Intergenic
1056187242 9:84147459-84147481 CAAGGAAATGCTGAGGGAGAAGG - Intergenic
1056377031 9:86024776-86024798 TTGGGACATCCTGGTGAAGATGG + Intergenic
1056483026 9:87025198-87025220 GTGGCACATCCTAAGGAAGATGG - Intergenic
1056716173 9:89031866-89031888 CTGAGAAATGCTGAGAAACATGG - Intronic
1056765581 9:89442793-89442815 CTGGGAAATGGTGAGAAGGATGG - Intronic
1058371368 9:104271438-104271460 GTGGGCAGTCCTGAGGAAGTTGG + Intergenic
1058562125 9:106241453-106241475 TTGGAAAATCCAGAGAAAGAAGG - Intergenic
1058668720 9:107342870-107342892 GTGGCAAAGCCTGGGGAAGAAGG - Intergenic
1058740828 9:107940505-107940527 CCAGGACATCCTGAGGCAGAGGG - Intergenic
1059427734 9:114231590-114231612 CAGGCAAATCCAGAGGAAGAAGG - Intronic
1059764915 9:117374998-117375020 TAGGGAGATCCAGAGGAAGAAGG - Intronic
1060062603 9:120474524-120474546 CTGAGAAATCCTGAGTTACAGGG + Intronic
1060494516 9:124108304-124108326 GTGGGAAATTCTGAGCAAGCAGG + Intergenic
1060932219 9:127496293-127496315 CTGGGAAATCCTGGGGAGGTGGG + Intronic
1062355693 9:136160942-136160964 CTGACAAATCCAAAGGAAGATGG - Intergenic
1188242964 X:27811010-27811032 CTGGGATATCAAGTGGAAGAGGG + Intronic
1189529577 X:41865888-41865910 CTGGGAAACCTTGAGGGGGAGGG + Intronic
1189809533 X:44768427-44768449 CTTGGAGAGCCTGAGGCAGATGG + Intergenic
1189960846 X:46323604-46323626 CTGGAAAGGCCTGAGAAAGAAGG - Intergenic
1190989130 X:55527606-55527628 CTGGGAAAACCTCAGGCTGAAGG - Intergenic
1192986953 X:76409800-76409822 AAGGGAAGTCCTGGGGAAGATGG + Intergenic
1200914336 Y:8558050-8558072 CTGGGCCATCCTGAGGAATTAGG - Intergenic
1201374532 Y:13302637-13302659 CTTGGAGATGCTGAGGCAGATGG - Intronic
1202627921 Y:56879617-56879639 CTGGGAGATCCTTAGGAATGAGG + Intergenic