ID: 915463992

View in Genome Browser
Species Human (GRCh38)
Location 1:156085300-156085322
Sequence CGCTCTCTCCCGGAGGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1299
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 1247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915463987_915463992 19 Left 915463987 1:156085258-156085280 CCTTGAGGAGCTGGATTCTCAGA 0: 1
1: 0
2: 4
3: 22
4: 239
Right 915463992 1:156085300-156085322 CGCTCTCTCCCGGAGGCTGGTGG 0: 1
1: 0
2: 1
3: 50
4: 1247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915463992 Original CRISPR CGCTCTCTCCCGGAGGCTGG TGG Intronic
900194602 1:1369502-1369524 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
900236143 1:1591956-1591978 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
900268676 1:1775074-1775096 CACTCTGTCCCCCAGGCTGGAGG - Intronic
900273824 1:1810107-1810129 CGCTCTGTCACCCAGGCTGGAGG + Intronic
900343920 1:2201982-2202004 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
900346764 1:2213926-2213948 CCCTCCGTGCCGGAGGCTGGTGG + Intergenic
900548122 1:3239912-3239934 CACTCTAGCCTGGAGGCTGGGGG + Intronic
901103230 1:6735609-6735631 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
901239214 1:7683147-7683169 CGCTCTGTCACCCAGGCTGGAGG - Intronic
901307877 1:8246317-8246339 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
901375919 1:8839392-8839414 CGCTCTGTCACAGAGGCTGGAGG - Intergenic
901504050 1:9673129-9673151 CGCTCTGTCACCTAGGCTGGAGG + Intronic
901545059 1:9950121-9950143 CGCTCTGTCACCCAGGCTGGAGG + Intronic
901561952 1:10079207-10079229 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
901608693 1:10479342-10479364 TGCTCTCTCACCCAGGCTGGAGG - Intronic
901695740 1:11006674-11006696 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
902226886 1:15001911-15001933 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
902261453 1:15228048-15228070 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
902327342 1:15710192-15710214 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
902406419 1:16186199-16186221 CGCTCTGTCGCCCAGGCTGGGGG + Intergenic
902532707 1:17100692-17100714 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
902566189 1:17313155-17313177 CGCTCTGTCGCCTAGGCTGGAGG - Intronic
902824638 1:18964674-18964696 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
903066739 1:20703896-20703918 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
903081801 1:20816598-20816620 CGCCCTGTCCGGGAGGGTGGTGG + Intronic
903117718 1:21191909-21191931 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
903127278 1:21256634-21256656 GGCTTTCTCCTGGAGGCTGTAGG - Intronic
903245434 1:22011725-22011747 TGCTCTGTCACCGAGGCTGGAGG - Intronic
903286266 1:22278828-22278850 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
903431131 1:23300896-23300918 CACTCTCTCGCCCAGGCTGGAGG + Intergenic
903575145 1:24335194-24335216 CTCCCTCTCCCAGAGGCTGTGGG - Intronic
903602240 1:24551034-24551056 CACTCTGTCACGCAGGCTGGAGG + Intergenic
903735299 1:25526369-25526391 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
903884426 1:26532604-26532626 TGCTCACTGCTGGAGGCTGGGGG - Intronic
904020225 1:27458278-27458300 CGCTCTGTCACCCAGGCTGGAGG - Intronic
904054646 1:27662149-27662171 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
904067457 1:27764965-27764987 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
904164589 1:28545654-28545676 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
904311797 1:29633958-29633980 CCCTCCTTCCCTGAGGCTGGAGG + Intergenic
904665993 1:32121938-32121960 CGCTCTGTCACCCAGGCTGGAGG - Intronic
905100894 1:35521304-35521326 TGCTCTCTCGCCCAGGCTGGAGG - Intronic
905129404 1:35741939-35741961 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
905211785 1:36379427-36379449 CGCTCTCTCACCCAGGCTGGAGG + Intronic
905330110 1:37188744-37188766 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
906015712 1:42577671-42577693 CGCTCTGTCACCCAGGCTGGAGG + Intronic
906092223 1:43190301-43190323 CGCTCTGTCACCCAGGCTGGAGG + Intronic
906134845 1:43491376-43491398 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
906310046 1:44747273-44747295 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
906407541 1:45553960-45553982 CGCTCTGTCACCCAGGCTGGAGG - Intronic
906632135 1:47380458-47380480 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
906821609 1:48935924-48935946 CGCTCTGTCACCCAGGCTGGAGG - Intronic
906902248 1:49847732-49847754 CGCTCTGTCACCCAGGCTGGAGG + Intronic
907022134 1:51078328-51078350 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
907071173 1:51536337-51536359 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
907348724 1:53807212-53807234 CGCTCTGTCACCCAGGCTGGAGG - Intronic
907375352 1:54033567-54033589 CACTCTGTCCCCCAGGCTGGAGG - Intronic
907544263 1:55245854-55245876 CACTCTGTCGCTGAGGCTGGAGG + Intergenic
907758982 1:57339186-57339208 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
908145146 1:61233802-61233824 AGCTATCTCCAGGAGGCTGCTGG - Intronic
908215742 1:61949867-61949889 CGCTCTGTCACCTAGGCTGGAGG - Intronic
908664261 1:66472509-66472531 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
909004155 1:70255723-70255745 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
909173156 1:72320140-72320162 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
909239591 1:73195522-73195544 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
909266824 1:73570287-73570309 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
909739428 1:79009722-79009744 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
909798918 1:79780977-79780999 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
910751153 1:90632578-90632600 CTCACTCTCCTGGAGGCTGGAGG - Intergenic
911101851 1:94101660-94101682 CGTTCTCTCCTGGAGTCTGGAGG + Intronic
911297646 1:96136836-96136858 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
911719995 1:101180499-101180521 CGCTCTGTCACTGAGGCTGGAGG - Intergenic
912360176 1:109088757-109088779 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
912462055 1:109841279-109841301 TGCTCTGTCCCCCAGGCTGGAGG - Intergenic
914215820 1:145626918-145626940 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
914413757 1:147457835-147457857 CACTCTGTCACTGAGGCTGGAGG - Intergenic
914467764 1:147947303-147947325 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
914775196 1:150728991-150729013 CGCCCTGTCCGGGAGGCAGGTGG - Intergenic
914854272 1:151339231-151339253 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
915015319 1:152727622-152727644 CGCTCTGTCGCTTAGGCTGGAGG - Intergenic
915173488 1:153995282-153995304 CACTCTGTCCCCCAGGCTGGAGG + Intronic
915276194 1:154789936-154789958 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
915319136 1:155046633-155046655 CGCTCTGTCACCCAGGCTGGAGG + Intronic
915381340 1:155444014-155444036 CGCTCTGTCACTCAGGCTGGAGG + Intronic
915463992 1:156085300-156085322 CGCTCTCTCCCGGAGGCTGGTGG + Intronic
915718101 1:157963365-157963387 CACTCTCTCCTGTAGGCAGGTGG - Intergenic
915856683 1:159396339-159396361 ACCTCTCTCCCTGAGCCTGGTGG - Intergenic
915954928 1:160213538-160213560 CCCCCTCTCCTGGAGGATGGGGG - Exonic
916039624 1:160950966-160950988 CCCTCCCTCCTGCAGGCTGGTGG + Intronic
916117227 1:161496535-161496557 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
916448571 1:164896536-164896558 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
917340911 1:173976417-173976439 CACTCTGTCCCCCAGGCTGGAGG - Intronic
917423453 1:174889154-174889176 CGCTCTGTCACCCAGGCTGGAGG + Intronic
917879253 1:179317498-179317520 CGCTCTGTCACCCAGGCTGGAGG - Intronic
918165157 1:181937996-181938018 CGCTCTGTCGCCAAGGCTGGAGG + Intergenic
918271483 1:182905965-182905987 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
918339753 1:183558596-183558618 CGCTCTGTCACCCAGGCTGGAGG + Intronic
918593857 1:186269794-186269816 CGCTCTTTCACCCAGGCTGGAGG - Intergenic
918949858 1:191123497-191123519 TGCTCTGTCCCCCAGGCTGGAGG + Intergenic
919111865 1:193230179-193230201 CACTCTGTCCCCCAGGCTGGAGG + Intronic
919186034 1:194151581-194151603 CTCTCTGTCCCCCAGGCTGGAGG + Intergenic
919188193 1:194181741-194181763 CTCTATCTCCCATAGGCTGGTGG - Intergenic
919425092 1:197419946-197419968 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
919893902 1:201996524-201996546 CGCTCTGTCACCCAGGCTGGAGG + Intronic
919911155 1:202111655-202111677 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
919949238 1:202347364-202347386 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
920007015 1:202840752-202840774 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
920334973 1:205239036-205239058 CCCTATCCCCGGGAGGCTGGTGG - Intronic
920460500 1:206135916-206135938 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
920598329 1:207296067-207296089 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
921094435 1:211874545-211874567 CCCTCACTGCCGGGGGCTGGCGG + Intergenic
921177426 1:212607264-212607286 GCCTCTCTCCCAGAGGCAGGTGG + Intronic
921208003 1:212865846-212865868 CGCTCTGTCACCCAGGCTGGAGG + Intronic
921216849 1:212945018-212945040 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
921685454 1:218083982-218084004 GGCTCTCTCCTGGTTGCTGGTGG + Intergenic
921735458 1:218622995-218623017 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
921903270 1:220469992-220470014 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
922292345 1:224218810-224218832 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
922810201 1:228411036-228411058 CACGCTCTCCCGGAGCCTGCTGG + Exonic
922976930 1:229793009-229793031 CGTTCTTTCCCCCAGGCTGGAGG + Intergenic
922999910 1:229998597-229998619 CACTCTCTCACCTAGGCTGGAGG + Intergenic
923019934 1:230155345-230155367 CGGTCTCTCCCGGAGGTCAGCGG - Intronic
923153331 1:231254472-231254494 CGCTCTGTCACCCAGGCTGGAGG + Intronic
923186882 1:231582615-231582637 CGCTCTGTCACCCAGGCTGGAGG + Intronic
923650470 1:235868202-235868224 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
923749025 1:236729289-236729311 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
924162381 1:241246069-241246091 CGCTCTGTCCCCCAGGCTGGAGG - Intronic
924471303 1:244344898-244344920 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
924530775 1:244891886-244891908 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
924570798 1:245235960-245235982 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1062963204 10:1589261-1589283 CGTTCTCCCCTGGAGGCTGGCGG - Intronic
1063019080 10:2108000-2108022 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1063451838 10:6155233-6155255 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1063476116 10:6330481-6330503 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1063578814 10:7287112-7287134 CGCTCTTTCACCCAGGCTGGAGG + Intronic
1063624191 10:7674040-7674062 CGCTCTGTCTCCCAGGCTGGAGG + Intergenic
1063704992 10:8422112-8422134 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1064100244 10:12457356-12457378 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1064108225 10:12519126-12519148 CGCCCTGTCCGGGAGGGTGGTGG - Intronic
1064365442 10:14703359-14703381 CTCTCTGTCCCCCAGGCTGGAGG + Intronic
1064449883 10:15432163-15432185 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1064680118 10:17802555-17802577 CGCTCTGTCACTCAGGCTGGAGG - Intergenic
1064874266 10:19975423-19975445 CGCTCTGTCTCCCAGGCTGGAGG - Intronic
1064954720 10:20894894-20894916 CGCTCTATCACCCAGGCTGGAGG - Intronic
1065003468 10:21358524-21358546 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1065443686 10:25775803-25775825 AGCTCTCTGCTGGAGACTGGGGG + Intergenic
1065488496 10:26257342-26257364 CGCTCTGTCTCCCAGGCTGGAGG - Intronic
1065978162 10:30862332-30862354 CGCTCTATCACCCAGGCTGGAGG + Intronic
1066318156 10:34270171-34270193 CACTCTGTCCCCCAGGCTGGAGG + Intronic
1066429093 10:35336043-35336065 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1066448333 10:35504667-35504689 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1067123797 10:43497932-43497954 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1067663326 10:48252613-48252635 GCCTCTCTTCCTGAGGCTGGAGG - Intronic
1068339167 10:55678760-55678782 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1068886849 10:62106589-62106611 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1069157599 10:65051167-65051189 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1069977690 10:72227996-72228018 CGCTCTGTCGCCCAGGCTGGGGG - Intronic
1070737341 10:78872297-78872319 CACTCTGTCCCCGAGGCTGGAGG + Intergenic
1071064684 10:81616639-81616661 CGCTCTGTCTCCCAGGCTGGAGG - Intergenic
