ID: 915461827

View in Genome Browser
Species Human (GRCh38)
Location 1:156075137-156075159
Sequence AAGCAGGACTGGGGGGAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 1, 2: 4, 3: 54, 4: 652}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915461827_915461840 9 Left 915461827 1:156075137-156075159 CCCACCTCCCCCCAGTCCTGCTT 0: 1
1: 1
2: 4
3: 54
4: 652
Right 915461840 1:156075169-156075191 CTGACCCCTCTTTGAAGACCTGG 0: 1
1: 0
2: 0
3: 10
4: 123
915461827_915461845 30 Left 915461827 1:156075137-156075159 CCCACCTCCCCCCAGTCCTGCTT 0: 1
1: 1
2: 4
3: 54
4: 652
Right 915461845 1:156075190-156075212 GGCTTCTCCTCAACCACATCAGG 0: 1
1: 0
2: 1
3: 16
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915461827 Original CRISPR AAGCAGGACTGGGGGGAGGT GGG (reversed) Exonic
900652531 1:3736943-3736965 AAGGAGGGCTGGGCGGTGGTGGG + Intergenic
901136554 1:7000461-7000483 AGGCAGGACAGGAGCGAGGTGGG + Intronic
901199866 1:7460606-7460628 AGGCAGAACTGGGGGCAGGCTGG - Intronic
901842712 1:11964092-11964114 AACCAGGGATGGGGGGAGGTAGG - Intronic
901884103 1:12210740-12210762 AAGTAGGGGTGGGGGGAAGTGGG - Intergenic
902292657 1:15445517-15445539 AAGCAGGACTGGGTTGGGGTGGG - Intronic
902515117 1:16985994-16986016 CAGCAGCACTGAGGGGAGCTGGG + Exonic
902550481 1:17216252-17216274 AAGCTGGACTGTGGGGAGAGAGG + Intronic
902670255 1:17968199-17968221 AGTCATGACTGGGGTGAGGTGGG + Intergenic
903189740 1:21650018-21650040 AGGCAGGACTGGGGGCAGTGGGG + Intronic
903320362 1:22539314-22539336 TTGCAGGACTGGGGGGAAGCTGG - Intergenic
903323565 1:22556525-22556547 AAGGAGGAGTGAGGGGTGGTGGG + Intergenic
903396176 1:23003417-23003439 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
903678397 1:25081085-25081107 AGGCAGGCCTGGGGAGAGTTGGG - Intergenic
903761900 1:25704205-25704227 CAGCAGGACTGGGGGCAGGAAGG - Intronic
903930041 1:26856780-26856802 TAGCAGGCCTGGGAGGAGGGAGG - Exonic
903978310 1:27166697-27166719 AAGCAGGTTTGGGGAGGGGTTGG - Intronic
903996486 1:27308073-27308095 AAGCAGGACAGGGGGCAGGGAGG - Exonic
904706492 1:32394735-32394757 AAGCTGGACTGCGGAGAGCTGGG + Intergenic
904991819 1:34599168-34599190 AGGCAGGAGTGGTGGGAGGCAGG - Intergenic
905023669 1:34835734-34835756 TCCCAGGACTGGAGGGAGGTTGG - Intronic
905108548 1:35577961-35577983 AAGCAGGACTGGTGGGGAGACGG + Intronic
905175664 1:36134034-36134056 AAGGGGGAGTGGGGGGAGGGAGG - Intergenic
905884922 1:41486557-41486579 AAGCAGGGCTGGGGGCTGCTTGG + Intergenic
905953792 1:41975213-41975235 AAGCAGGATTGGGTAGAGGGGGG - Intronic
906240390 1:44239028-44239050 AAGCTGGATTGGGGGGGGGAGGG - Intronic
906253641 1:44330956-44330978 AAGCAGGGCAGGATGGAGGTAGG + Intronic
906264567 1:44418252-44418274 AAGGAGGGATGGGAGGAGGTTGG + Intronic
906324973 1:44839824-44839846 CTGCAGGGCTGGGGGTAGGTAGG + Intronic
906444303 1:45881496-45881518 ATTTAGGACTGGTGGGAGGTGGG + Intronic
906744675 1:48213464-48213486 AAGGAGGACTGGAGGGTGGAAGG + Intergenic
906941226 1:50257139-50257161 TTGCAGCACTGGGGAGAGGTGGG + Intergenic
907193201 1:52665702-52665724 AAGAAGGATGGGAGGGAGGTGGG - Intronic
907477286 1:54714265-54714287 AAGCATTGATGGGGGGAGGTTGG - Intronic
907947717 1:59151055-59151077 AAGCTAGAATGGGAGGAGGTTGG + Intergenic
908341347 1:63182829-63182851 ATGAAGGACTGGGGAGATGTGGG + Intergenic
909535458 1:76730934-76730956 TTGCAGAGCTGGGGGGAGGTAGG + Intergenic
909602471 1:77474685-77474707 AAGTAAGATTGGGGGAAGGTGGG - Intronic
910021983 1:82602686-82602708 AAGCAGGATTGGGCAGAGGGAGG + Intergenic
910050927 1:82973366-82973388 TAGCAGGACTAGGTGGAGTTTGG + Intergenic
910228743 1:84964517-84964539 GGGCAGGAGTGGGGGGGGGTGGG + Intronic
912247440 1:107974799-107974821 GAGCAGGAATGGGGAGATGTTGG + Intergenic
912385849 1:109270853-109270875 AAGTAGGGCTGCGGGCAGGTGGG - Intronic
913098436 1:115541197-115541219 AAGCGGGAGTGGGGGGATGGAGG + Intergenic
913446652 1:118957368-118957390 GACCAGGACTGGAGTGAGGTGGG + Intronic
914434252 1:147646304-147646326 AAGCAGGTCTGGGAGGAGGGGGG + Exonic
915113148 1:153577641-153577663 GTGGAGGACTGGGGGGAGTTGGG - Intergenic
915202319 1:154240939-154240961 AAGCAGGAATGGGGGTGGGGGGG - Intronic
915461827 1:156075137-156075159 AAGCAGGACTGGGGGGAGGTGGG - Exonic
915519505 1:156433318-156433340 AGGCAATACTGGGGAGAGGTAGG + Intergenic
915940980 1:160117945-160117967 AGGGAGGAGTGGAGGGAGGTTGG + Intronic
916108411 1:161447067-161447089 AAGGAGGGATGGGTGGAGGTAGG + Intergenic
916109998 1:161454447-161454469 AAGGAGGGATGGGTGGAGGTAGG + Intergenic
916111584 1:161461858-161461880 AAGGAGGGATGGGTGGAGGTAGG + Intergenic
916113170 1:161469238-161469260 AAGGAGGGATGGGTGGAGGTAGG + Intergenic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916704894 1:167339177-167339199 AAGCAGGGTTGAGGGGAGGAGGG - Intronic
917737603 1:177934817-177934839 AAGGAGGAATGGAGGGAGGGAGG + Intronic
917737890 1:177937137-177937159 AAGCAGGAAAGGGAGGTGGTGGG - Intronic
918239035 1:182605667-182605689 AAGCAGGTCTGGGCAGAGGGAGG + Intergenic
920091311 1:203455183-203455205 AAGCAGGGGTGTGGTGAGGTGGG - Intergenic
920305392 1:205015192-205015214 AGGAAGGACTGGGGGTGGGTGGG + Intronic
920314272 1:205066363-205066385 AAGCCTGGCTGGGAGGAGGTTGG + Intronic
920512180 1:206559496-206559518 AAGGAGAACTGGGGGGAAGAAGG - Intronic
921285061 1:213602201-213602223 AAGAAGGAATGGAGGGAGGGAGG - Intergenic
922593330 1:226795463-226795485 AAGCAGGGCTGTGGGAAGGTCGG - Intergenic
923200331 1:231704799-231704821 AAGTAGGACTGGGGTGGGGTGGG + Intronic
923219821 1:231882940-231882962 AAGAAGGAATGGGTGGGGGTTGG + Intronic
1062833825 10:623543-623565 ATGCAGGGCTGAGGGGAGGAGGG + Intronic
1062833836 10:623571-623593 ATGCAGGGCTGAGGGGAGGAGGG + Intronic
1062896381 10:1106335-1106357 GAGCAGCACTGGTGGGAGGTAGG - Intronic
1063187266 10:3662853-3662875 TAGCAGGACTGTGGGGTGGGTGG - Intergenic
1064280051 10:13943283-13943305 ACCCAGGCCTGGTGGGAGGTTGG + Intronic
1064280268 10:13945084-13945106 ACCCAGGCCTGGTGGGAGGTTGG + Intronic
1065177617 10:23095208-23095230 GAGCAGGAGTGGGAGGAGCTGGG + Intergenic
1065488360 10:26255896-26255918 AAGGAGGACTGGGGAGGGATGGG + Intronic
1065765635 10:29026941-29026963 AAGAAGGAAGGGAGGGAGGTAGG + Intergenic
1066538959 10:36423216-36423238 ATGCAGGAGTGGAAGGAGGTAGG - Intergenic
1068154508 10:53180649-53180671 AAGCAGGAGAGGGGGAAAGTGGG - Intergenic
1068853646 10:61773948-61773970 AAGCAGAACTTGGAGGTGGTTGG + Intergenic
