ID: 915466620

View in Genome Browser
Species Human (GRCh38)
Location 1:156102161-156102183
Sequence CACAGGCACATTCCTCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 243}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915466620_915466625 1 Left 915466620 1:156102161-156102183 CCAAAGGGAGGAATGTGCCTGTG 0: 1
1: 0
2: 3
3: 23
4: 243
Right 915466625 1:156102185-156102207 ACCTGCTCCGTGATACACGGGGG 0: 1
1: 0
2: 0
3: 2
4: 33
915466620_915466630 12 Left 915466620 1:156102161-156102183 CCAAAGGGAGGAATGTGCCTGTG 0: 1
1: 0
2: 3
3: 23
4: 243
Right 915466630 1:156102196-156102218 GATACACGGGGGCGGGACAGTGG 0: 1
1: 0
2: 0
3: 5
4: 81
915466620_915466632 20 Left 915466620 1:156102161-156102183 CCAAAGGGAGGAATGTGCCTGTG 0: 1
1: 0
2: 3
3: 23
4: 243
Right 915466632 1:156102204-156102226 GGGGCGGGACAGTGGAGTGGAGG 0: 1
1: 0
2: 13
3: 60
4: 613
915466620_915466623 -1 Left 915466620 1:156102161-156102183 CCAAAGGGAGGAATGTGCCTGTG 0: 1
1: 0
2: 3
3: 23
4: 243
Right 915466623 1:156102183-156102205 GCACCTGCTCCGTGATACACGGG 0: 1
1: 0
2: 1
3: 2
4: 68
915466620_915466627 4 Left 915466620 1:156102161-156102183 CCAAAGGGAGGAATGTGCCTGTG 0: 1
1: 0
2: 3
3: 23
4: 243
Right 915466627 1:156102188-156102210 TGCTCCGTGATACACGGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
915466620_915466631 17 Left 915466620 1:156102161-156102183 CCAAAGGGAGGAATGTGCCTGTG 0: 1
1: 0
2: 3
3: 23
4: 243
Right 915466631 1:156102201-156102223 ACGGGGGCGGGACAGTGGAGTGG 0: 1
1: 0
2: 0
3: 29
4: 313
915466620_915466622 -2 Left 915466620 1:156102161-156102183 CCAAAGGGAGGAATGTGCCTGTG 0: 1
1: 0
2: 3
3: 23
4: 243
Right 915466622 1:156102182-156102204 TGCACCTGCTCCGTGATACACGG 0: 1
1: 2
2: 0
3: 5
4: 78
915466620_915466628 5 Left 915466620 1:156102161-156102183 CCAAAGGGAGGAATGTGCCTGTG 0: 1
1: 0
2: 3
3: 23
4: 243
Right 915466628 1:156102189-156102211 GCTCCGTGATACACGGGGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
915466620_915466624 0 Left 915466620 1:156102161-156102183 CCAAAGGGAGGAATGTGCCTGTG 0: 1
1: 0
2: 3
3: 23
4: 243
Right 915466624 1:156102184-156102206 CACCTGCTCCGTGATACACGGGG 0: 1
1: 0
2: 2
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915466620 Original CRISPR CACAGGCACATTCCTCCCTT TGG (reversed) Intronic
900196968 1:1381386-1381408 CACAGGCTCATTTCTGCCTAGGG - Intergenic
901124929 1:6922567-6922589 GACAGCCACATTTCTCCCCTGGG + Intronic
901942589 1:12674959-12674981 CACAGTGACACTCATCCCTTTGG + Intergenic
902194950 1:14791530-14791552 CAGAGGCACATTCCTCCACCAGG - Intronic
902907071 1:19566227-19566249 GATAGGCACACTCCTACCTTAGG - Intergenic
902929069 1:19717612-19717634 CACATGCACCTTCCTGCCTCTGG + Intronic
903155065 1:21437271-21437293 CCCAGGCACACTCCTCTCCTGGG - Intergenic
903208853 1:21803911-21803933 GCCAGGCACATTCCTGCCTCAGG + Intergenic
903237363 1:21958755-21958777 CACTGCCAAATTCCTCTCTTGGG - Intergenic
903393200 1:22979602-22979624 ACCAGGCACATTCCACCCTAAGG - Intergenic
904392406 1:30194764-30194786 AACAGGCACGTTCCTGCCTTGGG - Intergenic