1071247169 10:83777199-83777221 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1071929518 10:90452823-90452845 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1072650173 10:97289145-97289167 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1072959495 10:99916405-99916427 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1073003907 10:100306823-100306845 CACTCTCTCGCCCAGGCTGGAGG - Intronic
1073286662 10:102393984-102394006 CTGTCTCTCCCGGAGCCTTGAGG + Intergenic
1073832189 10:107397374-107397396 CGCTCTATCGCCCAGGCTGGAGG - Intergenic
1074133564 10:110607258-110607280 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1074281169 10:112053113-112053135 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1074385663 10:113014751-113014773 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1075059550 10:119245985-119246007 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1075140393 10:119828812-119828834 TGCTCTGTCCCCCAGGCTGGAGG - Exonic
1075143944 10:119867258-119867280 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1076130487 10:128010613-128010635 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1076662305 10:132063642-132063664 CGTTCTCTCCCGGAGCCCAGAGG - Intergenic
1076902928 10:133348540-133348562 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1077072017 11:679280-679302 CGCTCCATCCCCCAGGCTGGAGG - Intronic
1077322873 11:1950196-1950218 CGCACTCTCCCGGTGGCAGCAGG - Intronic
1077937927 11:6810059-6810081 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1078097245 11:8307564-8307586 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1078257816 11:9674934-9674956 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1080822646 11:35821885-35821907 CACTCTGTCCCCAAGGCTGGAGG - Intergenic
1081186680 11:40051345-40051367 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1081289262 11:41305256-41305278 CGCCCTCTCCGGGAGGGAGGTGG + Intronic
1081552933 11:44130916-44130938 GGCTCTCTGCCTGAGGCTGAGGG - Intronic
1081904868 11:46661796-46661818 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1082044093 11:47710875-47710897 CGCTCTGTCACTCAGGCTGGAGG - Intronic
1082734911 11:56845304-56845326 CCCTCACTGCCGGGGGCTGGCGG - Intergenic
1083330678 11:61897046-61897068 CTCCCTCTCCCCGTGGCTGGTGG - Intergenic
1083676041 11:64325490-64325512 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1083739618 11:64701882-64701904 CGCTCTGTCCGGGAGGGAGGTGG + Intronic
1083814163 11:65122750-65122772 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1083973980 11:66102355-66102377 CACTCTCTCACCCAGGCTGGAGG + Intronic
1084077960 11:66796748-66796770 CGCTCTGTCACCTAGGCTGGAGG - Intronic
1084165640 11:67373568-67373590 GCTCCTCTCCCGGAGGCTGGCGG + Exonic
1084167786 11:67384201-67384223 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1084499126 11:69524591-69524613 CTCTCCCTCCCGGCGGCTGGAGG + Intergenic
1084520791 11:69661451-69661473 CGCTCTCTCCCAGCTTCTGGTGG + Intronic
1084724694 11:70933865-70933887 TGCTCTCTCACCTAGGCTGGAGG - Intronic
1085146220 11:74200412-74200434 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1085601186 11:77857727-77857749 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1085602197 11:77864942-77864964 CACTCTGTCACTGAGGCTGGAGG - Intronic
1085632865 11:78133866-78133888 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1085657877 11:78333296-78333318 CGCTCTGTCACTCAGGCTGGAGG + Intronic
1085951182 11:81333495-81333517 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1086103273 11:83123922-83123944 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1086353754 11:85970768-85970790 CACTCTGTCCCCCAGGCTGGAGG - Intronic
1086679579 11:89653641-89653663 CGCTCTGTCACCTAGGCTGGAGG - Intergenic
1086860638 11:91921456-91921478 TGCTCTGTCCCCCAGGCTGGAGG + Intergenic
1087177271 11:95107299-95107321 CGCTCTCTCGCCCAGGCTGGAGG - Intronic
1087500950 11:98953102-98953124 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1087760124 11:102096777-102096799 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1087783522 11:102327605-102327627 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1087790797 11:102404628-102404650 TGCTCTGTCCCCCAGGCTGGAGG + Intronic
1088328476 11:108626399-108626421 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1088392910 11:109334982-109335004 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1088668795 11:112121085-112121107 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1088983675 11:114887245-114887267 CACTGTCTCCCACAGGCTGGAGG + Intergenic
1089210609 11:116798453-116798475 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1089306584 11:117530162-117530184 CCCCTTCTCCCGGAAGCTGGTGG + Intronic
1089728350 11:120503073-120503095 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1089760918 11:120722580-120722602 CGCTTTGTCACGCAGGCTGGAGG - Intronic
1089969800 11:122683570-122683592 CGCTCTGTCCCCCAGGCTGAAGG - Intronic
1089988366 11:122834859-122834881 CGTTCTGTCGCCGAGGCTGGAGG + Intergenic
1090008457 11:123023675-123023697 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1090084178 11:123636724-123636746 CGCTCTGTCGCCGAGGCTGGAGG + Intronic
1090230855 11:125102587-125102609 AGCTTTCTCCCGTGGGCTGGGGG - Intronic
1090377325 11:126300370-126300392 CGCTCTCTTGCCCAGGCTGGAGG + Intronic
1090746405 11:129709186-129709208 CACTCTGTCACGTAGGCTGGAGG + Intergenic
1090960524 11:131552470-131552492 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1091005444 11:131948995-131949017 TGGTGTCTCCCGGAGGCTGGAGG - Intronic
1202805891 11_KI270721v1_random:5509-5531 CGCACTCTCCCGGTGGCAGCAGG - Intergenic
1091516969 12:1194386-1194408 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1091739123 12:2947443-2947465 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1091739875 12:2953468-2953490 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1091741948 12:2965582-2965604 CGCTCTTTCGCCCAGGCTGGAGG + Intronic
1091758604 12:3072519-3072541 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1092020267 12:5196334-5196356 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1092106237 12:5923490-5923512 TGCTCTCTCCCCGAGGGAGGTGG - Intronic
1092110866 12:5963706-5963728 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1092135662 12:6145320-6145342 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1092454880 12:8634107-8634129 TGCTCTGTCGCGCAGGCTGGAGG - Intergenic
1092466720 12:8739938-8739960 CGCTCTGTCACCCAGGCTGGGGG + Intronic
1092610262 12:10165228-10165250 CGCTCTGTCCCCCAGGCTGGAGG - Intronic
1093442209 12:19212254-19212276 CGCTCTGTCTCCCAGGCTGGAGG - Intronic
1093576929 12:20742564-20742586 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1093578048 12:20757949-20757971 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1094315053 12:29130542-29130564 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1094331808 12:29302197-29302219 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1094425666 12:30314745-30314767 GGCTCTCTCCTGGATCCTGGTGG + Intergenic
1094447457 12:30546770-30546792 CGCTCTGTCACCGATGCTGGAGG + Intergenic
1094583281 12:31754174-31754196 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1094600576 12:31905630-31905652 CGCTCTGTCACCTAGGCTGGAGG - Intergenic
1094611622 12:32000380-32000402 CACTCTCTCGCCCAGGCTGGAGG - Intergenic
1094634852 12:32215919-32215941 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1094647231 12:32337610-32337632 CGCCCTGACCCAGAGGCTGGAGG + Exonic
1095376314 12:41533205-41533227 CGCTCTGTCCCCCAGGCTGGAGG + Intronic
1096062987 12:48717396-48717418 CGCTTTCTCACCCAGGCTGGAGG - Intergenic
1096064858 12:48731456-48731478 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1096093304 12:48917429-48917451 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1096180231 12:49546652-49546674 GGAGCTGTCCCGGAGGCTGGGGG - Intronic
1096281718 12:50261083-50261105 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1096645511 12:53032398-53032420 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1096788405 12:54030851-54030873 AGCTCTCACCCTGAGGCCGGCGG - Intronic
1097286130 12:57878944-57878966 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1097390278 12:59003642-59003664 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1097990039 12:65824759-65824781 CTCTCTCTCTCGCAGGGTGGGGG + Exonic
1098020495 12:66150445-66150467 CACTCTGTCACTGAGGCTGGAGG + Intronic
1098246836 12:68528490-68528512 CACTCTCTCACCCAGGCTGGAGG - Intergenic
1098388675 12:69945952-69945974 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1098417886 12:70257391-70257413 CGCTCTTTCGCCCAGGCTGGAGG + Intronic
1098517823 12:71398651-71398673 CGCTCTTTCACCCAGGCTGGAGG + Intronic
1098762734 12:74445739-74445761 CGCTTGGTCCCGGGGGCTGGAGG + Intergenic
1098862360 12:75724413-75724435 CGCTCTGTCCCCCAGGCTGGAGG + Intergenic
1098981714 12:76963214-76963236 GGCTCTCTCTCTGGGGCTGGTGG + Intergenic
1099057012 12:77855092-77855114 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1099393929 12:82115108-82115130 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1099446214 12:82754702-82754724 TGCTCTGTCCCCCAGGCTGGAGG - Intronic
1100323411 12:93518369-93518391 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1101064666 12:101007315-101007337 TACTCTCTCCCCCAGGCTGGAGG - Intronic
1101091975 12:101296536-101296558 CGCTCTGTCGTGCAGGCTGGAGG - Intronic
1101124661 12:101619448-101619470 AGCTCTCTGCCAGATGCTGGAGG - Intronic
1101132096 12:101699418-101699440 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1101230408 12:102735296-102735318 TGCTCTGTCCCCCAGGCTGGAGG - Intergenic
1101687535 12:107040316-107040338 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1101716560 12:107318136-107318158 CGCATTCTCCCGGAGGGTGGTGG - Intergenic
1101939792 12:109091351-109091373 CGCTCTGTCACCTAGGCTGGAGG - Intronic
1102020499 12:109678964-109678986 TGCTCTATCCCGGGGGCTGCGGG - Intergenic
1102074520 12:110049133-110049155 TGCTCTGTCCCAGAGACTGGGGG + Intronic
1102248281 12:111368817-111368839 CGCGCTCTCCAGGTGGCCGGGGG + Intronic
1102376706 12:112427511-112427533 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1103653820 12:122454756-122454778 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1103864139 12:124037998-124038020 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1104007905 12:124907536-124907558 CGCTCTGTCACTCAGGCTGGAGG + Intergenic
1104197583 12:126555740-126555762 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1104444448 12:128822580-128822602 CGCTCTGTCGCTCAGGCTGGAGG + Intronic
1105016726 12:132790299-132790321 CGCTCTGTACCCCAGGCTGGAGG - Intronic
1105203194 13:18195915-18195937 CGCTCTGTCTCCAAGGCTGGAGG + Intergenic
1105309999 13:19198133-19198155 CACTCTGTCCCCCAGGCTGGAGG - Intergenic
1105449135 13:20483360-20483382 CACTCTGTCGCGCAGGCTGGAGG + Intronic
1105511987 13:21059930-21059952 CGCTCTGTCTCCCAGGCTGGAGG - Intronic
1105801994 13:23914286-23914308 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1105813560 13:24014085-24014107 CTCGCTGTCCTGGAGGCTGGAGG + Intronic
1105891684 13:24686704-24686726 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1106241408 13:27916497-27916519 CGCTCTGTCTCCCAGGCTGGAGG + Intergenic
1106270702 13:28150602-28150624 CGCTCTGTCGCCTAGGCTGGAGG - Intronic
1106568337 13:30906045-30906067 CGGACACTGCCGGAGGCTGGAGG - Intergenic
1106747216 13:32718181-32718203 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1106904542 13:34391429-34391451 CACTCTCTCCCCCAGGCTGTAGG + Intergenic
1107524427 13:41215548-41215570 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1107946729 13:45425723-45425745 CGCTGTATCCCCCAGGCTGGAGG + Intergenic
1108042979 13:46356734-46356756 TGCTCTGTCACGCAGGCTGGAGG + Intronic
1108445003 13:50499234-50499256 CGCTCTGTCTCCCAGGCTGGAGG - Intronic
1108487246 13:50939322-50939344 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1109518589 13:63477639-63477661 CGCTCTGTCGCACAGGCTGGAGG + Intergenic
1109959406 13:69611236-69611258 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1110594427 13:77303298-77303320 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1110956151 13:81554683-81554705 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1111122070 13:83866238-83866260 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1111580274 13:90213841-90213863 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1111953258 13:94728208-94728230 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1112422386 13:99264322-99264344 TTCTCTGTCCCAGAGGCTGGTGG - Intronic