1069917641 10:71797263-71797285 AATCAGGGCAGGGGGCAGGTGGG + Intronic
1070508435 10:77137986-77138008 AACCAGGACTGGGTTAAGGTAGG - Intronic
1070667655 10:78356743-78356765 AGGCTGGATTGCGGGGAGGTTGG - Intergenic
1070703339 10:78619068-78619090 AAGCAGGACTGGGGAGGGAGGGG - Intergenic
1070751259 10:78965310-78965332 CAGCAGCACTGGGGGCAGGGCGG + Intergenic
1071800758 10:89057086-89057108 AAGGAGGAGTGAGGGGAGGCAGG + Intergenic
1072569412 10:96645558-96645580 AAGCAGGTCTGTGGAAAGGTGGG + Exonic
1072633978 10:97165607-97165629 AAGCAGGGCTGAGGGAAGGCAGG + Intronic
1074137535 10:110641100-110641122 AAGCAAGACTGCAGGTAGGTTGG - Intergenic
1074221827 10:111445559-111445581 AAGCAGGAGTGTTGGGATGTAGG + Intergenic
1074364415 10:112846336-112846358 AAGCTGGACAGGCGGGAGATTGG + Intergenic
1074422519 10:113322026-113322048 AAGCAGAACCTGGGGGAGGGGGG + Intergenic
1075388566 10:122075608-122075630 AGGCAGGAATGTGGGGAGCTGGG + Intronic
1075415108 10:122256881-122256903 AGACAGGACTCGGGGGAGGGGGG + Intergenic
1075421972 10:122308603-122308625 AAGCAGGGAAGGAGGGAGGTTGG - Intronic
1075571213 10:123547589-123547611 AAGCAGGAGTGGTTGGGGGTGGG + Intergenic
1075744475 10:124717103-124717125 AAGCAGGACTTAGGGGATGGGGG + Intronic
1076364645 10:129914191-129914213 GTGCAGGGCTGGAGGGAGGTGGG - Intronic
1076367833 10:129933802-129933824 GGGCAGTACTGGGAGGAGGTAGG - Intronic
1076520202 10:131076505-131076527 GAGCAGGCTTGGGTGGAGGTTGG + Intergenic
1076818274 10:132925300-132925322 CAGCAGGGCTTGTGGGAGGTGGG - Intronic
1077145541 11:1042667-1042689 GAGCAGGACTGGGTGGGGGGTGG + Intergenic
1077269786 11:1670404-1670426 AAACAGAACTGGGGGTAGGGGGG + Intergenic
1077830271 11:5860748-5860770 GTGGGGGACTGGGGGGAGGTGGG - Intronic
1078148043 11:8735585-8735607 AAGCTGGCCTGTGGGGAAGTGGG - Intronic
1078970304 11:16402675-16402697 AAACAGGAGTGGGTGGAGGAAGG - Intronic
1079389633 11:20010264-20010286 AAGAAGGACTGGGGGGAAAATGG + Intronic
1080037225 11:27722248-27722270 AATGGGGACTGGGGGGAGGGGGG + Intergenic
1081218912 11:40436538-40436560 AAGCAGGACAGGAGAGAGGCTGG - Intronic
1081743063 11:45454339-45454361 TATCAGGACTGGGGTGAGGTGGG + Intergenic
1083184497 11:61009255-61009277 AAGCAGGAGATGGGGGAGGTGGG + Intronic
1083296483 11:61718149-61718171 AGGCAGGCCTGGGGGCAGGCTGG + Intronic
1083406846 11:62463482-62463504 AAGCAAGACGGGAGGGAGGCTGG - Intronic
1084275679 11:68049890-68049912 GAGCAGGCCTGGCGGGTGGTGGG + Intronic
1084616675 11:70240975-70240997 GGGCAGGCCTGGGGGGTGGTGGG - Intergenic
1085015262 11:73169806-73169828 AAGCAGGGCTGTGGGCAGGGAGG + Intergenic
1085205234 11:74727737-74727759 AAGCAGGATTGGATGGAGGGAGG + Intronic
1086238853 11:84664632-84664654 AAGCAGGACAGATGGGAAGTAGG + Intronic
1086549771 11:88042360-88042382 AAGCTGGAGTGGGAGGAGCTGGG + Intergenic
1088094122 11:106077929-106077951 AAGCAGATCTTGGGGGAGGCGGG + Intronic
1088168558 11:106967773-106967795 AAGCAGGAAGGGAGGGAGGGAGG + Intronic
1088651664 11:111962697-111962719 AAGCAGGAATGTGTGGAGGGTGG + Intronic
1088791920 11:113233684-113233706 AAGCAGGACTGGCCGGGTGTCGG - Intronic
1089257757 11:117202976-117202998 AAGCAGGCCAGGGTGGAGGAGGG - Exonic
1089353069 11:117832271-117832293 AGGCAGGGCTGGAAGGAGGTGGG + Intronic
1089599403 11:119604310-119604332 AGGCAGGAGTGGAGGCAGGTGGG + Intergenic
1089637382 11:119824071-119824093 AGCCAGGACTGAGGTGAGGTAGG - Intergenic
1090123043 11:124053387-124053409 AAACAGGGCTGGGTGGACGTAGG + Intergenic
1090132472 11:124159142-124159164 AAGCAGGATGGCGGTGAGGTGGG - Intergenic
1090259486 11:125308369-125308391 GAGCAGGACTGAGCAGAGGTGGG - Intronic
1090660877 11:128880743-128880765 AGGCAGGACTGGGGTGTGGGTGG - Intergenic
1090670464 11:128941878-128941900 AAGCAGATCTGGGTGGAGGAGGG + Intronic
1090762508 11:129849684-129849706 AAGCAGGACCAGGTGCAGGTTGG - Intronic
1091086187 11:132724165-132724187 AAGAAGGGGTGGTGGGAGGTGGG - Intronic
1091387425 12:103746-103768 AGGCAGGGCTGGGGGGAGGTGGG + Intronic
1091446009 12:544458-544480 AGGCAGGTGTGGAGGGAGGTGGG - Intronic
1094362901 12:29649465-29649487 AAACAGGACTGCGGACAGGTGGG + Intronic
1096381876 12:51165592-51165614 AGGCTGGAGTGGGGGGAGATGGG + Intronic
1096576779 12:52557821-52557843 AAGCGGGACTGGGGGGATTGGGG - Intergenic
1097161389 12:57048775-57048797 AAGAAGCACTGGGGGTAGATGGG - Intronic
1097263939 12:57735516-57735538 AGGCAGGGTTGGGGGGGGGTTGG - Intronic
1097623804 12:61975285-61975307 AAGAAGGAATGGGGAGATGTAGG - Intronic
1099303607 12:80927862-80927884 AGCCAGGCCTGTGGGGAGGTGGG - Intronic
1100237146 12:92672419-92672441 GAGCAGGACAAGGGGGAGGAGGG + Intergenic
1100293208 12:93236593-93236615 AAGCAGGGTGGGGTGGAGGTAGG - Intergenic
1102046477 12:109833079-109833101 TAGCAGGTCTGGGGGGAGGGCGG - Intronic
1102054780 12:109888201-109888223 AAACAGGGCGGGGGAGAGGTGGG + Intergenic
1102059510 12:109922191-109922213 AAGGAGGACCGGGAGGAGATGGG + Intronic
1102059764 12:109923597-109923619 AAAGAGGACTGGGAGGAGATGGG + Intronic
1102419279 12:112791304-112791326 ATGCAGGACTGGGGGCGTGTGGG + Intronic
1102547301 12:113666101-113666123 ACTCAGGACTGGGGAGGGGTGGG + Intergenic
1102571048 12:113827311-113827333 GGGCAGGACTGGGGGGTTGTCGG - Intronic
1102737836 12:115179058-115179080 AAGAAGGACAGGGAGGAGGAGGG + Intergenic
1104101665 12:125618305-125618327 AAGTAGGGCTGGGTGGAGGAAGG + Intronic
1104301711 12:127570496-127570518 AAGAAGGAGTGAAGGGAGGTAGG + Intergenic
1104705844 12:130946805-130946827 AAGAAGGACTGGGGGCAGGCAGG - Intergenic
1105291672 13:19057380-19057402 GAGCAGGGCTGGGTGGAGCTGGG + Intergenic
1105795435 13:23847639-23847661 GAGTAGGACTGGGGGAAGTTCGG + Intronic
1106097446 13:26660520-26660542 AAACAGGACTGGCGTGGGGTTGG + Intronic
1106289090 13:28344084-28344106 AGGCAGGAATGGGGGGAGTGGGG - Intronic
1106912630 13:34479163-34479185 AGGCAGGTGTGGGGGGAGGGAGG + Intergenic
1108039519 13:46326465-46326487 AAGCAGGAATCCGGGGAGGAGGG - Intergenic
1108068976 13:46607941-46607963 AAGCAGAACTGAGGGCAGGGAGG + Intronic
1108607248 13:52052093-52052115 AAGCAGGGCGGGGGTGGGGTCGG - Intronic
1109854906 13:68114241-68114263 AAGCAAGGCTGGGGCCAGGTTGG + Intergenic
1112498099 13:99921198-99921220 AAACAAGATTGGGGGGAGGGGGG - Intergenic
1112504461 13:99968056-99968078 AAACGGGACTGGGGGCACGTGGG + Intronic
1112889468 13:104212513-104212535 AAGGAGGAATGGGGGGTGGAAGG + Intergenic