904477999 1:30776910-30776932 CCCAGGCTCTTTCCTCCCTGAGG - Intergenic
905907083 1:41626337-41626359 CACAGGCACTTTCTTCCCCAGGG + Intronic
906544084 1:46609322-46609344 CACACCCACATTCCTCCAATAGG + Exonic
907050323 1:51325888-51325910 GACAGGCACAGTCCTTCCCTCGG + Intronic
907789774 1:57650959-57650981 CACACACTCATTCCTCCCTTAGG - Intronic
908584572 1:65554304-65554326 CACAGCCACATTCTTCCCCCAGG + Intronic
910524947 1:88166770-88166792 ATCAGGCACATTCCTGCATTTGG + Intergenic
910711057 1:90181262-90181284 TACAGTCACACTCCTCCCCTAGG - Intergenic
911822161 1:102436200-102436222 CCCAGCCACTTTCCTCCCTGAGG + Intergenic
915041620 1:152972415-152972437 CCCAGACACTTTCCTCACTTTGG - Exonic
915466620 1:156102161-156102183 CACAGGCACATTCCTCCCTTTGG - Intronic
916147586 1:161754043-161754065 GACAGCCACATTTCTCCTTTAGG + Intronic
923664742 1:235990126-235990148 CACAGCCACATCCCTTCTTTGGG - Intronic
923967369 1:239156543-239156565 CAGAGGAATATTCCTGCCTTGGG + Intergenic
924039969 1:239974812-239974834 CACAAGCACATGCCACCCATCGG - Intergenic
1063709990 10:8468155-8468177 AATAAGCACATTCCTACCTTGGG - Intergenic
1065322133 10:24519865-24519887 GCCAGGCACAATCGTCCCTTTGG + Intronic
1065956235 10:30696287-30696309 CCCAGACACATTCCTGCCTCTGG - Intergenic
1066553028 10:36580538-36580560 CTCAGTCACTTTCCTCCCCTGGG - Intergenic
1067476129 10:46567612-46567634 CACTGGCACAGTCCTCACTTTGG + Intergenic
1067618609 10:47774168-47774190 CACTGGCACAGTCCTCACTTTGG - Intergenic
1068959155 10:62849315-62849337 GACTGGCACATTCCCACCTTAGG + Intronic
1068999137 10:63244064-63244086 CTCAGGGATATTTCTCCCTTTGG - Intronic
1069562733 10:69442101-69442123 CCTAGGCCCATTCCTACCTTTGG - Intergenic
1069667627 10:70174091-70174113 GCCAGGCACACTCCTGCCTTAGG - Intergenic
1070712631 10:78693871-78693893 CTCAGGCACAGTCCTCCCAGAGG - Intergenic
1071576994 10:86734752-86734774 CACAGGGCCCTTCCTACCTTTGG + Exonic
1071785482 10:88895081-88895103 GCCAGGCTCATTCCACCCTTGGG + Intronic
1073303151 10:102483164-102483186 CAGCAGCACATTCCTCCCCTGGG - Intronic
1075335447 10:121605938-121605960 CACAAACACATTCCTACCTTTGG + Intergenic
1076496097 10:130898741-130898763 CACAGGCACCATCCTCCATGGGG - Intergenic
1076585764 10:131546448-131546470 CACAGGCACAAACCTCCCACTGG + Intergenic
1078451779 11:11445941-11445963 CTCAGGCAAATTCCTCCCACAGG + Intronic
1078539476 11:12201527-12201549 CCCAGGCAAACTCCTGCCTTAGG + Intronic
1079469598 11:20765632-20765654 CACAAGCTCCTTCCTGCCTTAGG - Intronic
1080124956 11:28722140-28722162 ACCAGGCACATTCCTGCCTTAGG + Intergenic
1080821478 11:35810833-35810855 CACAGTCACATTCCCTCCTTAGG + Exonic
1081067871 11:38569711-38569733 CAAAGGCAGATCCCTCCCTAGGG + Intergenic
1081568736 11:44276474-44276496 CACCGGCACATTCCTAGCTCAGG + Intronic
1081620196 11:44614841-44614863 GCCAGGCACACTCCTGCCTTGGG - Intronic
1084904157 11:72333260-72333282 CACAGACACACTCCTTCCTAGGG - Intronic
1085478243 11:76801362-76801384 CAGAGGGACATTCCTGCATTTGG - Intergenic
1086018693 11:82199197-82199219 CACATGTACATTCTTCCCTGTGG - Intergenic
