ID: 915460846

View in Genome Browser
Species Human (GRCh38)
Location 1:156069908-156069930
Sequence TGAGCTCCAGACTGAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915460846_915460854 5 Left 915460846 1:156069908-156069930 CCTCCCACTCAGTCTGGAGCTCA 0: 1
1: 0
2: 1
3: 12
4: 252
Right 915460854 1:156069936-156069958 GGAACAGGCCACACTCCCCATGG 0: 1
1: 0
2: 0
3: 27
4: 565
915460846_915460858 18 Left 915460846 1:156069908-156069930 CCTCCCACTCAGTCTGGAGCTCA 0: 1
1: 0
2: 1
3: 12
4: 252
Right 915460858 1:156069949-156069971 CTCCCCATGGGGCTGACTCTTGG 0: 1
1: 0
2: 0
3: 20
4: 231
915460846_915460855 6 Left 915460846 1:156069908-156069930 CCTCCCACTCAGTCTGGAGCTCA 0: 1
1: 0
2: 1
3: 12
4: 252
Right 915460855 1:156069937-156069959 GAACAGGCCACACTCCCCATGGG 0: 1
1: 0
2: 1
3: 19
4: 125
915460846_915460856 7 Left 915460846 1:156069908-156069930 CCTCCCACTCAGTCTGGAGCTCA 0: 1
1: 0
2: 1
3: 12
4: 252
Right 915460856 1:156069938-156069960 AACAGGCCACACTCCCCATGGGG 0: 1
1: 0
2: 0
3: 11
4: 121
915460846_915460853 -10 Left 915460846 1:156069908-156069930 CCTCCCACTCAGTCTGGAGCTCA 0: 1
1: 0
2: 1
3: 12
4: 252
Right 915460853 1:156069921-156069943 CTGGAGCTCAGGGAGGGAACAGG 0: 1
1: 0
2: 13
3: 62
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915460846 Original CRISPR TGAGCTCCAGACTGAGTGGG AGG (reversed) Intronic
900303413 1:1989432-1989454 TGAGGTCCAAAGGGAGTGGGTGG - Intronic
901091214 1:6642851-6642873 TGAGCTGGAGATTGAGGGGGTGG + Intronic
903867729 1:26411094-26411116 TGCGCGCCAGACTACGTGGGTGG + Intronic
904043469 1:27597289-27597311 TGAGATGCAGAATGAGTGTGAGG + Intronic
904131953 1:28281842-28281864 ACAGCTGCAGACTGAGAGGGTGG + Exonic
905319399 1:37105227-37105249 TGTGCTCAAGAGAGAGTGGGAGG + Intergenic
907952962 1:59201828-59201850 TGAGCTTTAGAAAGAGTGGGTGG + Intergenic
907990637 1:59579009-59579031 TGGGCTCAAGAGAGAGTGGGAGG - Intronic
908781260 1:67692592-67692614 TAAGCCCCAGTCTGAGTCGGTGG - Intergenic
910531177 1:88237198-88237220 TGTGGGCGAGACTGAGTGGGGGG - Intergenic
911748133 1:101463839-101463861 TGAACTCCAGCCTGAGTGACAGG + Intergenic
912320955 1:108712781-108712803 TCAGCTCCACACTGAAGGGGAGG + Exonic
915460846 1:156069908-156069930 TGAGCTCCAGACTGAGTGGGAGG - Intronic
915490272 1:156246753-156246775 TGACCTAGAGACAGAGTGGGAGG + Exonic
915506452 1:156359964-156359986 TGGGCTCAAGACAGAATGGGAGG - Intronic
915704574 1:157831869-157831891 TGAGCCCCAGAATGAGTATGAGG + Exonic
916470606 1:165118945-165118967 TGAGTTCCAGACTGAGCAGAGGG - Intergenic
918410969 1:184257489-184257511 TTAACGCCAGACTGAATGGGTGG - Intergenic
920584163 1:207141295-207141317 TCAGCTCAAGATTAAGTGGGTGG + Intronic
921247167 1:213256679-213256701 TGAGCCCCAATCTGAATGGGAGG - Intronic
922261418 1:223948710-223948732 GGAGCTCCATACTGAGTAGAAGG - Intergenic
922735656 1:227977033-227977055 GGAGCTCCATACTGAGTAGAAGG + Intergenic