1113069523 13:106406927-106406949 GAGCAGGACAGGAGGGAGGGAGG - Intergenic
1113377593 13:109780091-109780113 AACCTGGACTGGGTGGAGCTGGG - Intronic
1113587106 13:111473012-111473034 AAGCAGGGCTGGGGACAGGCAGG + Intergenic
1114316067 14:21511123-21511145 AAGCAGGACTCGGGGCACTTGGG - Exonic
1114536676 14:23427333-23427355 AAGCATCAGTGTGGGGAGGTAGG + Intronic
1114618768 14:24082432-24082454 AAGCTGGCCTGAGGGGAGGCAGG - Intronic
1115252881 14:31368059-31368081 ATGCAGTACTGCTGGGAGGTAGG + Intronic
1115645822 14:35367955-35367977 ATGCAGGGCTGGGAGGAGGCGGG - Intergenic
1115782947 14:36790794-36790816 AAGCAGGAATTTGGGAAGGTTGG + Intronic
1115951454 14:38727012-38727034 AGGCAGGAGTGGAGGCAGGTGGG - Intergenic
1116547777 14:46191853-46191875 TGGCAGGCCTGGGGGCAGGTGGG + Intergenic
1117294979 14:54370913-54370935 GAGGAGGACGGGGGGGAGGAGGG - Intergenic
1118039066 14:61898238-61898260 AGGTAGGAGTGGGGGGAGGTGGG - Intergenic
1118171973 14:63396296-63396318 AAGAAGCAGTGGGGGGAGGAGGG + Intronic
1118876764 14:69792644-69792666 AAGCAGGACTGCTGGGTCGTGGG - Intronic
1118920971 14:70149740-70149762 AAGAAGGGCTGGGAGGAGGATGG - Intronic
1118992338 14:70808706-70808728 ACGGAGGCCTGGGGGGCGGTCGG - Intronic
1119383765 14:74244611-74244633 AAGCTGGTCTGGGTGGAGCTGGG + Intronic
1119420042 14:74503059-74503081 AAGTAGGGCAGGGGAGAGGTGGG - Intronic
1119545703 14:75469914-75469936 GGGCAGGGCTGGGGGCAGGTGGG - Exonic
1120584219 14:86291136-86291158 AAGAAGGAAGGGGGGGAGGGAGG - Intergenic
1121328535 14:93035583-93035605 AAACAGGACGGGAGGGAGGGAGG + Intronic
1121912359 14:97802971-97802993 AGGGAGGCCTGGGGGGAGGGTGG + Intergenic
1121957635 14:98228561-98228583 AAGCTTGAGTGGGGAGAGGTGGG - Intergenic
1122141786 14:99667089-99667111 CAGCTGGACTGGGGGCAGGGAGG - Intronic
1122232811 14:100315374-100315396 AAGCAGTGCTGTGGGGAGGTCGG + Intergenic
1122262249 14:100530331-100530353 CAGCAGGCCTGGGAGGAGGGAGG - Intergenic
1122385422 14:101342046-101342068 AAGCAGGGCTGGGGGATGGTGGG - Intergenic
1122409072 14:101516943-101516965 AGGCAGGACTGGGCTGCGGTTGG - Intergenic
1122623573 14:103073171-103073193 AAGCAAGAGTGGAGGGAGGGAGG + Intergenic
1122640523 14:103156598-103156620 AAGCAGAACTGGGGCCAGCTGGG + Intergenic
1122679304 14:103445355-103445377 AAGCAGGACAGGGAGGAAGCAGG - Intronic
1122900733 14:104781370-104781392 CAGCAGGACTGGGTGGTGGGTGG - Intronic
1122956285 14:105073047-105073069 AGGCAGGCCTGGGTGGAGCTGGG + Intergenic
1123091968 14:105745938-105745960 CAGCATGGCTGGTGGGAGGTGGG - Intergenic
1123097487 14:105773385-105773407 AAGCAGGGCTGGTGGGAAGCAGG - Intergenic
1123097541 14:105773617-105773639 GAGCATGGCTGGTGGGAGGTGGG - Intergenic
1124938427 15:34194607-34194629 GAGCAGGACCGTGTGGAGGTGGG + Intronic
1125213366 15:37240666-37240688 AAGGAGGAATGGAGGGAGGGTGG + Intergenic
1125493045 15:40162721-40162743 GAGCAGGTCTGGGAGGAAGTGGG + Intronic
1125585022 15:40813838-40813860 AAGCAAGGCTGGGGGGAGCCTGG - Intronic
1125814819 15:42575485-42575507 AAGGAGGATTGAGGGGAGGCGGG + Intergenic
1126102395 15:45127657-45127679 AAGCAGGACTGTGGGGTGTGGGG - Intronic
1126379501 15:48031375-48031397 AAGAAGGAGTGAGGGGAAGTGGG + Intergenic
1127730101 15:61792466-61792488 AAGAAGGACTGGGGAGACGTTGG - Intergenic
1127762286 15:62151109-62151131 AGGCAGAAATGGGTGGAGGTGGG - Intergenic
1128393200 15:67197172-67197194 AAGCGGGACTGTGTGGAGGTGGG - Intergenic
1128793220 15:70448236-70448258 AAGGAGGGCTTGGCGGAGGTGGG + Intergenic
1129311826 15:74718196-74718218 AAGCTGGTCTGGGGTGGGGTAGG + Intergenic
1129479063 15:75808545-75808567 GGGCAGGACTGAGGGGTGGTGGG + Intergenic
1129607987 15:77034129-77034151 AGGCAGGACTGGGAAGAGGCGGG + Intronic
1130704162 15:86216826-86216848 GAGCAGGACTGAGATGAGGTAGG - Intronic
1131224409 15:90612013-90612035 GAGGAGGAGTGGGGGGTGGTTGG - Intronic
1132556685 16:575713-575735 CAGCAGGACAGGGGGCAGGTGGG - Intronic
1132700108 16:1218688-1218710 AAGCAGGACAGGGAGGAAGATGG + Intronic
1132782962 16:1638591-1638613 AAGCAGGGCTGAGGGGCGCTGGG - Intronic
1133023142 16:2975649-2975671 GAGCAGGCCTGGGAGGAGGGCGG - Exonic
1133038569 16:3047558-3047580 AGGCAGGGCTGGGGAGGGGTGGG - Intronic
1133739741 16:8642011-8642033 AAACAGGGCTGGGGGTAGCTCGG - Intronic
1133814160 16:9183802-9183824 CAGCAGGATTGGGGGGGGGGGGG - Intergenic
1133839264 16:9394041-9394063 AAGCAGGAAGGGAGGGAGGGAGG - Intergenic
1133839435 16:9394556-9394578 AAGCAGGAAGGGAGGGAGGGTGG - Intergenic
1133839447 16:9394588-9394610 AAGCAGGAAGGGAGGGAGGGTGG - Intergenic
1133839504 16:9394771-9394793 AAGCAGGAAGGGAGGGAGGAAGG - Intergenic
1134108197 16:11499050-11499072 AAGGAGGAAGGGGGGGAGGGGGG + Intronic
1134137164 16:11684994-11685016 AAGCATAACTGGGGGGAGTGAGG + Intronic
1134411157 16:14004063-14004085 ATGGAGGACTGGTGGGAGGCAGG + Intergenic
1134690322 16:16187022-16187044 CATCAGTACTGGGGGGAGATGGG - Intronic
1135974037 16:27095514-27095536 AACCAGGACTAGAGTGAGGTAGG - Intergenic
1136381242 16:29896918-29896940 AGGCAGGGCTGGGTGGGGGTGGG + Exonic
1136530744 16:30867195-30867217 AAACATGATTGGGGGAAGGTGGG + Intronic
1138219912 16:55241745-55241767 AAGCAGGATGGGGAGGTGGTGGG + Intergenic
1138265992 16:55660079-55660101 AGGAAGGGCTGGGAGGAGGTGGG + Intronic
1139306450 16:65990373-65990395 ATGCAGGACCGGGGGAAGCTGGG - Intergenic
1139392112 16:66611658-66611680 AACCAGCACTGGGGTGGGGTTGG + Intronic
1139599021 16:67975612-67975634 TAGCGGGATTGGGGGCAGGTGGG - Intergenic
1139653118 16:68372459-68372481 AAGCAGGAGTGGGATGAGCTGGG - Intronic
1140207498 16:72945784-72945806 AGGCAGGACGGGAGGGAGGAAGG + Intronic
1140571722 16:76114896-76114918 TGCCAGGACTGTGGGGAGGTGGG - Intergenic
1140880663 16:79195276-79195298 AAGCAGGATGGGGTGGAGGGAGG + Intronic
1141886729 16:86897382-86897404 AACCAGGCCTGGGTGGGGGTTGG + Intergenic
1142325815 16:89413865-89413887 AGGCCAGACTGGGGGGAGGCAGG + Intronic
1142680094 17:1542433-1542455 AAGCAGGAAGGGAGGGAGGGAGG - Intronic
1142703497 17:1679138-1679160 AAGCTGGACTGGGTGGAGGTTGG - Exonic
1142709390 17:1715291-1715313 AACCAGGGCCGGAGGGAGGTGGG + Intergenic
1142864044 17:2779687-2779709 AAGGAGGAGTGGAGGGAGGGTGG + Intronic
1143047713 17:4095495-4095517 AAGCAGGAATGGGAGAAGGGGGG + Intronic
1143251652 17:5527462-5527484 GGGCAGGACTGGGGAGGGGTAGG + Intronic
1143447943 17:7019830-7019852 GAGCAGGGCTGGCGGGAGGCAGG - Intergenic
1143573474 17:7776009-7776031 AGCCAGGACTGGGGGGAGGTGGG - Exonic