1088593286 11:111421477-111421499 CACAGGGACATCCTGCCCTTCGG - Intronic
1088698507 11:112390899-112390921 TTCAGGCAGATTCCTGCCTTGGG + Intergenic
1089787000 11:120914942-120914964 CACAGCCATAATCCTCTCTTGGG - Intronic
1089973462 11:122712678-122712700 CACAGGTACCTTCCTACCTGTGG + Intronic
1091112355 11:132981496-132981518 CAAATTCACATTCCTCCCTCAGG - Intronic
1091399088 12:171942-171964 CACCTGCACACTCCTCCCATAGG - Intronic
1091557039 12:1581656-1581678 GACAGCCACATGCCTCCCGTAGG + Intronic
1094832736 12:34307865-34307887 CAAAGGCACTTTCGTCCCTTGGG - Intergenic
1095148404 12:38759951-38759973 TCCAGGCACTTTCATCCCTTTGG + Intronic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1096292004 12:50351363-50351385 CACAGGCCCCTCCCTCCCCTGGG - Exonic
1096631059 12:52927083-52927105 CACAGCTTCTTTCCTCCCTTGGG - Intronic
1097693783 12:62758377-62758399 CACAGGCAGGGACCTCCCTTTGG - Intronic
1098245287 12:68511032-68511054 AACAAGCACATTCTTTCCTTTGG - Intergenic
1100710635 12:97252507-97252529 CACAGGCATATCCTTCACTTTGG + Intergenic
1100773250 12:97947281-97947303 GTCAGGCACATTCCTGTCTTGGG - Intergenic
1101362912 12:104044458-104044480 CAGTTGCACATTCATCCCTTTGG - Intronic
1102326732 12:111992144-111992166 CACAGGGACACTCCTTTCTTAGG + Intronic
1102617907 12:114170720-114170742 CCCAGGCTCATTCCTGCCTTGGG + Intergenic
1105589105 13:21774887-21774909 CTCAGGCACACTCCCACCTTGGG + Intergenic
1105914450 13:24900239-24900261 CTCAGGCACATTCTTGCCTCAGG - Intronic
1107352255 13:39528161-39528183 CTCTGGCACATTCCTCACTCTGG + Intronic
1107445950 13:40470555-40470577 CACAGTCACCTGCCTTCCTTGGG - Intergenic
1112827087 13:103404162-103404184 CTGAGGCACAGTCCTACCTTTGG - Intergenic
1112999635 13:105619036-105619058 CACAATCACTTTCCTCCCTGAGG + Intergenic
1113042393 13:106119276-106119298 AAAAGGGACATTCCTCCCTCGGG - Intergenic
1113404325 13:110023805-110023827 CTCAGGCACCTTCCTGGCTTCGG - Intergenic
1116101755 14:40447051-40447073 CACAGTCACTTTCCTTCCATTGG - Intergenic
1117862154 14:60103812-60103834 CACAGCCATATTTCTCCCTTAGG + Intronic
1118166794 14:63344652-63344674 ACCAAGCACATTCCTGCCTTCGG + Intergenic
1118229686 14:63936563-63936585 CCCAGGCCCATTCCCACCTTAGG - Intronic
1118993716 14:70818911-70818933 CACAGGCATTTTCCTGTCTTAGG - Intergenic
1119809741 14:77507048-77507070 CACATTCACAGTCCACCCTTGGG - Exonic
1119972004 14:78981337-78981359 CACATGCACATTCCCCACTCTGG + Intronic
1120467817 14:84884092-84884114 CACAGCCACATTTCTCCTTATGG - Intergenic
1120722423 14:87903583-87903605 CCCAGGCACCTTCCTTCCTTAGG - Intronic
1122168766 14:99853388-99853410 CACGGGCACACCCCTCCCGTGGG - Intronic
1124234068 15:27971519-27971541 CCCAGCCACAAGCCTCCCTTGGG - Intronic
1124651592 15:31478045-31478067 CACAGGCACCCTCCTGCCTCAGG - Exonic
1127568114 15:60213519-60213541 CCCAGGCACCCTCCTCCCCTTGG + Intergenic
1128127518 15:65204006-65204028 CACAGGCACATTCCTGCCTCAGG - Intronic
1129126223 15:73443352-73443374 CTCAGGGATATTCCTGCCTTCGG - Intronic