1112544014 13:100346904-100346926 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1112787927 13:102971635-102971657 CGCTCTGTCTCCCAGGCTGGAGG - Intergenic
1112880175 13:104097634-104097656 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1112949201 13:104969903-104969925 CGCTCTTTCACCCAGGCTGGAGG - Intergenic
1113010823 13:105763637-105763659 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1113071046 13:106422016-106422038 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1113097976 13:106686862-106686884 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1113153250 13:107288250-107288272 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1113168262 13:107468013-107468035 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1113284584 13:108832173-108832195 CGCTCTATCGCCCAGGCTGGAGG + Intronic
1113706254 13:112434602-112434624 TGCCCTGTTCCGGAGGCTGGTGG - Exonic
1113842745 13:113369663-113369685 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1114296102 14:21330634-21330656 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1114619828 14:24088836-24088858 TGCTCTGTCCCCCAGGCTGGAGG + Intronic
1114775262 14:25474104-25474126 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1115268642 14:31527339-31527361 CCCTTACTGCCGGAGGCTGGCGG + Intronic
1115345246 14:32335870-32335892 CTCTCTCTCCAGGAGGCCAGAGG + Intronic
1115573251 14:34686870-34686892 TGCTCTGTCCCCCAGGCTGGAGG + Intergenic
1115914725 14:38299256-38299278 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1115939285 14:38590542-38590564 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1116076207 14:40114419-40114441 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1116695484 14:48170268-48170290 CGCTCTCTCACCTAGGCTGGAGG + Intergenic
1116817359 14:49596808-49596830 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1116916304 14:50529352-50529374 CGCTCTGTCCCCCAGGCTAGAGG - Intronic
1117055550 14:51908600-51908622 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1117124969 14:52613212-52613234 CACTCTGTCCCCCAGGCTGGAGG - Intronic
1117454460 14:55883721-55883743 CGCTCTTTCACCCAGGCTGGAGG + Intergenic
1117835457 14:59800431-59800453 CACTCTGTCCCCCAGGCTGGAGG + Intronic
1118245547 14:64106614-64106636 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1118269869 14:64332902-64332924 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1119787334 14:77323377-77323399 TGCTCTGTCCCCCAGGCTGGAGG + Intronic
1120099243 14:80425083-80425105 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1120962708 14:90139927-90139949 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1121060486 14:90903977-90903999 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1121197595 14:92088099-92088121 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1121203106 14:92137247-92137269 CACTCTGTCACCGAGGCTGGAGG + Intronic
1121357653 14:93229533-93229555 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1121470914 14:94153673-94153695 CACTCTGTCACGCAGGCTGGAGG - Intronic
1121533627 14:94676222-94676244 CGCTCTCTCACCCAGGCTGGAGG + Intergenic
1122868968 14:104625694-104625716 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1122964338 14:105114858-105114880 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1123433052 15:20234614-20234636 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1123875559 15:24620777-24620799 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1123990818 15:25682019-25682041 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1124087847 15:26568528-26568550 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1124442424 15:29696772-29696794 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1124586621 15:31015377-31015399 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1124640729 15:31394452-31394474 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1124725171 15:32150082-32150104 CGCTCTGTCTCCTAGGCTGGAGG + Intronic
1124999399 15:34754852-34754874 CGCTCTCCGCCGCAGGTTGGGGG + Exonic
1125139091 15:36382886-36382908 CGCTCTTTCACCCAGGCTGGAGG + Intergenic
1125516232 15:40322969-40322991 GGCTCTGTCCCGGAGGCTCAGGG + Intergenic
1125565213 15:40672270-40672292 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1125813011 15:42558351-42558373 TGCTCTGTCACGCAGGCTGGAGG + Intronic
1125830556 15:42714093-42714115 TGCTCTGTCCCCCAGGCTGGAGG + Intronic
1126023190 15:44422113-44422135 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1126498911 15:49322922-49322944 TGCTCTGTCCCACAGGCTGGAGG - Intronic
1126985022 15:54296231-54296253 CGCTCTATCCCCCAGGCTGGAGG + Intronic
1127490911 15:59462168-59462190 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1127589918 15:60412587-60412609 CACTCTGTCCCCCAGGCTGGAGG + Intergenic
1127591119 15:60424537-60424559 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1127939223 15:63676721-63676743 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1127986737 15:64078601-64078623 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1128449858 15:67799134-67799156 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1128596459 15:68956263-68956285 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1128973738 15:72132686-72132708 CACTCTATCCCCCAGGCTGGAGG + Intronic
1129338205 15:74866827-74866849 CGCTCTGTCATGCAGGCTGGGGG + Intronic
1129357276 15:74999559-74999581 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1129370914 15:75094368-75094390 CGCTCTGTTGCCGAGGCTGGAGG + Intronic
1129870338 15:78936213-78936235 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1130071440 15:80649733-80649755 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1130213595 15:81948314-81948336 CGCTCTGTCTCCCAGGCTGGAGG - Intergenic
1130231685 15:82102081-82102103 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1131107669 15:89745729-89745751 CGCTCTTTCGCCCAGGCTGGAGG - Intergenic
1131186393 15:90278264-90278286 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1131216506 15:90540738-90540760 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1131247355 15:90806476-90806498 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1131891040 15:96971576-96971598 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1132476497 16:141608-141630 CGCTCTATCACCCAGGCTGGAGG + Intergenic
1132596780 16:755093-755115 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1132640062 16:973975-973997 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1132759386 16:1501464-1501486 CGCCGTCACCCGCAGGCTGGGGG - Exonic
1132999708 16:2842704-2842726 CGCGCTCTTCCGGAGGTTGAGGG + Intergenic
1133037618 16:3043043-3043065 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1133273217 16:4621321-4621343 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1133739239 16:8639389-8639411 CTTTCTCTCCCGGACACTGGCGG + Intronic
1133807459 16:9136473-9136495 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1134072132 16:11266878-11266900 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1134368374 16:13600454-13600476 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1134633798 16:15777153-15777175 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1134662941 16:15997844-15997866 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1135100486 16:19600960-19600982 TGCTCTCTCACCCAGGCTGGAGG + Intronic
1135540772 16:23328826-23328848 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1135557507 16:23449328-23449350 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1135728923 16:24878120-24878142 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1135753683 16:25078055-25078077 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1135936553 16:26785522-26785544 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1136015555 16:27398342-27398364 CGCTCTGTCTCCCAGGCTGGAGG + Intergenic
1136052175 16:27659475-27659497 TGCTCTGTCCCCCAGGCTGGAGG - Intronic
1136146962 16:28321501-28321523 CCCTCCCTTCTGGAGGCTGGAGG + Exonic
1136360582 16:29776774-29776796 TGCTCTATCCCTCAGGCTGGAGG - Intergenic
1136389504 16:29953601-29953623 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1136491619 16:30612235-30612257 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1136864262 16:33730522-33730544 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1137258408 16:46798481-46798503 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1137504906 16:49045871-49045893 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1137638189 16:50005854-50005876 CGCTCTGTCTCCCAGGCTGGAGG - Intergenic
1137706502 16:50539310-50539332 CGCTGGCTCACGGAGGCAGGGGG - Intergenic
1137824268 16:51476989-51477011 CGCTCTGTCACCCAGGCTGGCGG + Intergenic
1137918842 16:52465045-52465067 CGCTCTGTCTCCCAGGCTGGAGG + Intronic
1138406025 16:56794893-56794915 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1138468813 16:57214993-57215015 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1138500117 16:57436258-57436280 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1138639591 16:58373726-58373748 GGCTCTCTCCTGCAGGCTGCAGG + Intronic
1138821223 16:60262198-60262220 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1139125099 16:64068469-64068491 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1139146438 16:64330917-64330939 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1139293908 16:65883115-65883137 TGCTCTGTCACGCAGGCTGGAGG - Intergenic
1139552140 16:67679852-67679874 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1139756686 16:69149516-69149538 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1139933545 16:70549890-70549912 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1140242797 16:73218734-73218756 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1140380378 16:74481815-74481837 CGCTCTGTCTCCCAGGCTGGAGG + Intronic
1140381556 16:74492784-74492806 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1140471118 16:75215281-75215303 CGCTCTGTCGCCTAGGCTGGAGG - Intergenic
1140554160 16:75901499-75901521 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1140558927 16:75954688-75954710 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1140727262 16:77824721-77824743 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1140750992 16:78023788-78023810 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1141175267 16:81714325-81714347 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1141652288 16:85399457-85399479 CGTTCTCTTCCTGAAGCTGGTGG - Intergenic
1141718594 16:85741819-85741841 GGCCCTGTCCTGGAGGCTGGTGG - Intronic
1142045115 16:87920343-87920365 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1142333649 16:89472550-89472572 TGCTCTGTCCCCCAGGCTGGAGG + Intronic
1142348088 16:89566629-89566651 CGCTCTGTCATGCAGGCTGGAGG - Exonic
1142400279 16:89854969-89854991 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1142568610 17:857291-857313 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1142706293 17:1696810-1696832 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1142738613 17:1917516-1917538 CGCTCTCCCCAGGTGCCTGGAGG - Intergenic
1142885981 17:2912277-2912299 CCCTCTCTCCCTGGGGTTGGGGG + Intronic
1143283352 17:5771352-5771374 CCCTCACTGCCGGGGGCTGGCGG - Intergenic
1143297059 17:5879118-5879140 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1143550129 17:7625542-7625564 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1143937432 17:10501403-10501425 TGATCTCTCCCGGGAGCTGGAGG - Exonic
1144479918 17:15620912-15620934 TGCTCTATCCCCCAGGCTGGAGG + Intronic
1144518255 17:15935897-15935919 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1144567543 17:16372600-16372622 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1144624900 17:16839575-16839597 CTCTCTCTCCTGGTGCCTGGAGG - Intergenic
1144881530 17:18433146-18433168 CTCTCTCTCCTGGTGCCTGGAGG + Intergenic
1144918383 17:18742830-18742852 CGCTCTATCCCCCAGGCTGGAGG - Intergenic
1145073848 17:19835177-19835199 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1145150703 17:20511240-20511262 CTCTCTCTCCTGGTGCCTGGAGG - Intergenic
1145707506 17:26936415-26936437 CACTCTCTCACCCAGGCTGGAGG - Intergenic
1145708013 17:26939844-26939866 CACTCTCTCACCCAGGCTGGAGG - Intergenic
1146000100 17:29125833-29125855 CGCCCTCTTCCTGAGGCTGGCGG - Intronic
1146326663 17:31891988-31892010 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1146858542 17:36275970-36275992 CGCTCTGTCACCCAGGCTGGGGG + Intronic
1146992514 17:37287708-37287730 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1146996026 17:37321713-37321735 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1147088863 17:38080046-38080068 CGCTCTGTCACCCAGGCTGGGGG + Intergenic