1143627238 17:8117651-8117673 AGGCAGGACTGTGGAGAGGAAGG - Intronic
1143912763 17:10265560-10265582 AAGCAGAATTGGGGGGAGGAGGG - Intergenic
1144007523 17:11114668-11114690 AGGGAGGACTAGGGGGAGCTTGG + Intergenic
1144410901 17:15000911-15000933 AAGCAGTAGTGAGAGGAGGTGGG + Intergenic
1144672408 17:17140386-17140408 ATGCAGAACTGGTGGGGGGTGGG - Intronic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1145747064 17:27328246-27328268 CAGCAGGGCAGGGGGCAGGTGGG + Intergenic
1146577907 17:34011304-34011326 AAGCAAGGCTGGGGGCAGGTAGG - Intronic
1146633995 17:34490857-34490879 AGGGAGGACTGGGAGGAGATTGG - Intergenic
1146642847 17:34554095-34554117 GTTCAGGACTGGGGGGAGCTGGG + Intergenic
1147371440 17:39995585-39995607 AGGCAGGAGTGGGAGGAGTTTGG + Intronic
1147857324 17:43491828-43491850 AAGCTGGAGTGGGGGTAGGGAGG + Intronic
1147915507 17:43883045-43883067 AGGAGGGACTGGGGGGTGGTGGG + Exonic
1148664987 17:49367792-49367814 AAGTAGGGCTGGTGGGAGGTGGG - Intergenic
1149439565 17:56663278-56663300 AAGTAAGACTTGGGGAAGGTGGG + Intergenic
1149498966 17:57136764-57136786 GAGCAGGATTTGGGGGAGGCTGG + Intergenic
1149575074 17:57706080-57706102 CAGCAGGGCTGTGGGGAGCTGGG - Intergenic
1150124883 17:62629181-62629203 AGGCAGGAGTGCGAGGAGGTAGG - Intronic
1150201305 17:63360778-63360800 AGTCAGGACTGGGGAGGGGTTGG - Intronic
1150560028 17:66286484-66286506 AAGGAGGAATGGGGAGAGGAGGG + Intergenic
1150575755 17:66429706-66429728 AGGCAGGATTGGGGGCAGGGAGG - Intronic
1150790001 17:68196060-68196082 AAGAGGGACTGGGGGATGGTGGG + Intergenic
1151169735 17:72236584-72236606 AGGCAGGACGGGAGGGAGGGAGG + Intergenic
1151401352 17:73857942-73857964 AAGCAGGGGTGTGGGGAGGGTGG + Intergenic
1152122048 17:78424841-78424863 TAGCAGGACAGGGGTGATGTGGG + Intronic
1152132692 17:78486585-78486607 CAGCAGAATTGGGTGGAGGTAGG - Intronic
1152266277 17:79296837-79296859 AAGCAGGAGGAGGGGGAGGAGGG - Intronic
1152328363 17:79655905-79655927 AAGCAGGACTAGGGGCTGGATGG - Intergenic
1152340383 17:79720995-79721017 AGGGAGGCCTGGGGGGAGGGAGG + Intergenic
1152892730 17:82891721-82891743 CAGCAGGGATGGGGGGTGGTTGG + Intronic
1153284783 18:3448066-3448088 AAGCGGGCGGGGGGGGAGGTAGG + Intronic
1153470032 18:5433819-5433841 AATCAGTACTGGGAAGAGGTGGG + Intronic
1153486213 18:5601326-5601348 TAGCAGCATTGGAGGGAGGTAGG - Intronic
1153648402 18:7216227-7216249 TAGGAGGAATGGGGAGAGGTTGG - Intergenic
1153752568 18:8248283-8248305 AAGCACGACATGTGGGAGGTGGG + Intronic
1154162668 18:11991559-11991581 AAACAGGACCGGCAGGAGGTGGG + Intronic
1154996564 18:21646176-21646198 AATCAGGAGTGGGGAGAGGAGGG - Intergenic
1156367912 18:36446728-36446750 AGGGAGCACTGGGGGCAGGTGGG - Intronic
1156472796 18:37388046-37388068 AGGCAGGAGTTGGGGGAGGGGGG + Intronic
1156696572 18:39774850-39774872 AGGCAGAGCTGGGGGGAGGAGGG - Intergenic
1157040789 18:44036616-44036638 AAGCAGGATGGGGGGGGGGGGGG - Intergenic
1157304339 18:46506146-46506168 AAGAAGGCCAGGGGTGAGGTTGG + Intronic
1157335507 18:46734394-46734416 GAGCAGGGGTGGGGGGAGGTGGG - Intronic
1157822820 18:50786313-50786335 TTCCAGGACTGGGGGGAGGGTGG - Intergenic
1157906551 18:51574520-51574542 AAGCAGGAATGGAGGGTGGAAGG + Intergenic
1158358622 18:56647953-56647975 AAGCAGGATTGGGCCGAGGAAGG + Intronic
1158412943 18:57223639-57223661 TAGTAGGACTGGGGGAAGGAAGG + Intergenic
1159682167 18:71368322-71368344 AGGGAGGACTGGGGAGAAGTAGG + Intergenic
1159957101 18:74526402-74526424 AGGGAGGACTTGGGAGAGGTGGG - Intergenic
1160347885 18:78149847-78149869 AAGGAGGACTGAGGAGAGGGAGG + Intergenic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1161059660 19:2208533-2208555 CAGCAGCACTGCGTGGAGGTGGG - Intronic
1161198740 19:3002457-3002479 AACCAGGACTGGCTGGCGGTCGG - Exonic
1161731620 19:5964317-5964339 GAGGATGACTGGGTGGAGGTGGG - Intronic
1161845254 19:6708500-6708522 AAGGAGGAATGGAGGGAGGAAGG - Intronic
1161924232 19:7289293-7289315 AAGCTGGACAGGGTGGAGGCTGG + Intronic
1162338970 19:10080020-10080042 AAGAAGGAATGGAGGGAGGGAGG + Intergenic
1162418450 19:10552338-10552360 AAGCTGGAGTGGGGTGAGGGGGG + Intronic
1162589442 19:11581260-11581282 AAGCAGGATTGGCAGGAGGAAGG - Intronic
1162590715 19:11589420-11589442 AAGGAGGACAGGGGTTAGGTGGG - Intronic
1162868252 19:13565569-13565591 GGCCAGGACTGGGGTGAGGTAGG - Intronic
1163023413 19:14495857-14495879 AAGCGGGGGTGGGGGGTGGTGGG - Intronic
1163538471 19:17892308-17892330 AAGCAGGAAGGGAGGGAGGGAGG + Intronic
1163716393 19:18874811-18874833 AAGCAGCAATGGGGTGAGATGGG + Intronic
1163899380 19:20088256-20088278 AAGCGGGATTGGGGGGGCGTGGG + Intronic
1164412925 19:28020715-28020737 AAGCAGGAGCGGGAGGAGGAGGG + Intergenic
1164656539 19:29925979-29926001 TACCAGGACTGGGGGGAGGAAGG + Intronic
1164772034 19:30816611-30816633 AAGAAGAAATGGAGGGAGGTAGG - Intergenic
1164888781 19:31805346-31805368 AGGCGGGAATGGGGGGAGGAGGG + Intergenic
1165119295 19:33548788-33548810 CAGCAGGGATGGGGGCAGGTAGG + Intergenic
1165250275 19:34527024-34527046 AAGAAAGAGTTGGGGGAGGTGGG - Intergenic
1165384809 19:35504051-35504073 AAGCAGGGCAGGGCAGAGGTGGG - Intronic
1165437436 19:35803941-35803963 AAACAGGTCTGGGGGGCGATAGG - Intronic
1165771073 19:38380649-38380671 GAGCAGGCTTGGGGGGAGGGAGG + Intronic
1166096521 19:40542647-40542669 AAGCAGAACAGGGGGGAGGAGGG - Intronic
1166105241 19:40594919-40594941 GAGCAGGAGTGGGGGGTGGGGGG + Intronic
1166546496 19:43637230-43637252 CAGCAGGAATCGGGGGAGATGGG - Intronic
1166758355 19:45208949-45208971 AAGGAGGACTGGGGAGACGGTGG + Intronic
1166760923 19:45224161-45224183 AGCCAGGAGTGGGGGGAGGGTGG + Intronic
1166851072 19:45761609-45761631 AAGCAGTACTGGGGGGATGAAGG + Intronic
1167466914 19:49654873-49654895 GAGCTGGCCTGGGGAGAGGTGGG + Intronic
1167624752 19:50580170-50580192 AAGCTGGAGTGGGGAGAGGTGGG - Intergenic
1167720743 19:51178702-51178724 AATCAGGACTGGGTGGTGCTGGG - Intergenic
1168265793 19:55223457-55223479 AAGCAGGGCTGTGGGAAGGAGGG - Intergenic
1168576736 19:57518056-57518078 AAACAGAAAAGGGGGGAGGTTGG + Intronic
925128224 2:1476842-1476864 GAGCAGGCCAGGGGGGAGGTGGG + Intronic
925280395 2:2680334-2680356 CAGCAGGAGTGGGGGAAGGAGGG + Intergenic
926027277 2:9556006-9556028 AGGCCGGACTGGGTGGAGTTGGG - Intergenic
926220840 2:10934633-10934655 AAGCAGGGCGGGGTGGAGGGAGG - Intergenic
926628706 2:15117794-15117816 AAGCAGGAGTGGGAGGAGGTTGG - Intergenic