923298405 1:232617282-232617304 TCATCTCCAGAATGAATGGGTGG + Intergenic
923461547 1:234213721-234213743 GGATCTCCAGACTGAGGCGGTGG + Intronic
924592274 1:245414862-245414884 TGAGCACCAGACAGACTTGGGGG - Intronic
924638407 1:245810270-245810292 TGAGCTGCAGAATGAGTTGTAGG - Intronic
1062966677 10:1612361-1612383 TGAGCTCCAGAGGGAGGGGCTGG + Intronic
1064348029 10:14550334-14550356 AGAGCTGCAGACTCAGTGGTAGG - Intronic
1065126386 10:22578297-22578319 TGAGCTGCAGAATGGATGGGGGG - Intronic
1065519272 10:26555633-26555655 TGTGCTCCAGACTGGGCTGGAGG - Intronic
1065888082 10:30096263-30096285 TGAGCTCCAGGCTGATTTGGTGG - Intronic
1066733893 10:38454665-38454687 GGAGCTCCATACTGAGTAGAAGG + Intergenic
1067539938 10:47143963-47143985 TGAGCTCCACCCTGAGCGGGTGG - Intergenic
1068921802 10:62492892-62492914 TGAGTTCCAGAGAGAATGGGAGG - Intronic
1070602912 10:77878138-77878160 TGCGCTCCATCCTGTGTGGGAGG - Intronic
1071886622 10:89958234-89958256 TGTGTTCCAGACTGACTGAGAGG - Intergenic
1072256684 10:93628153-93628175 TGAGCTCCAGAATGGGTGCTGGG - Intronic
1072492363 10:95920470-95920492 TGAGGGCGAGACCGAGTGGGAGG - Intronic
1073839455 10:107481915-107481937 TGAGGTCCAAAGGGAGTGGGTGG + Intergenic
1075655394 10:124157651-124157673 TGAGCTCCAGCCTGTGGGGCAGG + Intergenic
1076562896 10:131378472-131378494 TGAGCTCCAGCCTGAGTCCATGG - Intergenic
1076843891 10:133059765-133059787 TGAGACCCAGGCTGAGTGGGGGG - Intergenic
1077285154 11:1762294-1762316 GGAGCTCCAGACTGAGATCGGGG + Intronic
1078637016 11:13061361-13061383 TGTGCTCCAGACAGAGTGATGGG + Intergenic
1079135221 11:17772708-17772730 ACACCTCCAGACTGAGTGCGGGG - Intronic
1083676971 11:64331760-64331782 TGAGCTCCAAGTTGAGTGGTCGG + Intergenic
1083899055 11:65634961-65634983 AGGGCTCCAGGCTAAGTGGGAGG - Exonic
1089188675 11:116638243-116638265 TGTGCTCCAGAGTGCTTGGGTGG - Intergenic
1089985330 11:122807584-122807606 TGCGCTCCAGCCTGAGTGTCAGG - Intronic
1090608474 11:128449408-128449430 CAAGCTCCAGGCTCAGTGGGGGG + Intergenic
1090843478 11:130512795-130512817 TGAACTCCAGACTCAGCAGGGGG + Intergenic
1091130014 11:133138138-133138160 TTAGTTCCAGAAAGAGTGGGTGG + Intronic
1091489591 12:921574-921596 TGCCCTCCAGCCTGCGTGGGAGG + Intronic
1091713555 12:2760169-2760191 GGAGCTCCAGAAGGATTGGGAGG - Intergenic
1093642468 12:21543071-21543093 TGAGCTCCTGAGAGAGTGGAAGG - Intronic
1095930664 12:47622143-47622165 TCTGCTGCACACTGAGTGGGTGG + Intergenic
1095991492 12:48037598-48037620 TCAGCTACAGACTGAGGGGGAGG - Intergenic
1096158340 12:49355347-49355369 TGCACTCCAGCCTGAGTGGTAGG + Intronic
1097128409 12:56791379-56791401 TGCACTCCAGGCTGAGTGAGAGG + Intergenic
1097144977 12:56933852-56933874 TGATGTCCAGATTGGGTGGGAGG - Intronic
1098742574 12:74192919-74192941 AGAGTTCCACACTGCGTGGGGGG + Intergenic
1100141859 12:91628751-91628773 TTAGATCCAGACTCTGTGGGTGG + Intergenic