1147108345 17:38240479-38240501 CGCTCTGTCACCCAGGCTGGGGG - Intergenic
1147131566 17:38412690-38412712 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1147960664 17:44165697-44165719 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1147989691 17:44325101-44325123 CGCTCTGTCGCCGAGGCTGGAGG + Intergenic
1148084036 17:44983683-44983705 CACTCTCACTCTGAGGCTGGAGG - Intergenic
1148204286 17:45769770-45769792 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1148225466 17:45895632-45895654 CGCTCCCTGCCGGAGGCGCGGGG + Intronic
1148257039 17:46143769-46143791 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1148261348 17:46186349-46186371 CGCTCTGTGCCCCAGGCTGGAGG - Intronic
1148421052 17:47547377-47547399 CGCTCTGTCACCCAGGCTGGGGG + Intronic
1148641019 17:49187660-49187682 CACTCTCTCTCCCAGGCTGGAGG + Intergenic
1148660831 17:49331152-49331174 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1149103797 17:52937622-52937644 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1149190590 17:54056831-54056853 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1149528528 17:57376951-57376973 CGCTCTGTCCCCCAGGCTGGAGG + Intronic
1149556439 17:57576718-57576740 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1149767276 17:59289722-59289744 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1149932630 17:60770878-60770900 CACTCTGTCACGCAGGCTGGAGG + Intronic
1149949801 17:60973623-60973645 TGCTCTGTCCCCCAGGCTGGAGG + Intronic
1150320263 17:64207766-64207788 CGCTCTGTCACTCAGGCTGGAGG + Intronic
1150327027 17:64265442-64265464 CTCTCTCTCCCTGAGGCAGGGGG - Intergenic
1150360613 17:64530350-64530372 CGCACTCTCGCCCAGGCTGGAGG - Intronic
1150705263 17:67481173-67481195 CGCTCTGTCGCCTAGGCTGGAGG - Intronic
1150803255 17:68298560-68298582 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1150826090 17:68476702-68476724 CGCTCTGTCACCTAGGCTGGAGG + Intergenic
1150902146 17:69292074-69292096 TGCTCTGTCCCCCAGGCTGGAGG - Intronic
1150993768 17:70291987-70292009 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1151171737 17:72252164-72252186 CACTCTCTCACCCAGGCTGGAGG - Intergenic
1151671204 17:75572630-75572652 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1151675631 17:75595958-75595980 CGTGCCCTCCCTGAGGCTGGTGG + Intergenic
1151967618 17:77439651-77439673 CTTTCTGTCCTGGAGGCTGGTGG + Intronic
1152043560 17:77920822-77920844 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1152373489 17:79905283-79905305 TGTTCTTTCCCGGAGGCTGTAGG + Intergenic
1152389152 17:79992475-79992497 CGGTCTCTCTCCGAGCCTGGCGG - Intronic
1152402183 17:80073726-80073748 CACTCTGTCCCCCAGGCTGGAGG + Intronic
1152426779 17:80222341-80222363 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1152686973 17:81699032-81699054 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1152746472 17:82042328-82042350 CGCTCTATCACCCAGGCTGGAGG - Intergenic
1152752173 17:82067797-82067819 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1152865485 17:82720131-82720153 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1152969625 18:149194-149216 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1153044639 18:844562-844584 CGCTCTGTCACGCAGACTGGAGG + Intergenic
1153070369 18:1098332-1098354 CCCTCACTGCCCGAGGCTGGCGG - Intergenic
1153254287 18:3155252-3155274 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1153346658 18:4033770-4033792 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1153395433 18:4615205-4615227 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1153450037 18:5216925-5216947 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1153574634 18:6508320-6508342 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1153792109 18:8587967-8587989 CGCTCTGTCTCCCAGGCTGGAGG + Intergenic
1153944087 18:10003555-10003577 CCCTCTCTCCCAGAGGATAGAGG + Intergenic
1154139310 18:11809223-11809245 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1154238993 18:12634213-12634235 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1154469021 18:14680097-14680119 CGCTCTGTAGCTGAGGCTGGAGG - Intergenic
1155288470 18:24316226-24316248 CGCTCTGTCTCCCAGGCTGGAGG - Intronic
1155431601 18:25765330-25765352 CGCTCTCTCACCCAGGCTGGAGG + Intergenic
1156665324 18:39398601-39398623 CACTCTGTCACGCAGGCTGGAGG + Intergenic
1156689648 18:39692088-39692110 CGCTCTGTCGCCAAGGCTGGAGG - Intergenic
1157220226 18:45824237-45824259 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1157916698 18:51670463-51670485 CGCTCTGTCGCCCAGGCTGGCGG - Intergenic
1158187314 18:54785132-54785154 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1158210708 18:55046769-55046791 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1158315574 18:56208515-56208537 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1158377081 18:56883175-56883197 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1158459753 18:57635854-57635876 TGCTCTGTCCCCCAGGCTGGAGG + Intergenic
1158480452 18:57817120-57817142 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1159452652 18:68622171-68622193 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1159528644 18:69627479-69627501 CGCTTTGTCCCCCAGGCTGGAGG + Intronic
1159728390 18:71993204-71993226 CGCTCTGTCACTCAGGCTGGAGG + Intergenic
1159964343 18:74580934-74580956 CACTCTGTCCCCCAGGCTGGAGG - Intronic
1159979726 18:74763740-74763762 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1160625199 18:80199673-80199695 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1160672087 19:370372-370394 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1160730028 19:637587-637609 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1160746973 19:716375-716397 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1160877111 19:1301760-1301782 CGCTCTGTTGCCGAGGCTGGAGG - Intergenic
1160928793 19:1560055-1560077 AGCTGCCTCCCTGAGGCTGGAGG + Intronic
1161000231 19:1907152-1907174 CACTCTGTCCCCCAGGCTGGAGG - Intronic
1161106675 19:2447109-2447131 CGCTCTGTCTCCCAGGCTGGAGG - Intronic
1161142838 19:2659000-2659022 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1161159424 19:2753629-2753651 CGCTCTGTTCCCCAGGCTGGAGG + Intergenic
1161199612 19:3007118-3007140 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1161260286 19:3333987-3334009 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1161312549 19:3603001-3603023 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1161355343 19:3816276-3816298 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1161404867 19:4085778-4085800 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1161476008 19:4485707-4485729 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1161481904 19:4515141-4515163 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1161806767 19:6448501-6448523 CGCTCTCTCACCCAGGGTGGAGG + Intronic
1161941068 19:7404490-7404512 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1161983234 19:7641335-7641357 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1161985703 19:7652581-7652603 CGCTTTCTCACCCAGGCTGGAGG - Intergenic
1161990151 19:7680235-7680257 CGCTCTATCACCCAGGCTGGAGG + Intronic
1162008837 19:7798939-7798961 TGCTCTGTCCCCCAGGCTGGAGG + Intergenic
1162022242 19:7873269-7873291 TCCCCTCTCCCAGAGGCTGGGGG + Exonic
1162229521 19:9254694-9254716 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1162316761 19:9943860-9943882 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1162363979 19:10236824-10236846 CGCTCTGTCACTCAGGCTGGAGG + Intergenic
1162420252 19:10562079-10562101 CGCTCTATCCCTCAGGCTGGAGG + Intronic
1162458320 19:10799192-10799214 CGCTCTGTCTCCCAGGCTGGAGG - Intronic
1162475097 19:10895135-10895157 CGCTCTATCACCCAGGCTGGAGG + Intronic
1162537923 19:11274948-11274970 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1162540500 19:11293113-11293135 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1162681195 19:12343162-12343184 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1162772499 19:12957597-12957619 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1162812990 19:13175846-13175868 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1162995735 19:14333811-14333833 CCCCTTGTCCCGGAGGCTGGAGG + Intergenic
1163225619 19:15958939-15958961 CACTCTCTCTCCCAGGCTGGAGG - Intergenic
1163265168 19:16216410-16216432 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1163271599 19:16257929-16257951 CTCTGTCTCCCTGAGACTGGGGG + Intergenic
1163339370 19:16694952-16694974 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1163508872 19:17723820-17723842 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1163527889 19:17832226-17832248 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1163743533 19:19031668-19031690 CGCTCTGTCCCCCAGTCTGGAGG - Intronic
1163851239 19:19664743-19664765 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1164188007 19:22889049-22889071 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1164949872 19:32328188-32328210 CGCTCTTTCGCCCAGGCTGGAGG - Intergenic
1165025960 19:32961544-32961566 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1165047396 19:33116560-33116582 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1165048735 19:33127481-33127503 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1165058571 19:33194287-33194309 CGCCCGCGCCCGGAGCCTGGAGG - Intronic
1165156249 19:33790470-33790492 CACTCTCCCCCCCAGGCTGGAGG - Intergenic
1165333626 19:35154766-35154788 CCCTCTCTCCACGAGGCTGCCGG + Exonic
1165393340 19:35550636-35550658 CCCTCTCTCTCCCAGGCTGGTGG - Exonic
1165429069 19:35761826-35761848 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1165430636 19:35769935-35769957 TGCTCTGTCCCCCAGGCTGGAGG + Intronic
1165502643 19:36202332-36202354 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1165556026 19:36633070-36633092 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1165751189 19:38261305-38261327 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1165879781 19:39033933-39033955 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1165959734 19:39523971-39523993 CGCTTTGTCCCCCAGGCTGGAGG - Intergenic
1166525892 19:43509462-43509484 CGCTCTATCTCCCAGGCTGGAGG - Intronic
1166562587 19:43743040-43743062 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1166667711 19:44691072-44691094 TGCTCTGTCCCACAGGCTGGAGG - Intergenic
1166694347 19:44844365-44844387 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1166827560 19:45618912-45618934 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1166959768 19:46490311-46490333 TGCTCCCTCCCGAGGGCTGGAGG - Intronic
1167173598 19:47850039-47850061 CGCTCTGTCGCACAGGCTGGAGG - Intergenic
1167173839 19:47851856-47851878 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1167267398 19:48490490-48490512 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1167438575 19:49494782-49494804 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1167497129 19:49826305-49826327 CGCTCTGTCTCCCAGGCTGGAGG - Intronic
1167713508 19:51126138-51126160 AGCTCCCTCCCTGGGGCTGGAGG + Intronic
1167897454 19:52593418-52593440 CGCTCCCTCCGGGAGGGAGGTGG - Intergenic
1167921015 19:52783392-52783414 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1167934307 19:52893849-52893871 CGCTGTGTCCCCCAGGCTGGAGG - Exonic
1167960530 19:53101245-53101267 CGCTCTTTCACCCAGGCTGGAGG - Intronic
1168020454 19:53605407-53605429 CGCTCTGTCGCTCAGGCTGGAGG + Intergenic
1168219688 19:54951781-54951803 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1168406608 19:56113860-56113882 CGCTTTCTCGCCCAGGCTGGAGG + Intronic
1168472790 19:56652879-56652901 AGCTCTCCCCTGGAGGCTAGGGG - Intronic
1168569821 19:57457179-57457201 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1168613433 19:57819246-57819268 TGCTCTGTCGCGCAGGCTGGAGG + Intronic
1168625842 19:57917068-57917090 TGCTCTGTCGCGCAGGCTGGAGG - Intergenic
1168690115 19:58371373-58371395 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
925017952 2:546023-546045 GGCTCTCACCAGGAGCCTGGAGG - Intergenic
926148381 2:10410969-10410991 AGCTCTCTCCTGGAGGCTGTCGG - Intronic
926706459 2:15841183-15841205 CACTGTCACCCGGAGGCTGTAGG + Intergenic
927900586 2:26815593-26815615 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
928319809 2:30274150-30274172 CGCTCTCTTGCCCAGGCTGGAGG + Intronic
928584195 2:32741617-32741639 CGCTCTGTCACCCAGGCTGGAGG - Intronic
929065427 2:37968404-37968426 CGCTCTGTCACCCAGGCTGGAGG - Intronic
929147329 2:38718230-38718252 CCCTCTCTCGCCCAGGCTGGAGG + Intronic
929153221 2:38766828-38766850 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