926630861 2:15135218-15135240 AAGGTGGCCTGGGGGGAGGCTGG + Intergenic
927518005 2:23683126-23683148 AAGCAGGGCTGGGGCCAGGAAGG + Intronic
927683434 2:25154963-25154985 ATGCAGGGCTGGCAGGAGGTGGG + Exonic
928498592 2:31862924-31862946 AAATGGGATTGGGGGGAGGTGGG + Intergenic
928647254 2:33367794-33367816 AATCAGGACTGGGGCAAGATGGG + Intronic
928681607 2:33708468-33708490 AAGCAGGACTGGGCAGAGAGAGG + Intergenic
928695837 2:33849130-33849152 AAGCAGCACTGTGGGAAGCTGGG + Intergenic
928857588 2:35818231-35818253 GAGCAGGATTGGGGGGCCGTGGG - Intergenic
928921898 2:36535162-36535184 AAGGAGGACAGGAGGGAGGGAGG + Intronic
929281830 2:40088141-40088163 AAGCAACACTGGGCGGAGCTCGG - Intergenic
929455819 2:42064288-42064310 AGGCTGGACTGGGGGGTGGCAGG + Intergenic
929564383 2:42975450-42975472 AAGCAGGACTGGAGGGCTGGAGG - Intergenic
930236221 2:48891233-48891255 AAGCAGGAAGGGAGGGAGGGAGG - Intergenic
930713132 2:54568008-54568030 TAGGAGGTCTGTGGGGAGGTCGG - Intronic
931178101 2:59873581-59873603 AAGCAGGACTCTGAGGAGGGAGG + Intergenic
931208514 2:60170387-60170409 AAGCAGGGCAGGGGGATGGTAGG - Intergenic
931506822 2:62937713-62937735 ATCCAAGACTGGGTGGAGGTGGG + Intronic
931713907 2:65013112-65013134 AAGAAAGACAGGGGGAAGGTGGG + Intronic
931902766 2:66807569-66807591 AAGGAGGAGAGGGAGGAGGTGGG + Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932423584 2:71615287-71615309 CAGCAGCACTGGTGGGAGCTGGG + Intronic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933578367 2:84096081-84096103 AAGGAGGAAAGGGGGGAGGGAGG + Intergenic
933779845 2:85794053-85794075 TATCAGGGCTGGGGGGAGGCAGG - Intergenic
934060331 2:88286409-88286431 AAGGAGGACTGGGGGTCGGAAGG - Intergenic
934617730 2:95785292-95785314 AAGCAGGTATGGTGGGAAGTTGG + Intergenic
934643163 2:96039267-96039289 AAGCAGGTATGGTGGGAAGTTGG - Intronic
935015465 2:99177829-99177851 TAGGAGGAATGGGGAGAGGTTGG - Intronic
935139525 2:100340393-100340415 GAGCAGTAGTGGGGGAAGGTGGG - Intergenic
935634300 2:105238016-105238038 AGGCAGGAATGGAGGGAGGGAGG + Intergenic
936233643 2:110725220-110725242 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
936929571 2:117773762-117773784 CAGCAGGTCTGGGGTGAGGCTGG - Intergenic
937083172 2:119154794-119154816 CAGCAGGAGTGGGGTGGGGTGGG + Intergenic
937378074 2:121351527-121351549 AAGAAAGACTTGAGGGAGGTAGG - Intronic
938235935 2:129707576-129707598 GAGCAGCACTGGGGGGTGGGGGG - Intergenic
938279813 2:130055977-130055999 AAACAGGAGGGGGTGGAGGTGGG - Intergenic
938330765 2:130446691-130446713 AAACAGGAGGGGGTGGAGGTGGG - Intergenic
938359179 2:130674812-130674834 AAACAGGAGGGGGTGGAGGTGGG + Intergenic
938912627 2:135899149-135899171 AAGCAGGCCTGGGGAAAGGAGGG + Intergenic
938949945 2:136246213-136246235 AAGCAGTGCTGGTGGGGGGTGGG + Intergenic
939643127 2:144664361-144664383 AAGCTGGTTTGGGGGCAGGTAGG + Intergenic
942082973 2:172418711-172418733 GAGCAGGACTTTGGGGCGGTTGG - Intergenic
942512513 2:176717540-176717562 CAGCAGGACTGGGCAGAGGGAGG + Intergenic
943460466 2:188166162-188166184 AGGCAGGGGTGGGGGGAGGGGGG + Intergenic
944763613 2:202841787-202841809 ATGCAGGAGTGGAGGCAGGTGGG + Intronic
945146834 2:206747365-206747387 ATGCAGTACTTGGGGGAGGAGGG - Intronic
946040073 2:216775544-216775566 AAGGAGGACTGGAATGAGGTTGG + Intergenic
946514585 2:220397779-220397801 GAGCAGGACAGGGAGGAGGATGG + Intergenic
947418286 2:229921021-229921043 AACTAGGACTTGGGGGAGGGAGG - Intronic
947988007 2:234465363-234465385 GAGCGGGACTGGGGGGCGGGGGG - Intergenic
948003594 2:234589412-234589434 GAGCGGGAATGGGGGGATGTTGG - Intergenic
948025282 2:234771554-234771576 AAGTAGGACAGGAGGAAGGTAGG + Intergenic
948291984 2:236832382-236832404 AAGCAGGCCTGGGAGCAGGTGGG + Intergenic
948645058 2:239399584-239399606 CAGCAGGACTGGGGGGATACTGG - Intronic
948707968 2:239806981-239807003 ACTCAGGACTGGTGGGAGGATGG - Intergenic
1168785033 20:531208-531230 AAGCAGGAGGGAGGGCAGGTAGG + Intronic
1168959065 20:1856014-1856036 AAGCAGGACCACTGGGAGGTTGG - Intergenic
1169454605 20:5741227-5741249 AAGCAGGATTGGGTGGGGCTGGG - Intergenic
1170008704 20:11697251-11697273 AAGCAGGACGGGGGAGTGGGGGG + Intergenic
1170025981 20:11890685-11890707 AAGCAGGAGTGAGGGGTGGGCGG - Intergenic
1170357363 20:15507307-15507329 AAGCAGGAAGGGAGGGAGGAAGG - Intronic
1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG + Intronic
1171133484 20:22676253-22676275 AATCAGGAGAGGAGGGAGGTAGG - Intergenic
1171345538 20:24463475-24463497 AGGCAGGACAGGGGTGAGGCAGG + Intergenic
1171380800 20:24732635-24732657 GAGCAGGACTGGGGAGTGGGAGG - Intergenic
1171390799 20:24800462-24800484 AAGCAGGTGTGGGTGGAGGATGG - Intergenic
1172738673 20:37148810-37148832 TGGCAGGATTGGGGAGAGGTGGG - Intronic
1173042370 20:39476452-39476474 AAGAAGTACAGGTGGGAGGTAGG - Intergenic
1173519132 20:43686302-43686324 AAGCCTGACTGAGGGCAGGTGGG + Intronic
1174295262 20:49540966-49540988 AAGCAGGAATGAGGGTAGGTGGG + Intronic
1175556740 20:59867090-59867112 AAGCAAGACTGGGGGCGGGGGGG + Intronic
1176076971 20:63253140-63253162 AAGCAGGAATGGGGAGAGCAAGG - Intronic
1176174329 20:63711474-63711496 AAGCAGCACTGGGTGGAGCAGGG - Intronic
1177100481 21:16893432-16893454 AAGCAGGAATGGAGGGTGGAAGG - Intergenic
1177401430 21:20610638-20610660 ATGGAGGGTTGGGGGGAGGTGGG + Intergenic
1178944924 21:36939003-36939025 AAGCAGGAGAGGGAGGAGGTGGG + Intronic
1179043967 21:37829127-37829149 AAGTGGGAGTGGCGGGAGGTGGG + Intronic
1179295722 21:40060558-40060580 AAGCAGGCCCGGGGTGGGGTAGG + Intronic
1179364053 21:40739238-40739260 CAGCAATGCTGGGGGGAGGTGGG + Intronic
1179731189 21:43368125-43368147 GGGGATGACTGGGGGGAGGTTGG + Intergenic
1180515692 22:16140940-16140962 CAGAAGGACTGGGAGGGGGTGGG + Intergenic
1180750155 22:18119010-18119032 AGGCAGGACTAGAGGGTGGTCGG + Intronic
1180998825 22:19978489-19978511 AAGCAGGACTGTGGGGACCCAGG + Intronic
1181049830 22:20233251-20233273 AAGCAAGACGTGGGGGAAGTGGG - Intergenic
1181160721 22:20958022-20958044 AAGCAGGACCGTGTGGAGGAGGG + Intergenic
1181547402 22:23609903-23609925 AAGCAGGTCTTGGGAGAGCTAGG - Intronic
1181622385 22:24099902-24099924 AAGCAGGAAAGGAGGGAGGCAGG + Intronic
1182049984 22:27305276-27305298 AGTCAGGGCTGGGGGGAAGTTGG - Intergenic
1182051727 22:27317514-27317536 AAGCAGTCCTCGGGGAAGGTAGG - Intergenic
1182103751 22:27674538-27674560 AAGAAGGAGTGGGGAGAGGGAGG - Intergenic
1182983568 22:34695796-34695818 AAGCAGATGTGGGGGGCGGTGGG - Intergenic