1100199084 12:92279277-92279299 TGAGCTCCAGCCGGACTTGGAGG + Intergenic
1103520342 12:121533712-121533734 TGAACACCAGACTGGGTGAGTGG + Intronic
1104523122 12:129494019-129494041 TGAGCTCCTGACTGGATGGTGGG - Intronic
1104698032 12:130879508-130879530 TGAGCGCCACAGTGAGTGTGAGG + Intergenic
1104803314 12:131569427-131569449 TGGGCACCACACTGAGAGGGCGG + Intergenic
1105304583 13:19159745-19159767 TGACCTCCAGACTGTAAGGGTGG - Intergenic
1106259503 13:28053156-28053178 TGTGATCCAGGGTGAGTGGGAGG - Intronic
1113352213 13:109540418-109540440 TGAGATCCACAGTAAGTGGGCGG + Intergenic
1113427105 13:110217383-110217405 TGAGCTCCAGTGGAAGTGGGGGG - Intronic
1114660619 14:24341371-24341393 GGAGCTCCATACTCAGTAGGAGG + Intergenic
1116707433 14:48319940-48319962 TAAGCTCCAGTCTGAGTATGAGG + Intergenic
1117189865 14:53278911-53278933 TGAGGTCCACAGGGAGTGGGTGG + Intergenic
1117253439 14:53956146-53956168 TGAGGTCCAGAGAGAGTGAGGGG - Intronic
1117342969 14:54807510-54807532 TGAGGTCCAAAGGGAGTGGGTGG + Intergenic
1119025163 14:71146670-71146692 TGGGGAGCAGACTGAGTGGGTGG + Intergenic
1119420157 14:74503505-74503527 TGAGGTCCAGGGTGAGCGGGGGG + Exonic
1120934640 14:89882702-89882724 TGAGCCACAGACTGAGAGGTGGG - Intronic
1122046968 14:99030636-99030658 TGTGCTCCTGTCTCAGTGGGTGG - Intergenic
1122298081 14:100716745-100716767 AGAGATCCACACTCAGTGGGGGG - Intergenic
1122519802 14:102335362-102335384 TCAGCTCCAGAGGGAGTGTGGGG - Intronic
1122860620 14:104580838-104580860 AGAGCTCCAGACAGACAGGGCGG - Intronic
1124099826 15:26682887-26682909 TGGGCTCCAGGCTGAGTGGCCGG - Intronic
1124186677 15:27536151-27536173 TAAGCTGCATACTGGGTGGGGGG + Exonic
1125828377 15:42694193-42694215 TGAGTTCCACGCTGAGTGAGAGG - Exonic
1127942314 15:63711277-63711299 TGAACTCCAGCCTGAGTGACAGG + Intronic
1128555550 15:68629352-68629374 TCAGCTCCAGGCTCAGTGAGTGG - Intronic
1128712679 15:69884025-69884047 TGAGCTGCAGATAGAGAGGGAGG - Intergenic
1128726712 15:69993205-69993227 TGCACTCCAGCCTGAGAGGGAGG + Intergenic
1129154472 15:73709312-73709334 TGGGCTCCAGGCTGGGTGGATGG + Intronic
1130091222 15:80822985-80823007 TGAGCTACTGACTGATTGTGTGG + Intronic
1130912081 15:88277646-88277668 TGTGCCCCAGACTGACTGGCAGG - Intergenic
1131264185 15:90906054-90906076 TGAGCCCCAGGCTGGGTGGACGG + Intronic
1131899614 15:97073250-97073272 TGAGCCCCAGACTGAGACAGGGG + Intergenic
1132469569 16:94459-94481 GGGCCTCCAGACTGAGTGAGTGG + Intronic
1132569742 16:638867-638889 GGAGCTCCAGACTTACTGGGAGG - Intronic
1132672023 16:1105967-1105989 TGAGCTCCAGACAGTGTGAACGG + Intergenic
1133107896 16:3525598-3525620 TGCCCTCCAGACAGAGTGGCAGG - Intronic
1134836551 16:17366222-17366244 ACAGCTCCAGACTGAGTAGCTGG + Intronic
1134839352 16:17389279-17389301 TGCACTCCAGCCTGAGTGGCAGG - Intronic
1136088089 16:27899876-27899898 ACAGAGCCAGACTGAGTGGGTGG + Intronic
1138644197 16:58411355-58411377 TGAACTCCAGCCTGAGTGAAGGG + Intergenic