1129267745 15:74403099-74403121 CACAGTCACCTTCCTCTCCTGGG - Intergenic
1129463923 15:75713198-75713220 CACAGGCACACTCCAGCCTTAGG + Intergenic
1129738972 15:77980682-77980704 CACAAGCTCTTTCCTCCATTTGG - Intergenic
1130255603 15:82324711-82324733 CACAGCCACGTTCCTCACCTTGG - Intergenic
1130599364 15:85265275-85265297 CACAGCCACGTTCCTCACCTTGG + Intergenic
1132652332 16:1027185-1027207 CAGAGGCGCATTCCTTTCTTAGG - Intergenic
1135973102 16:27086674-27086696 AACAGGCACATTCCTGCCCCAGG + Intergenic
1137537680 16:49339892-49339914 AGCAGGCACACTCCTACCTTAGG - Intergenic
1138339384 16:56278802-56278824 GCCAGGCTCATTCCTCCCTCAGG - Intronic
1138890923 16:61143317-61143339 TACAATCACAGTCCTCCCTTTGG + Intergenic
1139914024 16:70417325-70417347 CACAGGAACTCTCCTCCCTGGGG + Intronic
1141797615 16:86285685-86285707 CACAGGTACCTGCCTCCCTCCGG - Intergenic
1143771790 17:9173675-9173697 CACAGGCAGATGCAGCCCTTTGG + Intronic
1145786681 17:27598236-27598258 CACAGTCACCTTCCTTCCTCTGG - Intronic
1146552207 17:33791101-33791123 CACAAGCAGATTCCACCCTTTGG + Intronic
1147129106 17:38395624-38395646 CACACACACCTTCCTCCCTCTGG - Intronic
1147687370 17:42294679-42294701 CACAGGCATGTTCCTGCCCTGGG - Intronic
1148047487 17:44753114-44753136 CCCAGGCACACTCATCCTTTGGG - Intergenic
1148065694 17:44867991-44868013 CACACACACATTCCTCCCCTGGG - Intronic
1148817161 17:50337266-50337288 AACAGGTACTTACCTCCCTTAGG + Intergenic
1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG + Exonic
1152861890 17:82701184-82701206 CATCGGAACATTCCTCCCTGTGG + Intergenic
1155755394 18:29488690-29488712 CACTGGCACATTCCACATTTTGG + Intergenic
1157389976 18:47293474-47293496 CACAAAGACATTCCTCCCATGGG - Intergenic
1158395563 18:57076465-57076487 CACTGGCACAGGCCTCCTTTGGG - Intergenic
1159117881 18:64136068-64136090 CACTGCCACATTCTTCCCTGAGG - Intergenic
1160672334 19:371712-371734 GACAGACACTTTCATCCCTTGGG - Intronic
1162076130 19:8188814-8188836 GACAGTAACACTCCTCCCTTCGG - Intronic
1162491021 19:10991720-10991742 CACAGGCACATTCCAGCCCCAGG - Intronic
1162869702 19:13576196-13576218 ACCAGGCACATTCCTGCCTCAGG + Intronic
1163383233 19:16982461-16982483 AACAGGCAGATTCTTCCTTTAGG - Intronic
1163981657 19:20906368-20906390 CACAGACTCATTCATTCCTTTGG + Intergenic
1164497267 19:28777845-28777867 CACAAGTACATTCCTCCAATAGG + Intergenic
1165757238 19:38301051-38301073 CACAGGCACATTCCTGCCTCAGG + Intronic
1166066373 19:40361613-40361635 ACCAGGCACATTCCTCCCTCAGG + Intronic
1166256619 19:41610642-41610664 CTCAGGGAAATTTCTCCCTTCGG + Intronic
1168239946 19:55083887-55083909 CCCAGCCCCCTTCCTCCCTTAGG - Intronic
925415635 2:3668333-3668355 CACAAGCACCTCCCTCACTTAGG - Intronic
925649841 2:6078219-6078241 CACAAGCCCTTCCCTCCCTTAGG + Intergenic
926012207 2:9417254-9417276 CACAGGCTCACTCCTCCCATGGG + Intronic
926160328 2:10483428-10483450 CACAGACCCACTCTTCCCTTTGG + Intergenic
926604026 2:14878333-14878355 CCCAGGCCCATACCTCCCTGTGG - Intergenic
927393495 2:22622861-22622883 TCCAGGCACATTCCAGCCTTGGG - Intergenic
927635764 2:24815344-24815366 CATAGGCTCATTCTTCCCCTTGG - Intronic