929192017 2:39148728-39148750 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
929499154 2:42475356-42475378 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
929838300 2:45428517-45428539 CGTTCTGTCGCCGAGGCTGGAGG - Intronic
930056431 2:47255601-47255623 CGCTCTGTCTCCCAGGCTGGAGG - Intergenic
930109682 2:47667899-47667921 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
930116618 2:47723606-47723628 CACTCTATCACTGAGGCTGGAGG + Intronic
930221034 2:48747120-48747142 CGCTCTGTTGCAGAGGCTGGAGG + Intronic
930640172 2:53846414-53846436 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
930658997 2:54035296-54035318 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
930689797 2:54349879-54349901 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
931300232 2:60972435-60972457 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
931313736 2:61106356-61106378 CGCTCTGTCACCCAGGCTGGAGG - Intronic
931423317 2:62148354-62148376 CGCTCTATCGCCCAGGCTGGAGG + Intergenic
931440482 2:62286994-62287016 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
931686579 2:64799376-64799398 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
931712230 2:64998202-64998224 CGCTCTGTCTCCCAGGCTGGAGG - Intronic
931980353 2:67687769-67687791 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
932234174 2:70107955-70107977 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
932676527 2:73786344-73786366 CGCTCTGTCGCCTAGGCTGGAGG - Intronic
932677112 2:73791242-73791264 CGCTCTGTCGCCTAGGCTGGAGG - Intronic
932677697 2:73796139-73796161 CGCTCTGTCGCCTAGGCTGGAGG - Intronic
932678283 2:73801037-73801059 CGCTCTGTCGCCTAGGCTGGAGG - Intronic
932678869 2:73805937-73805959 CGCTCTGTCGCCTAGGCTGGAGG - Intronic
932690642 2:73910180-73910202 CGCTCTGTCACACAGGCTGGAGG - Intronic
932704635 2:74013777-74013799 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
933332120 2:80906006-80906028 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
933771465 2:85747160-85747182 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
934522235 2:95026611-95026633 CGGTCTCTGCCTGAGGCTGCAGG + Intronic
934632481 2:95943449-95943471 CGCTCTGTCTCCCAGGCTGGAGG - Intronic
934801021 2:97159813-97159835 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
935238822 2:101160838-101160860 CGCTCTGTCACCCAGGCTGGAGG + Intronic
935505709 2:103899858-103899880 CGCTCTATCCCCCAGGCTGGAGG + Intergenic
936016456 2:108962640-108962662 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
936142417 2:109951866-109951888 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
936202271 2:110419605-110419627 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
936378182 2:111960446-111960468 CGCTCTGTCACTCAGGCTGGAGG - Intronic
936457026 2:112683005-112683027 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
936476643 2:112845460-112845482 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
936623517 2:114124317-114124339 CACTCTCTCACCCAGGCTGGAGG + Intergenic
936699027 2:114987834-114987856 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
936955957 2:118022595-118022617 CGCTCTGTACCCCAGGCTGGAGG + Intergenic
937446727 2:121964624-121964646 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
937899396 2:127006346-127006368 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
937904395 2:127045869-127045891 CGCTGGCTCCGGGAGGCTGGAGG + Intergenic
938057517 2:128227664-128227686 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
938415624 2:131101380-131101402 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
938786270 2:134632773-134632795 CGCTCTGTCACCCAGGCTGGAGG + Intronic
939322573 2:140642809-140642831 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
939575734 2:143892864-143892886 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
939929209 2:148211776-148211798 CGCTCTGTCACCCAGGCTGGAGG + Intronic
940700192 2:157030981-157031003 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
940735741 2:157450036-157450058 TGCTCTGTCGCCGAGGCTGGAGG + Intronic
940862324 2:158783521-158783543 CGCTCTATCGCACAGGCTGGAGG + Intergenic
940960182 2:159776735-159776757 CACTCTGTCGCCGAGGCTGGAGG + Intronic
941168264 2:162106517-162106539 CGCTCTGTCACACAGGCTGGAGG + Intergenic
941570838 2:167168645-167168667 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
941642395 2:168003014-168003036 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
941907703 2:170732815-170732837 TGCTCTGTCACTGAGGCTGGAGG - Intergenic
942156481 2:173133956-173133978 CGCTCTGTCACCCAGGCTGGAGG - Intronic
942294503 2:174504648-174504670 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
942502821 2:176609884-176609906 CGCTCTGTCCCCCAGGCTGGAGG + Intergenic
942788749 2:179733748-179733770 CGCTCTGTCACTCAGGCTGGAGG - Intronic
943019192 2:182552475-182552497 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
943520629 2:188944678-188944700 CCCTCACTGCCCGAGGCTGGCGG + Intergenic
943579731 2:189671316-189671338 CTCTCCCTCCCAGAGGTTGGTGG - Intergenic
943630732 2:190248826-190248848 CGCTCTGTCACCTAGGCTGGAGG - Intronic
944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG + Intergenic
944807445 2:203296229-203296251 CGCTCTGTCACCCAGGCTGGAGG - Intronic
945316655 2:208377600-208377622 CACCCTGTCCCGGAGGCAGGTGG - Intronic
945429230 2:209745573-209745595 TGCTCTGTCCCCGAGGCTGGAGG + Intergenic
945635573 2:212345231-212345253 TGCTCTGTCCCCCAGGCTGGAGG - Intronic
945727641 2:213492515-213492537 CGCTCTGTCGCCTAGGCTGGAGG - Intronic
945828968 2:214760223-214760245 CGCTCTGTCCCCCAGGTTGGAGG + Intronic
945930152 2:215846754-215846776 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
946286121 2:218704303-218704325 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
946380363 2:219344134-219344156 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
947389175 2:229622051-229622073 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
947737165 2:232461647-232461669 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
947805985 2:232968436-232968458 CGCTCTGTTGCGCAGGCTGGAGG + Intronic
948609652 2:239158732-239158754 CGCCCTCTCCTGGTGTCTGGAGG - Intronic
1168765823 20:381192-381214 CGGACTCGCCCGGAGGCCGGGGG + Intronic
1169156694 20:3336911-3336933 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1169220054 20:3817026-3817048 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1169220720 20:3820823-3820845 CGCGCTCTGCTGGCGGCTGGAGG + Intronic
1169579355 20:7001666-7001688 CGCTCTGTCCCCCAGGCTGGAGG + Intergenic
1169694939 20:8376893-8376915 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1169756891 20:9052551-9052573 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1169890847 20:10450782-10450804 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1170044532 20:12071481-12071503 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1170465535 20:16619241-16619263 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1170552490 20:17489744-17489766 CTCACTCTTCTGGAGGCTGGGGG + Intergenic
1170634440 20:18092525-18092547 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1170688431 20:18589316-18589338 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1171204074 20:23265785-23265807 CGCTCTGTCACCCAGGCTGGTGG + Intergenic
1171560387 20:26119308-26119330 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1171980789 20:31627237-31627259 CGCTCTGTCTCTCAGGCTGGAGG + Intergenic
1172125746 20:32624259-32624281 TCCTCTCTCCCCTAGGCTGGAGG + Intergenic
1172203700 20:33146731-33146753 CGCTCTGTCGCTCAGGCTGGAGG - Intergenic
1172234093 20:33358117-33358139 TGCTCTGTCCCCCAGGCTGGAGG + Intergenic
1172721320 20:37001102-37001124 CGCCCTGTCCCGGAGGGAGGCGG + Intronic
1172725572 20:37038332-37038354 CGCTCTTTCGCCCAGGCTGGAGG + Intronic
1172974314 20:38894833-38894855 CGTTCTCTCTAGGAGGCTGCAGG + Intronic
1173626087 20:44474064-44474086 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1173874926 20:46364322-46364344 GGCGCACTCCCAGAGGCTGGGGG - Intronic
1174225908 20:48999712-48999734 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1174276501 20:49408245-49408267 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1174448258 20:50604651-50604673 GTATCTCTCCCGGAAGCTGGGGG + Exonic
1174634250 20:51985581-51985603 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1174883841 20:54309759-54309781 CGCTCTATCACCCAGGCTGGAGG - Intergenic
1174947326 20:55002485-55002507 TGCTCTCTCACCCAGGCTGGAGG - Intergenic
1175035368 20:55995388-55995410 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1175100106 20:56573348-56573370 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1175174658 20:57103900-57103922 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1175321635 20:58092397-58092419 ACCTCTCTCCCAGTGGCTGGTGG - Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1175856512 20:62123247-62123269 CGGCGTCTCCCGAAGGCTGGGGG + Intronic
1176017018 20:62939083-62939105 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1176069417 20:63218302-63218324 CGGCCTCCACCGGAGGCTGGAGG - Intergenic
1176190299 20:63805786-63805808 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1176204571 20:63881325-63881347 CGCTCTGTCACTCAGGCTGGGGG - Intronic
1176295804 21:5071882-5071904 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1176380626 21:6110799-6110821 CGCCCCCTCCCGGGCGCTGGGGG - Intergenic
1176389001 21:6154128-6154150 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1176512356 21:7758509-7758531 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1176524669 21:7857198-7857220 CGCTCTGTCGCCAAGGCTGGAGG + Intergenic
1176650781 21:9545093-9545115 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1176947879 21:15005746-15005768 CCCTCTCTCCAGAATGCTGGTGG - Intronic
1177373029 21:20231255-20231277 TGCTCTCTTCCCTAGGCTGGAGG + Intergenic
1177605396 21:23370929-23370951 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1177614692 21:23501353-23501375 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1177775529 21:25562167-25562189 CGCTCCCTTCCCGAGGCTGCAGG - Intergenic
1177942784 21:27431775-27431797 TGCTCTCTCGCCCAGGCTGGAGG - Intergenic
1178258164 21:31074389-31074411 CGCTCTCCCCTGGAAGGTGGGGG - Intergenic
1178303218 21:31469797-31469819 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1178346135 21:31829814-31829836 CGCTCTATCACCCAGGCTGGAGG - Intergenic
1178351422 21:31874663-31874685 AGCTCCCACCCTGAGGCTGGAGG - Intronic
1178646468 21:34389033-34389055 CGCTCTGTCACCCAGGCTGGAGG - Exonic
1178658689 21:34487211-34487233 CGCTCTGTCGCCAAGGCTGGAGG + Intergenic
1179734471 21:43384120-43384142 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1179742846 21:43427441-43427463 CGCCCCCTCCCGGGCGCTGGGGG + Intergenic
1179839309 21:44060631-44060653 CACTCTGTCCCCCAGGCTGGAGG + Intronic
1179861243 21:44190242-44190264 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1179877069 21:44274045-44274067 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1180089279 21:45525517-45525539 CGCTCTCTGCCTGTGGCTGCCGG - Intronic
1180172184 21:46065301-46065323 CGGTGTCTCCCTGCGGCTGGTGG + Intergenic
1180222992 21:46371000-46371022 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1180297630 22:10958082-10958104 CGCTCTGTCACCTAGGCTGGAGG - Intergenic
1180603583 22:17037843-17037865 CGCTCTGTCTCCAAGGCTGGAGG + Intergenic
1180762232 22:18219621-18219643 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1180773435 22:18404987-18405009 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1180778319 22:18504331-18504353 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1180804786 22:18654536-18654558 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1180805958 22:18714874-18714896 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1180861006 22:19082722-19082744 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1181192533 22:21151920-21151942 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1181216908 22:21340655-21340677 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1181276674 22:21691653-21691675 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1181695822 22:24592408-24592430 CACTGTCTCCCGGATCCTGGAGG + Intronic
1182440416 22:30360470-30360492 CGCTCTGTCGCTCAGGCTGGAGG - Intronic
1182739856 22:32559795-32559817 CGCTCTGTCTCCCAGGCTGGAGG - Intronic
1183396292 22:37572732-37572754 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1183675368 22:39296290-39296312 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1184217334 22:43076421-43076443 CGCTCTGTCGCCGAGGCTGGAGG - Intronic
1184323774 22:43766066-43766088 CGCTCTGTCACGCAGGCTGGAGG + Intronic