1183344102 22:37297500-37297522 AAGCAGGCCTGGGAGGGGGAAGG - Intronic
1183362091 22:37388015-37388037 AGGCGGGACTAGGGGCAGGTGGG - Intronic
1183404472 22:37623690-37623712 TAGCAGGGCCTGGGGGAGGTGGG - Intronic
1183487599 22:38097779-38097801 AAGTAGGAGATGGGGGAGGTGGG + Intronic
1183546702 22:38457963-38457985 AGACTGGACTGGGAGGAGGTAGG + Intergenic
1183684244 22:39352233-39352255 GAGCAGGACTGGGAGGCTGTGGG - Intronic
1183696651 22:39427499-39427521 GAGCAGCACTGGGGGGAGCACGG - Intronic
1184297450 22:43533868-43533890 AAGCAGGACTGGGCTGGGCTGGG + Intronic
1184298867 22:43543335-43543357 GAGAAGGGCTGGGGGCAGGTGGG - Intronic
1184842907 22:47063092-47063114 CAGCAGGACTCGGTGGAGGATGG + Intronic
1185117956 22:48948884-48948906 AGGCTGGAGTGGGGGGAGGCTGG - Intergenic
1185338397 22:50280966-50280988 CATCAGGTCTGGGGGGAGGCTGG + Exonic
950119968 3:10475279-10475301 AAGTAGCACATGGGGGAGGTGGG + Intronic
950142079 3:10622343-10622365 AACCAGGACTGTGAGGAGGATGG + Intronic
950275014 3:11653273-11653295 AAGAAGGAATAGGTGGAGGTGGG - Intronic
950649004 3:14395743-14395765 CAGCAGGTCTGGGGTGGGGTTGG - Intergenic
950916629 3:16652498-16652520 AAGCAGGAGTGGGGGGACAAAGG + Intronic
952038571 3:29234134-29234156 CATCAGGACTTGGGGGAAGTAGG + Intergenic
953027800 3:39154644-39154666 GAGCAGGACTGGGAGGGGGAGGG - Intergenic
953384218 3:42497105-42497127 ACGCAGGACTGGGAAGAGGGAGG + Intronic
953878361 3:46679116-46679138 ACTCAGGGCTGGGGGCAGGTAGG - Intronic
954504222 3:51053188-51053210 AATCAGGAATGGGGAGAGATAGG - Intronic
954616927 3:51973892-51973914 AAGGAAGACTTGGGGTAGGTGGG + Intronic
954708541 3:52493830-52493852 AGGCAGGGCTGTGGAGAGGTGGG + Intergenic
954950402 3:54467735-54467757 AAGGAGGAGTGGGGAGAGATTGG + Intronic
955058314 3:55474886-55474908 AGGTAGGGCTGGGGGGAGGTTGG + Intronic
955752438 3:62196526-62196548 AACCAGGACTGGGATTAGGTTGG - Intronic
956171965 3:66440027-66440049 AAAAAGGAGTGGAGGGAGGTGGG + Intronic
956702601 3:71971783-71971805 ATGCTTGACTGGAGGGAGGTGGG - Intergenic
956734535 3:72228144-72228166 AAGCAGAGCTGGGGGAGGGTGGG - Intergenic
956882804 3:73528223-73528245 AAGCAGGACTGGGCGTTGGAAGG - Intronic
957789970 3:84928368-84928390 AAGCAGGACTGGGAGGCCTTTGG + Intergenic
958039236 3:88206564-88206586 AAGCAGGAGAGAGGGGAGGAAGG + Intergenic
958625202 3:96614390-96614412 AAACAGAACTGGGAGGAAGTAGG + Intergenic
959619975 3:108389509-108389531 AAGCAGGACTGGAGGGTTGTGGG - Intronic
961861213 3:129918050-129918072 AGGTAGGACTGGGGCCAGGTTGG - Intergenic
962089729 3:132230507-132230529 AAGCAGTACAGGGTGGATGTGGG - Intronic
962209758 3:133467444-133467466 AAGCAGGACAGGGCAGAGGAAGG - Intronic
962712977 3:138102923-138102945 AAGCAGGAGTGGAGGCAGGTGGG + Intronic
962866168 3:139449512-139449534 AAGGAGGGTTGGGGAGAGGTGGG - Intergenic
963130010 3:141849226-141849248 AAGCAGGACGGGGAGGAGGAGGG + Intergenic
963259677 3:143179115-143179137 GGGCAGGACTGGGGACAGGTTGG + Intergenic
963406316 3:144868227-144868249 AAGCAGGAGAGAGGGGAGGGAGG - Intergenic
964592838 3:158384864-158384886 AAGCAGGTCAGGGTGGAGGAGGG + Intronic
966205126 3:177398322-177398344 AAGCAGGAGAGAGGGGAGGGAGG + Intergenic
966542249 3:181105351-181105373 AAGGTGGGCTGGGGGGAGGTGGG - Intergenic
966937760 3:184724879-184724901 ATGCTGGAGTGGGGAGAGGTTGG + Intergenic
967170388 3:186818481-186818503 AAATAAGACTGGGGGCAGGTAGG + Intergenic
968501357 4:951667-951689 ATGCAGGCCTGGAGGGAGGGAGG - Exonic
968713752 4:2139250-2139272 AAGCAGGGCTGGCCGGAGCTTGG + Intronic
969369679 4:6723707-6723729 AAGGAGGACAGGGAGCAGGTGGG + Intergenic
969440914 4:7216247-7216269 AAGCAGCAGTGAGGGGAGGTGGG + Intronic
969445930 4:7244723-7244745 AAACAAGAGTTGGGGGAGGTAGG - Intronic
969518810 4:7663988-7664010 AAGCAGGGATGGGGGCGGGTGGG - Intronic
969670831 4:8589367-8589389 AAGCAGGAGGTGGGGCAGGTGGG + Intronic
969828620 4:9778119-9778141 GAGCAAGACTCGGGGGAGGCGGG - Intronic
970513240 4:16801564-16801586 AATCAGTACTTGGGGGAGATGGG - Intronic
971608916 4:28696203-28696225 AGGGAGGACTGATGGGAGGTTGG + Intergenic
972172320 4:36361802-36361824 AAGAAAGACTGGGGTCAGGTGGG + Intergenic
972251791 4:37309587-37309609 GAGAATGGCTGGGGGGAGGTGGG + Intronic
973026048 4:45272585-45272607 AAGCAGAAATGGGGAGAGGGAGG + Intergenic
975541936 4:75522571-75522593 TAGTAGGATGGGGGGGAGGTGGG - Intronic
975544789 4:75549542-75549564 AACAAGGACTTGAGGGAGGTGGG - Intronic
975723486 4:77270279-77270301 AAGCAGGACCAGGGAGAGGAAGG + Intronic
975725863 4:77291119-77291141 AAGCAGGACCGGGCAGAGGGAGG + Intronic
976207142 4:82633927-82633949 AAACAGGACTGGGAGGGAGTAGG - Intronic
976465657 4:85365907-85365929 AAGGAGGACGGAGGGGAGGAAGG - Intergenic
976489398 4:85651135-85651157 AAACAGGACGGGGGAGAGGCAGG + Intronic
976704576 4:88007601-88007623 ACGCGGGACCGCGGGGAGGTCGG + Intergenic
976801915 4:89002506-89002528 GAGCAGGGCTTGGGGGAGGTGGG - Intronic
977198028 4:94085184-94085206 AAGCAGGATTGGGGCGGTGTGGG + Intergenic
977928845 4:102730177-102730199 AGGCAGGAGTGGGGGCAGGAAGG + Intronic
979734677 4:124068625-124068647 AACCAAGACTGGGGAGATGTGGG + Intergenic
980893095 4:138835793-138835815 AAGAAGGACTTAGGGGAAGTGGG + Intergenic
981715053 4:147744541-147744563 AAGCAGGACTGGAGGTTGGGGGG + Intronic
982265162 4:153531906-153531928 AATCAGGACTGGGGTTTGGTGGG - Intronic
982814448 4:159868619-159868641 CAGCAGGACTGGGGTGGGGCCGG - Intergenic
983925670 4:173399236-173399258 AGCCAGGACTGTGGGGAGGAGGG + Exonic
984653095 4:182290266-182290288 AAGCAGTACGGGGAGGAAGTAGG - Intronic
984894705 4:184527658-184527680 AAGCAGGACTGGGCAGAGAAAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985111770 4:186554219-186554241 AAGCACTACTGGGGGCGGGTGGG + Intronic
985522081 5:378637-378659 ATGGAGGAGTGGGGAGAGGTGGG + Intronic
985791192 5:1927852-1927874 AAGCGGGGCCGGGGGCAGGTAGG + Intergenic
986031112 5:3893311-3893333 AAGCAGGACAGCAGGGAGGGAGG - Intergenic
986092386 5:4523165-4523187 GAGCAAGACTGGAGGAAGGTGGG + Intergenic
986265896 5:6190106-6190128 AGGCAGGACTGACGGGAGATTGG - Intergenic
986342030 5:6797733-6797755 AAGAAGGACTGAGGGAAGGAAGG - Intergenic
986871306 5:12049860-12049882 GAGAAGGACTGGTGGGGGGTTGG + Intergenic
987723840 5:21671753-21671775 AAGGAGGAATGGAGGGAGGGAGG - Intergenic
988479824 5:31620311-31620333 AAGCAGAACTGGGCAGAGGGAGG + Intergenic
989550643 5:42731735-42731757 AAAAAGGGTTGGGGGGAGGTGGG + Intergenic