928552268 2:32384094-32384116 TGCTGGAACATTCCTCCCTTGGG + Intronic
928586285 2:32761588-32761610 GCCAGGCACATTCCTGCCTCAGG + Intronic
931900390 2:66781983-66782005 CACAGGCAGAGTCATCTCTTAGG - Intergenic
932729681 2:74209951-74209973 CACAACCACATTCTTCCCTAGGG - Exonic
933006441 2:77001446-77001468 CACATGCACATACTTGCCTTAGG - Intronic
933274944 2:80273677-80273699 CACAGACACACTCCTGCCTCAGG + Intronic
934712806 2:96526924-96526946 CTCAGTCACATGCCGCCCTTGGG - Intergenic
937333108 2:121044387-121044409 CACTCACACATTCCTTCCTTTGG + Intergenic
938095289 2:128457428-128457450 CACAGGCTCAGTCATCACTTGGG - Intergenic
938140244 2:128789483-128789505 CACAGGGACCTCCTTCCCTTTGG - Intergenic
938806770 2:134813453-134813475 CAGTGGCACATTCCGTCCTTGGG + Intergenic
941266828 2:163372823-163372845 CACAGGCACGTTCTTACCTAAGG - Intergenic
944852938 2:203738586-203738608 CACAGGCATGTTCCTACCTCAGG + Exonic
945796190 2:214367044-214367066 CACAGGAACCCTCCTCCCTAGGG - Intronic
1169116155 20:3067331-3067353 GCCAGGCACATTCCTGCCTCAGG + Intergenic
1172698313 20:36837130-36837152 CTCAGGCCCACTTCTCCCTTGGG + Intronic
1173309485 20:41884342-41884364 CACTGGCACACTCCTATCTTGGG + Intergenic
1174023015 20:47546911-47546933 TGCAGGCACATTCTTGCCTTTGG + Intronic
1174975572 20:55329299-55329321 CACACACACATTCCTTCCCTGGG - Intergenic
1175568229 20:59997953-59997975 CACAGGCACATACCTGCCAGAGG - Intronic
1175870955 20:62209215-62209237 CAGAGCCACAGACCTCCCTTGGG + Intergenic
1175917881 20:62435543-62435565 TCCAGGCACACTCCTGCCTTCGG + Intergenic
1176049783 20:63112640-63112662 CACAGGGAGAGTCCTTCCTTGGG - Intergenic
1179475136 21:41638257-41638279 CACAAGCACAGTCCTGCTTTAGG - Intergenic
1181673448 22:24436867-24436889 CACATGCTCATTCCTTCCTCAGG - Intronic
1182387762 22:29960233-29960255 CACAGCAATATTCCCCCCTTTGG - Intronic
1183240037 22:36650841-36650863 CACAGGCACACTCCTGCCTCGGG + Intronic
1183747509 22:39700099-39700121 CACAGGCATAGTCCTCCCCCAGG + Intergenic
949168577 3:970846-970868 CTCTGGGACATTACTCCCTTGGG + Intergenic
950114133 3:10439421-10439443 CACAGTCACATGCATCCCCTTGG + Intronic
950457207 3:13099876-13099898 ACCAGGCACACTGCTCCCTTGGG - Intergenic
954564130 3:51584034-51584056 CTCAGGCCCATTTCTCCCCTGGG + Intronic
955628626 3:60948180-60948202 TACAGGCCCATTCATCCCTAAGG + Intronic
956670213 3:71682119-71682141 CACAGGCACTTGCCTACATTGGG - Exonic
957025523 3:75177438-75177460 CTCGGGCACATTCCTTCCTCAGG + Intergenic
958554360 3:95655423-95655445 CACAACCACATTCTTCCCTAGGG + Intergenic
959510643 3:107207825-107207847 CACAGGCACATCCCAGCCTGTGG + Intergenic
959749088 3:109811984-109812006 AGCAGGCCCATTCCTACCTTAGG - Intergenic
960262847 3:115588129-115588151 AACATGCACACTCCTGCCTTGGG + Intergenic
961489400 3:127243204-127243226 GACAGCCACATCCCTGCCTTGGG - Intergenic
961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG + Intergenic
962912958 3:139871707-139871729 CACAGGCACATGATTCCCTATGG + Intergenic
966377066 3:179307156-179307178 AACAGGATGATTCCTCCCTTGGG - Intergenic