1184338495 22:43870635-43870657 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1184705211 22:46207312-46207334 CGCTCTATCACCCAGGCTGGAGG + Intronic
1184760363 22:46540369-46540391 TGCTCTCTCACCTAGGCTGGAGG + Intergenic
1185035601 22:48475086-48475108 CTCTGCCTCCCGCAGGCTGGGGG + Intergenic
1185172714 22:49303156-49303178 TGCTCTCTCCTGGAGGATGGTGG + Intergenic
1185237021 22:49719943-49719965 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1185256820 22:49838546-49838568 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1203235265 22_KI270731v1_random:145969-145991 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1203291387 22_KI270735v1_random:42216-42238 CACTCTCTCACCCAGGCTGGAGG + Intergenic
949256272 3:2050078-2050100 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
949279405 3:2328371-2328393 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
949318306 3:2781755-2781777 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
949331953 3:2932853-2932875 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
949346760 3:3084017-3084039 CACTCTCTCACCCAGGCTGGAGG - Intronic
949499752 3:4668498-4668520 CGCTCTGTCACCCAGGCTGGAGG + Intronic
949536098 3:4997441-4997463 CACTCTGTCCCCCAGGCTGGAGG + Intergenic
949927288 3:9051744-9051766 CGCTCTGTCACCCAGGCTGGAGG + Intronic
950181653 3:10917852-10917874 GCCTCTCCCCCGGAGGCTGCCGG + Intronic
950513094 3:13445180-13445202 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
950638593 3:14333388-14333410 CTCTCTCTCCTGGACTCTGGTGG + Intergenic
951063963 3:18242580-18242602 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
951989883 3:28664618-28664640 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
952373077 3:32741734-32741756 CGCTCTGTCGCCCAGGCTGGGGG - Intronic
952461183 3:33527928-33527950 CGCTCTGTCACCCAGGCTGGGGG - Intronic
952642624 3:35615229-35615251 CACTCTGTCCCCCAGGCTGGAGG - Intergenic
952864627 3:37845133-37845155 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
953166462 3:40469463-40469485 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
953173621 3:40529653-40529675 CGCTCTGTCACCTAGGCTGGAGG + Intronic
953488824 3:43329403-43329425 CGCTCTGTCACCCAGGCTGGAGG - Intronic
953866153 3:46585057-46585079 CACCTTCTCCCAGAGGCTGGGGG - Intronic
954126340 3:48532275-48532297 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
954190066 3:48953434-48953456 CGCTCTGTCTCCCAGGCTGGAGG + Intronic
954250652 3:49364626-49364648 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
954340289 3:49948058-49948080 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
954356174 3:50084820-50084842 CGCTCCCTCCGGGAGGGAGGTGG - Intronic
954547814 3:51453917-51453939 CGCTCTGTCGTGCAGGCTGGAGG - Intronic
954621127 3:51996198-51996220 CGCTCTTCCACCGAGGCTGGAGG + Intergenic
954644609 3:52123304-52123326 CGCTCCCTGCTGGAGGCTGCTGG + Intronic
954938444 3:54348759-54348781 CGCTCTGTCACCCAGGCTGGAGG + Intronic
955587706 3:60499422-60499444 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
956700308 3:71953012-71953034 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
956947899 3:74244502-74244524 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
958979230 3:100701734-100701756 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
959217660 3:103473139-103473161 CGCTCTATCGCCCAGGCTGGAGG - Intergenic
959347767 3:105220709-105220731 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
959356834 3:105342675-105342697 CGCTCTGTCGCGCAGGCTGGAGG + Intergenic
959378213 3:105610774-105610796 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
959710287 3:109378723-109378745 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
960395981 3:117138151-117138173 CGCTCTGTCACCCAGGCTGGAGG + Intronic
960548719 3:118948937-118948959 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
960749837 3:120936640-120936662 CGCTCTGTCTCCCAGGCTGGAGG + Intronic
960966380 3:123107829-123107851 CGCTCTGTCACCCAGGCTGGAGG + Intronic
961036508 3:123646089-123646111 CACTCTGTCGCCGAGGCTGGAGG - Intronic
961447576 3:126988071-126988093 AGCTCCCTGCCTGAGGCTGGTGG - Intergenic
961932412 3:130547828-130547850 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
962093600 3:132270656-132270678 CACTCTGTCCCCCAGGCTGGAGG - Intronic
962788001 3:138785216-138785238 CGCCCTGTCCCGGAGGGAGGCGG + Intronic
963079550 3:141378144-141378166 CGCTCTGTCACCCAGGCTGGGGG - Intronic
963233899 3:142936840-142936862 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
963360751 3:144269306-144269328 CGCTCTGTTCCTTAGGCTGGAGG - Intergenic
964013797 3:151922304-151922326 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
964057494 3:152479206-152479228 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
964135221 3:153338233-153338255 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
964151494 3:153531300-153531322 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
964400808 3:156296504-156296526 CGCTCTGTAGCGCAGGCTGGAGG + Intronic
965149120 3:164947252-164947274 CTCTCTGTCACCGAGGCTGGAGG - Intergenic
965579501 3:170252179-170252201 CGCTCTGTCACCCAGGCTGGAGG - Intronic
965710339 3:171550459-171550481 CGCTCTGTCACTCAGGCTGGAGG - Intergenic
965826302 3:172734592-172734614 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
966287585 3:178315707-178315729 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
966412065 3:179654179-179654201 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
966794123 3:183697938-183697960 TGCTCTCTCGCGGCGGCCGGCGG + Exonic
966814736 3:183880846-183880868 CACTCTCTCACTCAGGCTGGAGG + Intronic
966979859 3:185122064-185122086 CGCTCTGTCACCCAGGCTGGAGG - Intronic
967469852 3:189848966-189848988 CTCTCCTTCCTGGAGGCTGGGGG - Intronic
967871226 3:194231546-194231568 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
968112598 3:196061520-196061542 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
968209246 3:196834218-196834240 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
968212706 3:196862187-196862209 CACTCTGTCCCCCAGGCTGGAGG + Intergenic
968316054 3:197726570-197726592 CGCTCTGTCACCCAGGCTGGAGG + Intronic
968316791 3:197731808-197731830 CGCCCTGTCCCGGAGGGAGGTGG - Intronic
968453807 4:687288-687310 GGCTCACTCCGGGAGGCAGGAGG + Intronic
968683039 4:1934813-1934835 CGCTCTGTCACCCAGGCTGGAGG - Intronic
968846759 4:3047276-3047298 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
968920747 4:3521176-3521198 CGCCCTTTCCTGGGGGCTGGGGG + Intronic
969243047 4:5914235-5914257 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
969264007 4:6052616-6052638 CGCTCTGTCACCCAGGCTGGAGG - Intronic
969396201 4:6923167-6923189 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
969677846 4:8624547-8624569 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
969678801 4:8630188-8630210 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
969679757 4:8635830-8635852 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
970018529 4:11539978-11540000 CGCTCTGTCTCCCAGGCTGGAGG - Intergenic
970292629 4:14591745-14591767 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
970392389 4:15627165-15627187 CGCTCTGTCACCCAGGCTGGAGG + Intronic
971320643 4:25603275-25603297 CACTCTGTCACGAAGGCTGGAGG + Intergenic
971325672 4:25641646-25641668 CGCTCTGTCACTCAGGCTGGAGG - Intergenic
971398391 4:26251813-26251835 CGCTCTGTCACCCAGGCTGGAGG - Intronic
972288432 4:37669339-37669361 CGCTCCCTCCGGGAGGGAGGTGG + Intronic
972393235 4:38632755-38632777 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
972552392 4:40146128-40146150 CGCTCTGTCACCCAGGCTGGAGG - Intronic
972563653 4:40250452-40250474 CGCTCTATCCCCCAGGCTGGAGG - Intergenic
972962394 4:44470215-44470237 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
973132814 4:46669818-46669840 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
973139387 4:46747334-46747356 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
973262872 4:48182250-48182272 CGCTCTGTCACCTAGGCTGGAGG - Intronic
973317876 4:48780251-48780273 CGCTCTCTCCCAGAGCCCGACGG + Exonic
974032052 4:56784819-56784841 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
974247279 4:59336129-59336151 CGCTCTATCGCCCAGGCTGGAGG + Intergenic
975485837 4:74933469-74933491 CGCACTCACCCGGAGGCGCGCGG - Intronic
975578647 4:75887586-75887608 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
975677206 4:76838872-76838894 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
975969947 4:80021115-80021137 CGCTCTGTCGCCCAGGCTGGGGG - Intronic
976181941 4:82407303-82407325 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
976748818 4:88433053-88433075 CGCTCTGTCACCCAGGCTGGAGG - Intronic
977078464 4:92489811-92489833 CGCTCTATCGCCCAGGCTGGAGG - Intronic
978152533 4:105454358-105454380 CGCTCTGTCGCCCAGGCTGGTGG + Intronic
978447661 4:108795598-108795620 CGCTCTGTCTCCTAGGCTGGAGG - Intergenic
978806258 4:112804049-112804071 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
979520673 4:121662994-121663016 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
979870666 4:125815785-125815807 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
979939926 4:126749652-126749674 CGCTCTGTCACCCAGGCTGGTGG + Intergenic
980234448 4:130087257-130087279 TGCTCTGTCACCGAGGCTGGAGG + Intergenic
980662562 4:135883112-135883134 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
980704671 4:136478206-136478228 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
980785579 4:137549954-137549976 CACTCCATCACGGAGGCTGGAGG - Intergenic
980854174 4:138419408-138419430 GTCTCTGTCCAGGAGGCTGGAGG - Intergenic
980932462 4:139194786-139194808 GGCTCTCTCGCAGAGGATGGTGG - Intergenic
981196270 4:141924856-141924878 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
981729944 4:147886801-147886823 CGCTCTGTCACCCAGGCTGGAGG + Intronic
982342236 4:154312514-154312536 CGCTCTGTTCCCCAGGCTGGAGG - Intronic
982392126 4:154876399-154876421 AGCTCTATCCTGGAAGCTGGGGG - Intergenic
982463323 4:155698641-155698663 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
982575019 4:157098638-157098660 CGCTCTGTCACCCAGGCTGGAGG + Intronic
982765873 4:159347752-159347774 CGCTCTTTCGCCCAGGCTGGAGG - Intronic
983095211 4:163552998-163553020 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
984075765 4:175177715-175177737 AGCTCTCTCACTCAGGCTGGAGG + Intergenic
984583931 4:181541350-181541372 CGCTCTGTCACCTAGGCTGGAGG - Intergenic
984904213 4:184611696-184611718 CTCTCTTCCCGGGAGGCTGGGGG + Intergenic
985135736 4:186784035-186784057 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
985658512 5:1144126-1144148 CGTCCTCTCCCTGAGGGTGGTGG - Intergenic
985836412 5:2275349-2275371 CTCTCTCTGCAGGAGGCTGTGGG - Intergenic
986000762 5:3628939-3628961 CTCACATTCCCGGAGGCTGGGGG - Intergenic
986281633 5:6327797-6327819 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
986289157 5:6385007-6385029 GCCTCTCTCCCGGCTGCTGGTGG + Intergenic
986321356 5:6634292-6634314 CGCTCTGTCACCCAGGCTGGAGG - Intronic
986493635 5:8319442-8319464 AGCTCACTCGCGGAGGCTGCTGG + Intergenic
986535328 5:8780804-8780826 CACTCTGTCTCTGAGGCTGGAGG + Intergenic
986923679 5:12718509-12718531 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
986953468 5:13120726-13120748 CACTCTCTCGCCCAGGCTGGAGG + Intergenic
987005406 5:13705022-13705044 CGCTCTGTCACCCAGGCTGGAGG + Intronic
987326271 5:16814173-16814195 CGCTCTGTCACCCAGGCTGGAGG + Intronic
987372070 5:17202671-17202693 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
987468932 5:18306867-18306889 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
987471866 5:18340706-18340728 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
987474550 5:18374802-18374824 CACTCTGTCACCGAGGCTGGAGG + Intergenic
987784256 5:22478383-22478405 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
988130276 5:27095692-27095714 CGCTCTGTCGCCCAGGCTGGTGG + Intronic
988155656 5:27446645-27446667 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
988185778 5:27859951-27859973 CGCTCTGTCCCCCAGGCTGGAGG + Intergenic
988243003 5:28637888-28637910 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
988358656 5:30207979-30208001 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
988373551 5:30404478-30404500 CGCTCTGTCTCCCAGGCTGGAGG + Intergenic
988523237 5:31964746-31964768 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
988733198 5:33994210-33994232 CGCTCTGTCACCCAGGCTGGAGG + Intronic
988787787 5:34580235-34580257 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
990247396 5:53876370-53876392 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