1139324291 16:66139980-66140002 TGAGCTGCAGAAAGAGTGAGGGG - Intergenic
1140788218 16:78364045-78364067 TGAAAACAAGACTGAGTGGGGGG - Intronic
1143625064 17:8104982-8105004 TGAGCTCCAGACTCAGCCGTGGG + Intronic
1146008087 17:29174468-29174490 TGTGCTCCAGCCTGGGTGGAGGG + Intronic
1146278155 17:31528510-31528532 TGAGTTCCAGAAGGAGCGGGAGG + Exonic
1147420084 17:40318235-40318257 GGAGCCCCAGACTGAAGGGGCGG - Intronic
1147475115 17:40703529-40703551 GCAGCTGCAGCCTGAGTGGGGGG - Exonic
1148957436 17:51365372-51365394 TGAGGTCCAGAGGGAGCGGGTGG + Intergenic
1152646914 17:81473456-81473478 TGAGCTGCAGATTGGCTGGGGGG - Intergenic
1153915727 18:9742452-9742474 TCAGCGCCAGCCTGAGTGTGGGG + Intronic
1154172121 18:12060067-12060089 TAAGCTGCAAACTGAGTGGCTGG - Intergenic
1154360172 18:13654275-13654297 TCAGCTCCAGCCAGAGCGGGCGG - Intergenic
1155265507 18:24089012-24089034 TGACCCCCAGAATTAGTGGGAGG + Intronic
1156746251 18:40395042-40395064 TGAGCTAAATGCTGAGTGGGTGG + Intergenic
1157593828 18:48851792-48851814 GAAACTCCAGACAGAGTGGGTGG - Intronic
1157749861 18:50168579-50168601 TGTGCTCCAGACAGAGGGGAGGG + Intronic
1161918805 19:7250846-7250868 TGAGCTCCAGACTCAGAGCTAGG - Intronic
1162248143 19:9419995-9420017 TGGACTCCATACTGTGTGGGGGG + Exonic
1162906857 19:13829243-13829265 TGCACTCCAGCCTGAGTGGCAGG + Intronic
1163127739 19:15253407-15253429 TGAGCAGCAGCCTCAGTGGGAGG - Intronic
1164909316 19:31992807-31992829 TGGGGTCCAGACTGAGGGAGGGG - Intergenic
1166032896 19:40146433-40146455 TGAGCTCCAGCCTGGGTGACAGG - Intergenic
1166065716 19:40357507-40357529 TGAGATTCAGGCTGAGAGGGTGG - Intronic
1166696944 19:44857268-44857290 TGCACTCCAGACTGAGTGACAGG - Intronic
1167534747 19:50042435-50042457 GGAGCTGCAGACTGACTGGATGG - Intronic
1167975008 19:53218838-53218860 TGAGATACAGACTGAGTCTGTGG - Intergenic
925866713 2:8234545-8234567 TCAGCTCCACACTGAGAGGAAGG + Intergenic
926038944 2:9657346-9657368 TGATCCCCAGACTGAAAGGGGGG - Intergenic
926194216 2:10752347-10752369 TGGGCTCCGGTCTGAGTGGCTGG + Intronic
926996653 2:18742620-18742642 TGAGCGGCAGACTGATTGGCTGG + Intergenic
927202275 2:20585147-20585169 AGAGCTCTGGACAGAGTGGGAGG - Intronic
928172637 2:29013118-29013140 TGAGCTCCAAACCCTGTGGGTGG + Intronic
930107870 2:47654249-47654271 TGAGGTCCAGAAGGAGTGGGTGG + Intergenic
931726848 2:65119469-65119491 TGCACTCCAGCCTGGGTGGGAGG + Intronic
934657088 2:96122058-96122080 TGAGCCCCAGCCTGGGTGGTGGG - Intergenic
935187688 2:100748592-100748614 TGAGGTCCAGCCTGAGGGGCTGG - Intergenic
937013330 2:118581357-118581379 TGCTCTCCAGACTGGGTGGTAGG - Intergenic
937335862 2:121062106-121062128 TGACCTCCAGAAAGAGCGGGGGG - Intergenic
937428304 2:121817757-121817779 TGAGCAGCAGTCAGAGTGGGGGG + Intergenic
937826224 2:126371280-126371302 TGAGGTCCGGAGGGAGTGGGTGG + Intergenic
940649240 2:156425130-156425152 TGCACTCCAGACTGAGTGACGGG - Intergenic