989795966 5:45472618-45472640 AAGAAGGAAAGGGGGGAGGGAGG + Intronic
990198114 5:53341924-53341946 AAGCAGGATTGGGAAGAGGAAGG - Intergenic
992013927 5:72557188-72557210 GAGCAGGGGTGGGGTGAGGTGGG + Intergenic
992988466 5:82258025-82258047 GAGCAGGACTGGGGCCAGCTCGG + Intronic
994320969 5:98393535-98393557 AAGCAGGAGTGGAGGCAGGCGGG + Intergenic
995692097 5:114838678-114838700 TAGGAGGATTAGGGGGAGGTGGG + Intergenic
996509759 5:124305034-124305056 AAGGAGGACTGGAGGGTGGAAGG - Intergenic
997979238 5:138458838-138458860 AAGAAGGAGTGGGTGGAAGTGGG - Intergenic
998185397 5:139975403-139975425 AAGTAGGACTGGGGTAAGGGTGG - Intronic
999046836 5:148478685-148478707 AAGCAGGACGGGGAATAGGTAGG - Intronic
999982868 5:156974852-156974874 AAGAAAGAGTGGGGGGAGGGAGG + Intergenic
1000878259 5:166667079-166667101 AAGGAGGACTGGGAGTAGGCAGG - Intergenic
1001891712 5:175344780-175344802 AGGCAGGAGTGGGGGGAAGGAGG + Intergenic
1002060576 5:176623431-176623453 GGCCAGGACTGAGGGGAGGTGGG + Intronic
1002364104 5:178696782-178696804 AAGCAGTACTGGGGAGAGGGTGG + Intergenic
1002400799 5:178990754-178990776 GAGCAGGGCTGGGGTGAGGGAGG + Intronic
1002516086 5:179760043-179760065 AAACAGGACTGGGGAGAGGCTGG + Intronic
1002844394 6:934197-934219 AGGCAGGCCTGGGGGAAGGATGG + Intergenic
1003236046 6:4295901-4295923 CAGCAGGACTGGGGTGAGGCTGG - Intergenic
1003654947 6:7998488-7998510 AAGCAGTCCTGGGTGGAGGAGGG - Intronic
1003772337 6:9319297-9319319 ATGGAGGCCTGGGGGGAAGTGGG + Intergenic
1005117696 6:22356480-22356502 GAGCAGGGGTGGGGGGTGGTGGG + Intergenic
1005889802 6:30127658-30127680 AAGAAAGGCTGGGAGGAGGTGGG + Intergenic
1006091930 6:31633421-31633443 CAGCAGAACTGCTGGGAGGTGGG - Exonic
1006097700 6:31666174-31666196 GACCAGGACTGGGGTGGGGTAGG - Exonic
1006186590 6:32184862-32184884 GGGCAGGACTGGGGACAGGTTGG - Exonic
1006195926 6:32242308-32242330 AAGCAGAGCAGGGGTGAGGTGGG + Intergenic
1006749344 6:36366821-36366843 AAGCAGAACTGGGGTTGGGTGGG - Intronic
1007038615 6:38701145-38701167 AAGCAGAACAGGGTGGAGGTTGG + Intronic
1007394607 6:41570399-41570421 GAGAAGGACAGGTGGGAGGTGGG + Intronic
1007656090 6:43451852-43451874 AGGCAGGACTGTTGGGAGGGTGG - Intronic
1008617878 6:53243645-53243667 CAGCAGGTCTAGGGCGAGGTCGG + Intergenic
1010756101 6:79667896-79667918 GAGGAAAACTGGGGGGAGGTGGG - Intronic
1011714700 6:90093040-90093062 TTGCTGGACTGAGGGGAGGTTGG + Intronic
1011716406 6:90109655-90109677 AAGCAGGTTTGGAGGGAGGATGG - Intronic
1012562218 6:100597151-100597173 AAGGCGGCCTGGGGGGAGATGGG - Intronic
1015998506 6:139018829-139018851 AAGGAGGACAGGAGGGAGGGAGG + Intergenic
1016330109 6:142945972-142945994 AAGGAGGACGGGGAGGAGGAGGG + Intergenic
1016990768 6:149926146-149926168 AAGAAGGATTGGAGGGAGGGCGG + Intergenic
1017229072 6:152052753-152052775 AGGCAGGATGGGGGTGAGGTGGG + Intronic
1017821061 6:158049388-158049410 GAGCAGGACAGAGGGGAGGAAGG + Intronic
1017989689 6:159475394-159475416 GAGCAGAACTGGGAGGAAGTTGG - Intergenic
1017993169 6:159507461-159507483 AGGCAGGACTAGGGAGAGATTGG + Intergenic
1018861655 6:167714410-167714432 AAGCAGGAAGGGAGGGAGGGCGG + Intergenic
1018904039 6:168064836-168064858 TAGCAGTGCTGGGAGGAGGTGGG + Intronic
1019304306 7:325585-325607 CAGCTGGAGAGGGGGGAGGTGGG - Intergenic
1019321831 7:419513-419535 AGGGGTGACTGGGGGGAGGTGGG - Intergenic
1019321869 7:419647-419669 AGGGGTGACTGGGGGGAGGTGGG - Intergenic
1019321906 7:419781-419803 AGGGGTGACTGGGGGGAGGTGGG - Intergenic
1019321945 7:419915-419937 AGGGGTGACTGGGGGGAGGTGGG - Intergenic
1019321965 7:419982-420004 AGGGGTGACTGGGGGGAGGTGGG - Intergenic
1019321985 7:420049-420071 AGGGGTGACTGGGGGGAGGTGGG - Intergenic
1019322005 7:420116-420138 AGGGGTGACTGGGGGGAGGTGGG - Intergenic
1019432688 7:1006834-1006856 CAGCAGGGCTGGGGAGAGGAGGG - Intronic
1019527547 7:1487508-1487530 AAGCAGGGATGGGAGGAGGAGGG - Intronic
1019696822 7:2450877-2450899 CTGCAGGGCTTGGGGGAGGTGGG + Intergenic
1019748397 7:2713383-2713405 AAGCCGGACTGTGCTGAGGTTGG + Exonic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1020023263 7:4881941-4881963 AAGCAGGGGTGGGGGGAAGTGGG - Intronic
1020131062 7:5558879-5558901 AAGCAGGAATGAGGGGTGGAGGG + Intronic
1020257199 7:6508925-6508947 AAGCAGGTGTGGAGGGAGGCGGG - Intronic
1020440261 7:8209965-8209987 AAGCTGGGGTTGGGGGAGGTAGG + Intronic
1020817933 7:12928858-12928880 AAGAAGGACTGGGGCAAGGAAGG - Intergenic
1020832601 7:13110304-13110326 GAGAAGCACTGGAGGGAGGTTGG - Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1021954187 7:25807313-25807335 AGGGAGGAGTGGGGGGAGGGAGG + Intergenic
1023575509 7:41622210-41622232 AAGCAGGAATGGAGGGAGAAAGG + Intergenic
1024701297 7:51906903-51906925 ACCCAGGACTGGGGGGCTGTGGG + Intergenic
1026509357 7:71015680-71015702 AAGGAGGACTGGAGTGAGTTCGG + Intergenic
1026524654 7:71143576-71143598 TAGGAGGACTGGGTGGAGGCTGG + Intronic
1026872785 7:73863305-73863327 CTGCAGGACTGGGGTGAGGTGGG - Intronic
1027119102 7:75502994-75503016 GAGCAGGGGTGGGGGGAGGGGGG + Intergenic
1027188280 7:75984380-75984402 AAGCAGGGGTGGGGCGAGGTGGG - Intronic
1027272726 7:76532611-76532633 GAGCAGGGGTGGGGGGAGGGGGG - Intergenic
1027326174 7:77051696-77051718 GAGCAGGGGTGGGGGGAGGGGGG - Intergenic
1027569689 7:79848390-79848412 CATCAGGACTGGGGGGCAGTAGG - Intergenic
1029284350 7:99455731-99455753 AATCAGGACTGGGATGAGGCAGG + Intronic
1029436817 7:100568305-100568327 CAGCAGGACTGGGAGGGGGAGGG + Intergenic
1029443786 7:100602093-100602115 AAGCAGGGGCGGGGGGAGGATGG + Intergenic
1029600037 7:101558109-101558131 AGGCAGGGCTGCGGGGAGGCTGG + Exonic
1029718396 7:102347038-102347060 GAGCAGGGGTGGGGGGAGGGGGG - Intergenic
1029754220 7:102562217-102562239 GAGCAGGGGTGGGGGGAGGGGGG + Intronic
1029772170 7:102661307-102661329 GAGCAGGGGTGGGGGGAGGGGGG + Intronic
1029793703 7:102871915-102871937 GAGAAGGACTGGGGGCAGGGAGG - Intronic
1029933214 7:104395589-104395611 AAGCAGGAGTTAGGAGAGGTAGG + Intronic
1030107340 7:105998028-105998050 AAGAAGGAGTGGGGGCAGGGTGG + Intronic
1030531671 7:110718598-110718620 AAGCTAGCCTGGGAGGAGGTTGG + Intronic
1030925008 7:115441018-115441040 AAGGAGGAAGGGAGGGAGGTAGG + Intergenic
1031205550 7:118752519-118752541 CTTCAGGACTGGGGGGATGTAGG + Intergenic
1031528484 7:122849979-122850001 AGGCAGGCTTGGGGGCAGGTGGG - Intronic
1031844810 7:126792399-126792421 AAGCAGGGCTGGGGAGAGACTGG - Intronic