990421531 5:55640016-55640038 CGCTCTGTCACCCAGGCTGGAGG + Intronic
990481013 5:56210526-56210548 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
990548139 5:56844220-56844242 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
990562576 5:56997677-56997699 TGCTCTGTCACCGAGGCTGGAGG + Intergenic
990918780 5:60939528-60939550 CGCTCTGTCACCCAGGCTGGAGG + Intronic
990920190 5:60955945-60955967 CGCTCTGTCACTCAGGCTGGAGG + Intronic
991123426 5:63042944-63042966 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
991719346 5:69480974-69480996 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
991769658 5:70028518-70028540 CGCTCTGTCACCCAGGCTGGAGG - Intronic
991848953 5:70903936-70903958 CGCTCTGTCACCCAGGCTGGAGG - Intronic
992511706 5:77442857-77442879 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
992711499 5:79462165-79462187 CGCTCTGTCGCCCAGGCTGGGGG - Intronic
993025288 5:82638219-82638241 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
993181934 5:84564074-84564096 CGCTCTATCACCCAGGCTGGAGG - Intergenic
993724527 5:91352700-91352722 TGCTCTCTCACCAAGGCTGGAGG - Intergenic
993878625 5:93338094-93338116 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
993992914 5:94681897-94681919 CACTCTGTCCCCCAGGCTGGAGG - Intronic
994157381 5:96519026-96519048 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
994421692 5:99532458-99532480 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
994658651 5:102626609-102626631 TGCTCTCTTCCCCAGGCTGGAGG - Intergenic
994759268 5:103833271-103833293 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
994939448 5:106302574-106302596 CGCTCTGTCACCCAGGCTGGTGG - Intergenic
995343168 5:111083022-111083044 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
995729016 5:115216170-115216192 CGCTCTGTCACACAGGCTGGAGG + Intronic
997460465 5:134048297-134048319 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
997478002 5:134159578-134159600 CGCTCTGTCACCCAGGCTGGAGG + Intronic
997936342 5:138114765-138114787 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
997958512 5:138299461-138299483 TGCTCTGTCCCCCAGGCTGGAGG - Intronic
997961815 5:138327897-138327919 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
998086798 5:139332954-139332976 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
998433368 5:142085570-142085592 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
998443123 5:142178737-142178759 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
998491075 5:142546982-142547004 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
998763731 5:145461331-145461353 CGCTCTGTCGCCCAGGCTGGGGG + Intergenic
999158181 5:149473394-149473416 TGCTCTGTCGCGAAGGCTGGAGG - Intergenic
999160889 5:149497864-149497886 CGCTCTGTCACCCAGGCTGGAGG + Intronic
999174970 5:149625671-149625693 TGCTCTCTCCCCGAGTCTCGGGG - Intronic
999344184 5:150800715-150800737 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
999394353 5:151217608-151217630 CCCTCTCTCCCAGATCCTGGTGG + Intronic
999978575 5:156936897-156936919 CGCTCTCTTACCCAGGCTGGAGG - Intronic
1000039581 5:157475163-157475185 GGCTCTGTCCCCCAGGCTGGAGG + Intronic
1000062204 5:157667704-157667726 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1000159449 5:158583288-158583310 CGCCCTGTCCGGGAGGCAGGTGG + Intergenic
1000592614 5:163176777-163176799 TGCTCTGTCCCCCAGGCTGGAGG + Intergenic
1000783247 5:165511212-165511234 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1001193134 5:169648834-169648856 TGCTCTCTCCTGGTGGGTGGAGG + Intronic
1001206819 5:169771311-169771333 CGCTCTGTCGCCCAGGCTGGTGG + Intronic
1001854429 5:174998795-174998817 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1002036717 5:176476663-176476685 CGCTCTGTCACCTAGGCTGGAGG + Intronic
1002350075 5:178577247-178577269 AGCCCTCTCCCTGCGGCTGGTGG + Intronic
1002592722 5:180302252-180302274 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1002670332 5:180861314-180861336 CGCCCTCTCTGGGACGCTGGAGG + Intergenic
1002926795 6:1609760-1609782 GGCCCGCTCCCGGAGGCCGGAGG - Intergenic
1003014340 6:2455987-2456009 TGCTCTCTCCAGCAGGGTGGGGG - Intergenic
1003382084 6:5634333-5634355 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1003945697 6:11073155-11073177 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1003977218 6:11355751-11355773 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1004105183 6:12660961-12660983 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1004115040 6:12758431-12758453 CGCTCTTTCACCCAGGCTGGAGG - Intronic
1004666096 6:17749991-17750013 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1005332048 6:24760158-24760180 CGCTCTGTCACTCAGGCTGGAGG - Intergenic
1005444446 6:25906904-25906926 CACTCTGTCGCCGAGGCTGGAGG + Intergenic
1005572139 6:27155811-27155833 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1005616126 6:27575017-27575039 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1005993667 6:30919149-30919171 CGCTCTGTCACCAAGGCTGGAGG + Intronic
1006097887 6:31667162-31667184 CACTCTGTCACCGAGGCTGGAGG + Intronic
1006191079 6:32209848-32209870 CGCTCTATCCCCCAGGCTGAAGG - Intronic
1006322158 6:33325823-33325845 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1007338542 6:41173053-41173075 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1007408155 6:41646579-41646601 AGCTCTCTTCCTGAGGCAGGGGG - Intronic
1007411593 6:41665955-41665977 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1007827224 6:44609762-44609784 CAGTCTCTCCCTGAGGCTAGAGG + Intergenic
1008328038 6:50209402-50209424 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1008505809 6:52228598-52228620 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1008604077 6:53123231-53123253 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1009966394 6:70583143-70583165 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1010029588 6:71259324-71259346 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1010078075 6:71824597-71824619 TGCTCTGTCCCCCAGGCTGGAGG - Intergenic
1010721163 6:79284621-79284643 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1010807715 6:80258598-80258620 CTCACTCTCCCGGTGCCTGGGGG - Intronic
1011023739 6:82843083-82843105 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1012396730 6:98806747-98806769 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1013119208 6:107126498-107126520 CGCTCTCTCTCCCAGTCTGGAGG + Intergenic
1013120909 6:107139749-107139771 CACTCTGTCACGCAGGCTGGAGG + Intergenic
1013198639 6:107868547-107868569 CGCTCTGTCCTCCAGGCTGGAGG - Exonic
1013271230 6:108547157-108547179 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1013538341 6:111083940-111083962 CTCTCTGTCCCCGAGGCTGGAGG - Intergenic
1013826554 6:114218028-114218050 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1013878770 6:114867462-114867484 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1014189385 6:118475384-118475406 CGCTCTGTCCCCCAGGCTGGAGG + Intronic
1014225488 6:118841865-118841887 CGCTCTGTCGCCTAGGCTGGAGG + Intronic
1015011345 6:128352219-128352241 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1016075622 6:139792664-139792686 CGCTCTGTCACTCAGGCTGGAGG + Intergenic
1016693783 6:146968949-146968971 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1016815290 6:148297795-148297817 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1017096340 6:150808717-150808739 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1017446266 6:154510012-154510034 CGCCCCATCCCCGAGGCTGGAGG + Intronic
1017495792 6:154982308-154982330 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1017578582 6:155834771-155834793 TGCTCTGTCCCCCAGGCTGGAGG + Intergenic
1018186500 6:161269610-161269632 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1018351927 6:162969012-162969034 CGCTCTGTTCCCCAGGCTGGAGG - Intronic
1018790359 6:167143516-167143538 CGCTTTCTCCTGAAGGCCGGAGG + Intergenic
1019320513 7:413373-413395 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1019387640 7:767204-767226 CGCTCTGTCGCCTAGGCTGGAGG - Intronic
1019392012 7:793827-793849 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1019394043 7:807147-807169 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1019465670 7:1187061-1187083 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1019504909 7:1385924-1385946 CGCTCAATCCCAGAGGCTGCAGG - Intergenic
1019665551 7:2250488-2250510 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1019667891 7:2261398-2261420 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1019720057 7:2563859-2563881 CGCTCTCTCACCCAGGCTGGAGG - Intronic
1019883508 7:3884111-3884133 CGCTGTGTCACGCAGGCTGGAGG + Intronic
1019996835 7:4729955-4729977 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1020204371 7:6104105-6104127 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1020289383 7:6711084-6711106 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1020410358 7:7885606-7885628 CACTCTGTCCCCCAGGCTGGAGG + Intronic
1020664735 7:11025760-11025782 CGCTCTGTCACCTAGGCTGGAGG - Intronic
1020951849 7:14689236-14689258 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1021687513 7:23201714-23201736 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1021728602 7:23574624-23574646 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1022974154 7:35542012-35542034 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1023083220 7:36545082-36545104 CGCTCTATCACCCAGGCTGGAGG + Intronic
1023140012 7:37092409-37092431 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1024290789 7:47802157-47802179 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1025032879 7:55572016-55572038 CGCGCTCACCCGCAGGGTGGGGG + Intronic
1025277454 7:57596043-57596065 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1025901952 7:65751581-65751603 AGTTATCTCCCGCAGGCTGGAGG - Intergenic
1026054713 7:66974271-66974293 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1026573563 7:71553292-71553314 TGCTCTGTCCCCCAGGCTGGAGG - Intronic
1026817397 7:73523033-73523055 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1026908347 7:74077332-74077354 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1026942804 7:74297442-74297464 TGCTCTGTCCCCCAGGCTGGAGG - Intronic
1027454684 7:78374870-78374892 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1028202132 7:87974269-87974291 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1028510244 7:91617620-91617642 CACTCTGTCCCCCAGGCTGGAGG + Intergenic
1029119707 7:98259145-98259167 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1029257580 7:99279902-99279924 CGCTGTGTCACGTAGGCTGGAGG + Intergenic
1029415487 7:100440575-100440597 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1029559784 7:101294988-101295010 CGCTCTGTCCCCCAGGCTGGAGG + Intergenic
1029626890 7:101725500-101725522 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1029685936 7:102147941-102147963 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1029690274 7:102176601-102176623 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1029853566 7:103489962-103489984 TCCCCTCTCCCAGAGGCTGGAGG - Intronic
1031601512 7:123716243-123716265 CGCTCTCTCACCCAGGGTGGAGG + Intronic
1031609398 7:123807465-123807487 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1031832304 7:126642605-126642627 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1031916366 7:127566515-127566537 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1032026620 7:128447614-128447636 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1032351894 7:131172171-131172193 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1032377050 7:131430892-131430914 TGCTCTGTCACCGAGGCTGGAGG - Intronic
1032849483 7:135782076-135782098 CGCTCTGTCACTCAGGCTGGAGG + Intergenic
1032849688 7:135783417-135783439 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1032972280 7:137178339-137178361 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1033039994 7:137909065-137909087 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1033080289 7:138290264-138290286 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1033082594 7:138312276-138312298 TGCTCTGTCCCTCAGGCTGGAGG - Intergenic
1033103422 7:138497431-138497453 CGCTCTGTCTCCCAGGCTGGAGG + Intronic
1033327921 7:140394639-140394661 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1033646171 7:143306287-143306309 CGCTCTGTCGCCCAGGCTGGAGG + Exonic
1033650333 7:143337857-143337879 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1033683453 7:143619172-143619194 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1033701160 7:143838466-143838488 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1033936864 7:146596558-146596580 CTCTCTTTCTTGGAGGCTGGGGG - Intronic