941128986 2:161623530-161623552 TGAACTCCAGACTAAGTGTATGG - Intronic
942352005 2:175062766-175062788 TGAGGTCCAAAGGGAGTGGGTGG + Intergenic
942602598 2:177656943-177656965 TGAGCTTCAGAATGAATGAGGGG + Intronic
946143625 2:217712637-217712659 AGAGCTCCACACTGAGAGGCCGG - Intronic
946328695 2:218997840-218997862 TGGGCTCCAGACTGGGGGTGGGG - Intergenic
946959086 2:224964538-224964560 TGAACTCCAGACTGGGTGATGGG - Intronic
948375547 2:237518169-237518191 TGAGCCACTGATTGAGTGGGTGG + Intronic
948462854 2:238138737-238138759 CGAGGTCCAGGCTGAGTGAGAGG + Exonic
948836688 2:240629336-240629358 AGAGCTCAGGACTGGGTGGGTGG + Intronic
948889722 2:240901427-240901449 TGCACTCCAGCCTGAGTGAGAGG - Intergenic
949017046 2:241719375-241719397 TGACCTGCAGCCAGAGTGGGGGG - Intronic
1172264807 20:33601838-33601860 TGTGCTCCAGCCTGAGTGACAGG - Intronic
1173499980 20:43546091-43546113 TGAACTCCAGACAGAGTGGAAGG + Intronic
1173872470 20:46350613-46350635 TCATCTCCAGAGTGGGTGGGTGG - Intronic
1175127855 20:56765708-56765730 TGAGCTGCAGAAAGAATGGGAGG + Intergenic
1175856164 20:62122185-62122207 GGAGCACGAGACTGAGCGGGCGG - Intergenic
1176008619 20:62880212-62880234 TGACCTCCAAACTGAGAGGGAGG + Exonic
1176419218 21:6500401-6500423 TGAGCCCCAGACTGTGGGGCAGG + Intergenic
1178888424 21:36500244-36500266 CGAGCTCCCGGCTGAGAGGGCGG - Intronic
1179694711 21:43108723-43108745 TGAGCCCCAGACTGTGGGGCAGG + Intergenic
1179907819 21:44433400-44433422 TGAGCTCCAGAAGGAGAGGAAGG - Intronic
1180061029 21:45385193-45385215 GGGGCTCCAGAGTGGGTGGGAGG - Intergenic
1180099673 21:45578735-45578757 AGAGCTCCAGGCTGAGTGGGAGG - Intergenic
1180798286 22:18618614-18618636 TGAGCTGCAGACTGGGAGGCAGG + Intergenic
1181223432 22:21376651-21376673 TGAGCTGCAGACTGGGAGGCAGG - Intergenic
1181255308 22:21558971-21558993 TGAGCTGCAGACTGGGAGGCAGG + Intronic
1183115133 22:35685983-35686005 AGAGCTCCATCCTGAGGGGGCGG + Intergenic
1183276710 22:36902836-36902858 TGAGTTTCAGAGTGAGTGTGTGG + Intergenic
1183307830 22:37092358-37092380 TGCGCTCCAGCCTGAGTGACAGG - Intronic
1183519326 22:38287407-38287429 GGAGGTCCAAACGGAGTGGGAGG - Intergenic
1183541358 22:38431112-38431134 TGAGCTCCAGAGAAGGTGGGGGG + Intronic
1184837788 22:47034228-47034250 AGAGCTCCACACTGAGGGAGGGG - Intronic
1185124698 22:49002234-49002256 TGAGTATCAGACTGTGTGGGAGG - Intergenic
950263121 3:11556026-11556048 TCAGCGCCAGGCTGGGTGGGCGG - Exonic
950419350 3:12888315-12888337 TGAACTCCAGCCTGGGTGAGAGG + Intergenic
950905258 3:16531695-16531717 TGAGCTGCAGACTGATTGAAAGG - Intergenic
953515258 3:43584616-43584638 TGAGGTCCAAAGGGAGTGGGTGG - Intronic
953793934 3:45968424-45968446 TGAGCTCCAGAAGCAGTGGGAGG - Exonic
955775745 3:62431107-62431129 TCAGCTTCAGACTGATTTGGAGG + Intronic
956614572 3:71158050-71158072 TGCACTCCAGCCTGGGTGGGAGG + Intronic