1032386543 7:131529504-131529526 AAGGAGGCCAGGGAGGAGGTGGG + Intronic
1032497941 7:132376822-132376844 AAGGAGGACTGGGTGCAGGTGGG - Intronic
1034927925 7:155138206-155138228 AAGCAGGACTGGGCAGAAGGAGG + Intergenic
1035285616 7:157804813-157804835 AGGCAGGACTGGGAGAAGGGGGG - Intronic
1035301588 7:157901108-157901130 AAGCAGGAGAGGGCGGAGGGAGG + Intronic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1035761844 8:2074431-2074453 AAGGAGGAGTGGGAGTAGGTGGG - Intronic
1036525316 8:9529401-9529423 AAGCAGGGGTGGGGGGTGGTGGG - Intergenic
1036616195 8:10389667-10389689 AGGCAGGACTGGAGAGAGGATGG - Intronic
1037858671 8:22389447-22389469 CAGGAGGACCCGGGGGAGGTGGG + Intronic
1037883142 8:22582495-22582517 GACCAGGGCTCGGGGGAGGTAGG + Intronic
1037972890 8:23186858-23186880 ATGCAACAGTGGGGGGAGGTGGG + Intergenic
1040067655 8:43161133-43161155 AAGCAGGACATGGGGGTGGGTGG + Intronic
1041935128 8:63324895-63324917 AAGCAGGTCTGGGGGGAAGCTGG - Intergenic
1042309110 8:67362507-67362529 AAGCAGTATTGAGGGGAGGAGGG + Intergenic
1043635051 8:82375011-82375033 AAGCAGGTGTGGAGGGAGGAAGG + Intergenic
1043718042 8:83509580-83509602 AAGCAGGAATGGAGGGTGGAAGG + Intergenic
1044099951 8:88122902-88122924 AGGCAGGGGTGGGGGGAGGAGGG - Intronic
1044623741 8:94216433-94216455 AAGGAGGCCTGGGAGGAGGCCGG + Intronic
1045331525 8:101159529-101159551 AGACAGTCCTGGGGGGAGGTGGG + Intergenic
1045651570 8:104346352-104346374 CAGGAGGACTGCGGGCAGGTGGG - Intronic
1047367236 8:124222693-124222715 AAGTATGGCTGGGGGGAGGGCGG + Intergenic
1047594687 8:126366401-126366423 AGGAAGGGCTGTGGGGAGGTAGG + Intergenic
1047730333 8:127722782-127722804 AGGCAGGGCGAGGGGGAGGTGGG - Intergenic
1047927633 8:129696981-129697003 AAGAAGGATTGGAGGGAGGTGGG + Intergenic
1048136708 8:131753101-131753123 GAGGGAGACTGGGGGGAGGTTGG + Intergenic
1048802891 8:138210483-138210505 AAGCATGACTGGGGGGACTCAGG + Intronic
1048948372 8:139472000-139472022 AGGCAGGACAGGGGAGAGGGAGG - Intergenic
1048952296 8:139506370-139506392 GAGAAGGAGTGGGGAGAGGTGGG + Intergenic
1049283904 8:141764288-141764310 AGGGAGGGCTGGGAGGAGGTGGG + Intergenic
1049423895 8:142528813-142528835 GAGCAGGCCTGTGGGGAGGATGG - Intronic
1049582547 8:143419351-143419373 AAGGAGGTCTGGGGGAAGGAAGG + Intronic
1049607889 8:143538131-143538153 AGACAGGACTGGGGAGAGCTGGG + Exonic
1052323498 9:27193158-27193180 AAGCAGGACTGGGAGGTGGAGGG - Intronic
1052821223 9:33139178-33139200 AAGGAGGAGTGGGTTGAGGTAGG + Intronic
1053079606 9:35163582-35163604 TAGCAGGATTTGGGAGAGGTTGG + Intronic
1053305418 9:36981186-36981208 AAGCAGGGCTGAGGGGGGGGGGG - Intronic
1053449846 9:38184219-38184241 AAGCAAGACAGAGGGGAGGGAGG + Intergenic
1056671114 9:88627588-88627610 AAGGAGGATTGGGGGGAAGGTGG + Intergenic
1057279990 9:93702179-93702201 AGTCAGGACTGGGAGGGGGTGGG + Intergenic
1057820936 9:98330106-98330128 ATGCAGGGCTGGAGGGAGCTTGG - Intronic
1058308625 9:103473182-103473204 AGCCATGACTGGAGGGAGGTAGG + Intergenic
1058767339 9:108194631-108194653 AGGCAGGACTGGAGGCAGGGAGG - Intergenic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1059740133 9:117141977-117141999 AAGCAGGATCAGGGTGAGGTTGG + Intronic
1060200329 9:121648714-121648736 AAGCAGCACATGGGAGAGGTGGG + Intronic
1060867406 9:127011164-127011186 AAGGCGGGCTGGGGGGTGGTGGG - Intronic
1061074635 9:128333669-128333691 AAGCAGGGGATGGGGGAGGTAGG - Exonic
1061177900 9:129008491-129008513 AAGCAGGGCTGGGGGAGGGGTGG + Exonic
1061252494 9:129434755-129434777 AAGCAGGAATAGGGGGAGCCTGG + Intergenic
1061382189 9:130265417-130265439 AGGCAGGGGTGGGGGGAGTTGGG + Intergenic
1061403428 9:130381019-130381041 GGGCAGGACTGGGGGGCAGTTGG - Intronic
1061761613 9:132855577-132855599 AACCAGCACTGGGGGCAGGGTGG - Intronic
1061817191 9:133204561-133204583 ATGCTGGTCTGGCGGGAGGTGGG + Intergenic
1061868431 9:133507296-133507318 AGGCAGGAGTGTGGGGAGGAGGG - Intergenic
1061899331 9:133665052-133665074 AACCAGCTCTGGGGTGAGGTGGG + Intronic
1062267701 9:135694964-135694986 AAGCAGGACTGGGAGGAGGTGGG + Intronic
1062274421 9:135724040-135724062 AAGCAGGAGTGCTGGGAGGAGGG - Intronic
1062284040 9:135765250-135765272 AAGCAGTCCTGGGGAGAGGATGG - Intronic
1062284071 9:135765371-135765393 AAGCAGTCCTGGGGAGAGGATGG - Intronic
1062474482 9:136720405-136720427 AAGCAGGCTTGGAGGGAGCTGGG - Intronic
1062569652 9:137179233-137179255 GCTCAGGACTGGGGGGAGGCGGG - Intronic
1062612047 9:137379810-137379832 AAGCAGGAGTGAGGGAAGGCGGG - Intronic
1185603592 X:1354959-1354981 GAGGAGGACTGGGGGGAGGAAGG + Intronic
1186053609 X:5626511-5626533 AAGAAGGAATGTTGGGAGGTAGG + Intergenic
1186545513 X:10445010-10445032 CAGCAGGTCTCGGGGGAGGCAGG + Intergenic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187621605 X:21062425-21062447 AAGCAGGAAAAGAGGGAGGTAGG + Intergenic
1187768840 X:22672543-22672565 AAGAAGGGCTGAAGGGAGGTTGG + Intergenic
1189333240 X:40155485-40155507 AAGGAGGAGTGGGAGGAAGTGGG + Intronic
1189362950 X:40367223-40367245 TAGCAGGGATGGGGAGAGGTTGG + Intergenic
1189547294 X:42054990-42055012 AAGCATGACTGGGTAGAGGGAGG + Intergenic
1189658543 X:43273511-43273533 GAGAAGGAATGGGGAGAGGTTGG - Intergenic
1189761347 X:44324545-44324567 ATGCAGGGGTTGGGGGAGGTGGG - Intronic
1190119784 X:47650491-47650513 ACCCAGGCCTGGGGGGCGGTGGG - Exonic
1191220602 X:57984658-57984680 AAGCAGGAGTGGAGGCAGGTGGG - Intergenic
1192247308 X:69384377-69384399 AAGCAGGATAGGGAAGAGGTAGG - Intergenic
1192491314 X:71579169-71579191 TTGCGGCACTGGGGGGAGGTGGG + Intronic
1192491431 X:71579574-71579596 TTGCAGCATTGGGGGGAGGTGGG + Intronic
1194898655 X:99478062-99478084 AAGCAGGAATGGGAAGAGGTTGG - Intergenic
1196237433 X:113299747-113299769 GAGCAGGGCGGGGGGTAGGTAGG - Intergenic
1196516292 X:116616271-116616293 AGGCAGAACTGCGGGGAGCTGGG - Intergenic
1198463577 X:136885057-136885079 ATGCAGGAGAGGGGGGACGTGGG + Intergenic
1198956584 X:142137924-142137946 AGGCAGGGGTGGGGGGCGGTGGG + Intergenic
1199927088 X:152479549-152479571 AGGCAGGAGTGGAGGCAGGTGGG - Intergenic
1199983115 X:152931977-152931999 AATGAGGCCTGGAGGGAGGTAGG + Intronic
1200176105 X:154117403-154117425 AAAGAGGACTGGGTGAAGGTTGG - Intergenic
1200206513 X:154320312-154320334 AAGCAGGACAAGGCGGAGATGGG + Intronic
1201256097 Y:12109631-12109653 AGGGAGGACTGGAGGGAGGGAGG + Intergenic
1201458989 Y:14201572-14201594 AAGGAGAAATGGGGGGAGGCAGG + Intergenic