1033970133 7:147028994-147029016 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1033991021 7:147287269-147287291 CGCCATCTCCCGGGGGATGGTGG - Intronic
1034817316 7:154183684-154183706 CGTTCTCTCCATGAGGCTGTGGG - Intronic
1035388353 7:158489412-158489434 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1035396423 7:158538108-158538130 AGCTCTCTTCCGGACGCTGGCGG + Intronic
1035519261 8:263849-263871 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1035790461 8:2299109-2299131 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1035802344 8:2422596-2422618 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1035869030 8:3117101-3117123 CACTCTCTCGCCCAGGCTGGAGG + Intronic
1036383613 8:8258538-8258560 CGCTCTGTCTCCCAGGCTGGAGG + Intergenic
1037801433 8:22037938-22037960 CACTCTGTCACCGAGGCTGGAGG + Intergenic
1037825213 8:22156551-22156573 CGATCTCTCCCTGGGGCCGGCGG + Exonic
1038118324 8:24582550-24582572 CGCTCTGTCACCGAGGCTAGAGG - Intergenic
1038552817 8:28484622-28484644 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1038716850 8:29998898-29998920 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1038742104 8:30225053-30225075 CGCTCTGTCCGCCAGGCTGGAGG + Intergenic
1038930275 8:32186426-32186448 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1039068095 8:33626894-33626916 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1039486330 8:37912975-37912997 CTCTCTGTCCCCCAGGCTGGAGG + Intergenic
1039494030 8:37967372-37967394 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1039512093 8:38100338-38100360 CGCTCTGTCGCTCAGGCTGGAGG + Intergenic
1039515351 8:38128011-38128033 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1040571588 8:48616198-48616220 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1040886660 8:52270935-52270957 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1041422956 8:57689778-57689800 CGCTCTGTCCCCCAGCCTGGAGG - Intergenic
1041572944 8:59358349-59358371 CGCTCTGTCTCCCAGGCTGGAGG + Intergenic
1042291010 8:67169476-67169498 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1042302805 8:67303679-67303701 CACTCTGTCGCTGAGGCTGGAGG - Intronic
1042514083 8:69641709-69641731 CTCTCTGTCCCTCAGGCTGGAGG - Intronic
1042836132 8:73080480-73080502 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1043394771 8:79825820-79825842 GGCTCTCTTCCTGGGGCTGGAGG + Intergenic
1043529002 8:81129258-81129280 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1043886187 8:85603288-85603310 CACTGTTTCCCTGAGGCTGGGGG + Intergenic
1044022188 8:87118280-87118302 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1044076134 8:87823897-87823919 CGCTCTCTCACCCAGGCTGGAGG + Intergenic
1044275858 8:90298455-90298477 CTCCCTCTCCTGGAGGCTGCAGG - Intergenic
1044816258 8:96116483-96116505 GGCTCTGTCCCCCAGGCTGGAGG + Intergenic
1045208926 8:100074798-100074820 CGCTCTATCGCCCAGGCTGGAGG + Intronic
1045284444 8:100778316-100778338 CACTCTGTCACCGAGGCTGGAGG + Intergenic
1045362470 8:101445703-101445725 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1045527797 8:102956241-102956263 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1045834706 8:106506576-106506598 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1046164574 8:110415249-110415271 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1046177406 8:110596175-110596197 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1046207602 8:111021918-111021940 CGCTCTGTCCCCCAGGCTGGAGG - Intergenic
1046451031 8:114389907-114389929 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1046775971 8:118163840-118163862 CGCTCTGTCTCCCAGGCTGGAGG - Intergenic
1046929181 8:119825715-119825737 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1046944161 8:119959193-119959215 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1047870527 8:129077258-129077280 CTCCTTCTCCCGGAGGCAGGCGG + Intergenic
1047879477 8:129177783-129177805 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1047915923 8:129583703-129583725 TTCTCTCTACCAGAGGCTGGTGG - Intergenic
1048968431 8:139630420-139630442 GCCTCTCTCCCGGAGGATGCAGG + Intronic
1049016497 8:139923765-139923787 CGTTCTCTCCAGGAGGCTTTTGG - Intronic
1049057424 8:140249634-140249656 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1049460040 8:142722527-142722549 CTCTCTGACCAGGAGGCTGGTGG - Intergenic
1049533009 8:143165687-143165709 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1049759359 8:144325129-144325151 CCCTCTCTCCAGGAGGCAGGGGG - Intronic
1049958431 9:714390-714412 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1049997261 9:1045200-1045222 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1050473576 9:6018290-6018312 CGCTCTGTCACCTAGGCTGGAGG + Intergenic
1050850914 9:10285641-10285663 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1051360413 9:16277093-16277115 CACTTTCTCCCGGAGGCTGCAGG - Intergenic
1051390119 9:16555050-16555072 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1051445579 9:17135559-17135581 CGCTCGCGGCCGGGGGCTGGAGG + Intronic
1051614125 9:18991226-18991248 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1051664448 9:19455561-19455583 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1052196917 9:25728274-25728296 TGCTCTCTCACCCAGGCTGGAGG - Intergenic
1052376715 9:27725829-27725851 CGCTCTGTCACCGAGGCTGGAGG - Intergenic
1052484165 9:29074716-29074738 CGCTCTCTCGCCCAGGCTGGAGG + Intergenic
1053049752 9:34950317-34950339 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1053083459 9:35197238-35197260 CGCTCTCTCACCGAGGCTGGGGG + Intronic
1053658524 9:40245987-40246009 CACTCTGTCCCCCAGGCTGGAGG + Intronic
1053844027 9:42217993-42218015 CACTCTGTCCCCCAGGCTGGAGG + Intergenic
1053884876 9:42636514-42636536 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1053908896 9:42875255-42875277 CACTCTGTCCCCCAGGCTGGAGG + Intergenic
1054148811 9:61584252-61584274 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1054223898 9:62443965-62443987 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1054340414 9:63856214-63856236 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1054370643 9:64392261-64392283 CACTCTGTCCCCCAGGCTGGAGG + Intronic
1054526074 9:66130235-66130257 CACTCTGTCCCCCAGGCTGGAGG - Intronic
1054678274 9:67882010-67882032 CACTCTGTCCCCCAGGCTGGAGG + Intronic
1054764871 9:69035145-69035167 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1055198657 9:73628768-73628790 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1057025035 9:91728461-91728483 CGCTCTATCTCCTAGGCTGGAGG + Intronic
1057622039 9:96644929-96644951 CACTCTCTCACCCAGGCTGGAGG + Intronic
1057626664 9:96684240-96684262 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1057717720 9:97508219-97508241 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1057940797 9:99281974-99281996 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1058088846 9:100781402-100781424 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1058430720 9:104916710-104916732 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1058439593 9:104994549-104994571 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1058703477 9:107620052-107620074 ATCTCTCTCCAGGAGGCTGTGGG + Intergenic
1058887456 9:109332188-109332210 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1058905598 9:109480204-109480226 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1058937171 9:109780174-109780196 CGCGCCCTCCCGGCGGCTGCCGG + Intronic
1059135699 9:111803841-111803863 CGCTTTGTCCCCCAGGCTGGAGG - Intergenic
1059167993 9:112097290-112097312 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1059197330 9:112382230-112382252 CACTCTCTCTCGCAGGGTGGAGG - Intronic
1059936286 9:119314396-119314418 CACTCTCTCACCCAGGCTGGAGG + Intronic
1060125372 9:121039602-121039624 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1060191213 9:121594267-121594289 TGCTCTGTCGCCGAGGCTGGAGG + Intronic
1060645787 9:125278486-125278508 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1061073946 9:128329407-128329429 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1061208770 9:129178752-129178774 GCCTCTCTACAGGAGGCTGGTGG + Intergenic
1061613819 9:131766142-131766164 CGCTCTATCACCCAGGCTGGAGG + Intergenic
1061709308 9:132476780-132476802 GCCTCTCTCCCGGCTGCTGGTGG - Intronic
1061741993 9:132713927-132713949 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1061825257 9:133254477-133254499 AGGTCTCTTCCGGAGCCTGGAGG - Intronic
1061952364 9:133943623-133943645 TGCCCTCTCCCCCAGGCTGGCGG + Intronic
1062006322 9:134240159-134240181 CTGTCTCCCCCGGAGACTGGTGG + Intergenic
1062488745 9:136793984-136794006 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1062512076 9:136911880-136911902 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1062613567 9:137386259-137386281 CACTCTGTCCCCCAGGCTGGAGG - Intronic
1203628516 Un_KI270750v1:48643-48665 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1185492021 X:525066-525088 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1185512146 X:671627-671649 CGCTCTTTCACCCAGGCTGGAGG + Intergenic
1185555527 X:1018320-1018342 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1185570392 X:1130612-1130634 CGCTCTGTCTCCGAGGTTGGAGG + Intergenic
1185579784 X:1203063-1203085 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1185615782 X:1420990-1421012 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1185617953 X:1434760-1434782 CGCTCTCTTACCCAGGCTGGAGG - Intronic
1185618851 X:1440117-1440139 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1185854147 X:3518710-3518732 TCCTCTCTCACAGAGGCTGGGGG - Intergenic
1186136357 X:6526063-6526085 TGCTCTGTCCCCCAGGCTGGAGG - Intergenic
1186244794 X:7608640-7608662 CGCTCTGTCCGGGAGGGAGGTGG - Intergenic
1186890043 X:13950999-13951021 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1187343071 X:18438755-18438777 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1187344752 X:18452861-18452883 CGCTCTGTCACCCAGGCTGGAGG + Intronic
1187344954 X:18454923-18454945 CACTCTGTCACGCAGGCTGGAGG + Intronic
1188287327 X:28343784-28343806 TGCTCTGTCCCCCAGGCTGGAGG + Intergenic
1188406837 X:29821415-29821437 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1189123691 X:38423342-38423364 CGCTCTGTCACCTAGGCTGGAGG - Intronic
1190069123 X:47265124-47265146 CACTCTGTCACGCAGGCTGGAGG + Intergenic
1190254171 X:48750160-48750182 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1190728421 X:53207934-53207956 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1191072710 X:56419416-56419438 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1192740259 X:73885394-73885416 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1193234738 X:79093030-79093052 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1193825244 X:86217055-86217077 CGCTCTGTCACCCAGGCTGGAGG - Intronic
1193920981 X:87425550-87425572 CGTGCTCTCCCTGGGGCTGGTGG + Intergenic
1194738768 X:97546801-97546823 CACTCTGTCGCCGAGGCTGGAGG - Intronic
1195221099 X:102745976-102745998 CGCTCTCTCCGCGAGGGTGTCGG - Intronic
1195895695 X:109744083-109744105 CGCTCTGTCACCCAGGCTGGAGG - Intergenic
1196049803 X:111292916-111292938 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1196712922 X:118782103-118782125 TGCTCTGTCACCGAGGCTGGAGG + Intronic
1196738844 X:119006618-119006640 CGCTCTGTCGCCCAGGCTGGAGG + Intronic
1196803902 X:119568039-119568061 CGCTCTCTCGCCCAGGCTGGAGG + Intergenic
1197017711 X:121647473-121647495 CGCTCTGTCGCCCAGGCTGGAGG - Intergenic
1197692977 X:129522932-129522954 CCCGCTCTCCCGGGGCCTGGGGG - Intronic
1197784731 X:130188335-130188357 CACTCTCTCACCCAGGCTGGAGG - Intergenic
1198242293 X:134797844-134797866 CGCTCTTTCGCCCAGGCTGGAGG + Intronic
1199723411 X:150559488-150559510 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1199765835 X:150941240-150941262 CTCACTCTCCCGGGGGCGGGGGG - Intergenic
1200000903 X:153059286-153059308 TGATCTCTCCAGGAGTCTGGTGG - Intronic
1200123255 X:153801154-153801176 CACTCTGTCGCCGAGGCTGGAGG + Intergenic
1200211335 X:154347928-154347950 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1200242273 X:154503364-154503386 CGCTCTGTCACCCAGGCTGGAGG + Intergenic
1200243531 X:154510306-154510328 TGCTCTCTCACCCAGGCTGGAGG - Intronic
1200330999 X:155297825-155297847 CGCTCTGTCGCCCAGGCTGGAGG - Intronic
1200483556 Y:3738663-3738685 CGCTCTGTCTCCCAGGCTGGAGG + Intergenic
1201220560 Y:11766118-11766140 CGCTCTGTCGCCCAGGCTGGAGG + Intergenic
1201438095 Y:13980886-13980908 CGCTCTGTCACCCAGGCTGGAGG + Intergenic