957793604 3:84972173-84972195 TCAGCTGTAGACTGAGTGGTTGG + Intronic
960658952 3:120037571-120037593 TGAACTCCAGACTGGGTGACAGG + Intronic
966474124 3:180324563-180324585 TGAGATCCTGACTGAATAGGAGG + Intergenic
971171629 4:24239663-24239685 TGAGCTCCAGAGTAAGTAGTTGG + Intergenic
977871754 4:102098633-102098655 TGAGCGTCAAACTGAGGGGGAGG + Intergenic
983033977 4:162839350-162839372 TGAGATCCAAACTGATAGGGTGG - Intergenic
985989497 5:3543742-3543764 TGAACTCCAGACAGGGTGGATGG + Intergenic
987733091 5:21802625-21802647 TGAGCTCCAGCCTGGGAGAGAGG - Intronic
991450857 5:66749237-66749259 TGAGGTCCAGTCTGAGAGAGAGG + Intronic
991937325 5:71815115-71815137 TGCGCTCCAGTCTGGGTGGTGGG + Intergenic
992915062 5:81441351-81441373 TGAGAGGAAGACTGAGTGGGCGG - Intronic
994556584 5:101314842-101314864 TGAGGGCCAGGCTGAGAGGGTGG + Intergenic
994981173 5:106876232-106876254 TCAGTCTCAGACTGAGTGGGGGG + Intergenic
995180997 5:109230123-109230145 TGAGCTGGAGAATGAATGGGAGG + Intergenic
995778838 5:115754836-115754858 TGCACTCCAGCCTGAGTGAGAGG + Intergenic
999282709 5:150375589-150375611 GCAGCTCCACTCTGAGTGGGGGG - Intronic
1001689930 5:173625457-173625479 TGAGCTGGATAGTGAGTGGGTGG - Intergenic
1001905846 5:175472449-175472471 TGAGCTCCAGTGTGAGTGAGAGG + Intergenic
1001910212 5:175510466-175510488 TGAGCTCCAGGGTGAGAAGGAGG - Intronic
1002457116 5:179351495-179351517 TTTGCTCCAGACTGGGAGGGAGG - Intergenic
1003485894 6:6579496-6579518 TGAGGGCCAGACTGCCTGGGAGG + Intergenic
1006425378 6:33959965-33959987 GGAGCTCCAGGCTGAGGAGGAGG - Intergenic
1006430580 6:33993313-33993335 TGCGTTCCAGGCTGAGTGAGTGG + Intergenic
1006559852 6:34901544-34901566 TGTGCTCCAGCCTGAGTGACAGG - Intronic
1006871267 6:37254410-37254432 TGATCTCCTGACTAGGTGGGTGG + Intronic
1007359482 6:41344847-41344869 TGGGCTCCAGGCGGATTGGGCGG + Intronic
1008546144 6:52585380-52585402 TGAGCTCCAGCCTGAGCGACAGG + Intergenic
1008938710 6:57021422-57021444 TGAGCTCAGGACTGAGTGGAGGG - Intronic
1013802632 6:113965400-113965422 TGCACTCCAGCCTGGGTGGGTGG - Intronic
1015685520 6:135855092-135855114 TGAGGTCAAGAATGAGTGAGTGG - Intronic
1016971513 6:149768485-149768507 TGCGCTCCAGCCTGAGTGACAGG - Intronic
1018179429 6:161207856-161207878 TGAGCAGCAGGTTGAGTGGGTGG + Intronic
1018587935 6:165383883-165383905 TGAGGTCATGCCTGAGTGGGGGG + Intronic
1018657980 6:166058255-166058277 AGAGCTCAAGAGTGAGCGGGGGG - Intergenic
1018964329 6:168472894-168472916 TGAGCACCAAACAGTGTGGGAGG - Intronic
1019463212 7:1172451-1172473 TGAGCACCTGAGTGAGTAGGGGG - Intergenic
1019463285 7:1172686-1172708 TGACCACCTGAGTGAGTGGGAGG - Intergenic
1022412455 7:30149506-30149528 TGCGCCCCAGACTGAATGAGAGG + Intronic
1023401959 7:39797255-39797277 GGAGCTCCATACTGAGTAGAAGG + Intergenic
1024647661 7:51383407-51383429 GGAGCTCCATACTGAGTAGAAGG - Intergenic
1025063514 7:55832163-55832185 TGAACTCCAGCCTGAGTGACAGG + Intronic
