ID: 915463992

View in Genome Browser
Species Human (GRCh38)
Location 1:156085300-156085322
Sequence CGCTCTCTCCCGGAGGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1299
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 1247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915463987_915463992 19 Left 915463987 1:156085258-156085280 CCTTGAGGAGCTGGATTCTCAGA 0: 1
1: 0
2: 4
3: 22
4: 239
Right 915463992 1:156085300-156085322 CGCTCTCTCCCGGAGGCTGGTGG 0: 1
1: 0
2: 1
3: 50
4: 1247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915463992 Original CRISPR CGCTCTCTCCCGGAGGCTGG TGG Intronic