1025176844 7:56806444-56806466 GGAGCTCCATACTGAGTAGAAGG - Intergenic
1025694948 7:63769942-63769964 GGAGCTCCATACTGAGTAGAAGG + Intergenic
1026796002 7:73366517-73366539 TGAGGTCCACACTGTGTGTGTGG - Intergenic
1029424157 7:100486210-100486232 TGAGCTTCTGTCTGAGTGGAGGG - Intronic
1031710066 7:125034387-125034409 AGAGCCCCAGGCTGAGTGGAAGG + Intergenic
1032052471 7:128657647-128657669 GGAGCTCCATACTGAGTAGAAGG + Intergenic
1033508583 7:142031012-142031034 TCAGCTGCAGAGTGTGTGGGAGG - Intronic
1034265952 7:149780721-149780743 TCAGCTCCACCCTGAGGGGGTGG - Intergenic
1035729643 8:1845101-1845123 TGAACTCCAGCCTGGGTGGTGGG + Intronic
1037809234 8:22076822-22076844 CGAGCCCCAGAATGTGTGGGAGG + Intronic
1037852816 8:22346536-22346558 TGAGCTTAAGACTGTCTGGGAGG - Intronic
1039246468 8:35613961-35613983 TGAGCTAAAGACTGTGTGTGGGG + Intronic
1039725110 8:40206964-40206986 TGAGCTCCTGTCTGTGTGGAAGG + Intergenic
1041445569 8:57948193-57948215 TCAGCTCCAGAGGGAGAGGGAGG + Intergenic
1043027340 8:75086347-75086369 TGAGCTACAGAATGAGTTTGAGG + Intergenic
1043593651 8:81859191-81859213 GGAGCACCATACTGCGTGGGTGG + Intergenic
1046198778 8:110894422-110894444 TGTGGTCCAGAGGGAGTGGGTGG + Intergenic
1051101621 9:13529018-13529040 TGAGCTCCAGCCTGGGTGACAGG - Intergenic
1053661513 9:40285548-40285570 TGAACTCCAGCCTGAGTGACAGG + Intronic
1053911888 9:42914891-42914913 TGAACTCCAGCCTGAGTGACAGG + Intergenic
1054373634 9:64431765-64431787 TGAACTCCAGCCTGAGTGACAGG + Intergenic
1054523096 9:66090736-66090758 TGAACTCCAGCCTGAGTGACAGG - Intergenic
1056990278 9:91404337-91404359 TGAACTCCAGCCTGAGTGACAGG - Intergenic
1057878349 9:98774490-98774512 TGCATTCCAGACTGAGTGAGGGG + Intronic
1059369154 9:113811303-113811325 TGTGCTCCAGCCTGTGTGGTAGG - Intergenic
1060488252 9:124063113-124063135 TGAGCCTGAGACTGAGTGTGAGG - Intergenic
1061187758 9:129064816-129064838 TGCACTCCAGACTGGGTGGCGGG - Intronic
1061551738 9:131338846-131338868 TGAGGTCCAAAGTGAGGGGGTGG - Intergenic
1062021903 9:134323681-134323703 AAAGCTCCAAACTGAGGGGGAGG + Intronic
1062291053 9:135794548-135794570 TGAGCTCCAGGCGGAGCAGGGGG - Intergenic
1062619296 9:137412159-137412181 TGAGACCCAGAGCGAGTGGGCGG + Intronic
1187603428 X:20858476-20858498 TGAGCTCCAGAACTAGAGGGTGG + Intergenic
1188671045 X:32882201-32882223 TGAGCTCAGGTCTGAGTAGGGGG - Intronic
1192082101 X:68058317-68058339 GGAGCTCAAAACTGAGTTGGGGG + Intronic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1196089750 X:111726909-111726931 TGTGCTGCAGCCTGGGTGGGAGG - Exonic
1198016663 X:132618502-132618524 TGATCTCCACACTTCGTGGGTGG - Intergenic
1198772480 X:140145536-140145558 TGAGGTCCAGAGGGAGTTGGTGG - Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic
1202381727 Y:24280024-24280046 GGAGCTCCATACTGAGTAGAAGG + Intergenic
1202489058 Y:25390102-25390124 GGAGCTCCATACTGAGTAGAAGG - Intergenic