966392241 3:179464916-179464938 CACAACCACATTCTTCCCTAGGG - Intergenic
967230017 3:187328915-187328937 CACAGGTACATCCCTGCCTCTGG - Intergenic
970404953 4:15753986-15754008 CTCAGTCACCTTCCTTCCTTTGG + Intergenic
970757456 4:19443477-19443499 CACCTGAACATTCCTCCCTGGGG + Intergenic
971632367 4:29010069-29010091 GACAAGCACATTCCATCCTTAGG - Intergenic
971682946 4:29724800-29724822 CTCAGTCACATTCCTCTATTTGG - Intergenic
972276839 4:37565499-37565521 CACAGACACCTTCCTCCCCCAGG + Intronic
973273783 4:48287881-48287903 CAGAGGAAGATTCCTGCCTTGGG - Intergenic
974609967 4:64204755-64204777 CACAGGCACATTCTTTACCTTGG + Intergenic
974787372 4:66636705-66636727 CACAGGGACAATACACCCTTTGG - Intergenic
977240632 4:94564406-94564428 CACTGGTACATTCCTGCCTCAGG + Intronic
977452542 4:97217458-97217480 CACAGGCATATTCCTGCTTCAGG - Intronic
978335730 4:107666936-107666958 CAAAGGCACATTGATCACTTAGG - Intronic
978349313 4:107804744-107804766 GCCAGGCACATTCCTCTCTCAGG - Intergenic
981260032 4:142708439-142708461 CACAGAACCATTCCTCCCTATGG - Intronic
982076743 4:151744937-151744959 CACAGACACATACCTCCTTTAGG + Intronic
983632126 4:169860024-169860046 CTGAGGCACATTCCTCCACTTGG - Intergenic
983927091 4:173414123-173414145 CACAGACAAAATCCTCTCTTGGG + Intergenic
985533576 5:448403-448425 CACAGCCTCATCCCTCCCCTTGG + Intronic
986053321 5:4110730-4110752 CAAAGGCACAATCATCCCATTGG - Intergenic
988268259 5:28979721-28979743 CACTGGTATATTCCTCCCTGCGG - Intergenic
988382832 5:30520368-30520390 TACAGGCACATACCACCATTTGG + Intergenic
989062729 5:37425501-37425523 GCCAGGCACATTACTGCCTTAGG - Intronic
989484039 5:41967597-41967619 CACAACCACATTCTTCCCTAGGG + Intergenic
990110717 5:52319900-52319922 CACACACACATTCTTCCATTTGG - Intergenic
992492593 5:77259537-77259559 AGCAAGCACATTGCTCCCTTGGG + Intronic
993458661 5:88156377-88156399 CACACACACATCCCTACCTTCGG - Intergenic
997513168 5:134466685-134466707 CCCAGGCACATTCCCCACTAGGG - Intergenic
999450453 5:151673848-151673870 CACAGGCACATTCTTAACCTTGG + Intronic
999953887 5:156679473-156679495 TACATGCACATGCCACCCTTGGG + Intronic
1001763968 5:174230439-174230461 CGCAGCCACATTCCTACCTCTGG + Intronic
1002795304 6:466807-466829 CACAGGGACATGCCTCCCTGTGG + Intergenic
1002923100 6:1587097-1587119 CACAGGGTCATTTTTCCCTTGGG - Intergenic
1004091118 6:12502932-12502954 ACCAGGCACATCCCTACCTTGGG + Intergenic
1006780293 6:36627844-36627866 TTCAGGCACATACCTCCCTCCGG + Intergenic
1007474461 6:42109581-42109603 CCCAGGCACATTTCCGCCTTGGG - Intronic
1008062899 6:47017143-47017165 CACAGGCATTTTCCCGCCTTAGG - Intronic
1010780879 6:79945242-79945264 CATAGGCAAATACCTTCCTTCGG + Intronic
1012169838 6:96003203-96003225 CACAAGCACATCACTTCCTTGGG + Intergenic
1012463578 6:99491968-99491990 CACAGACACATTATTCACTTGGG + Intronic
1013183984 6:107741465-107741487 CTCAGGGATATTTCTCCCTTCGG - Intronic
1013446444 6:110233322-110233344 AACAGACACTTTCCTCCCATTGG - Intronic
1015853941 6:137603739-137603761 CACAGGCACATCCTTCCCTGGGG - Intergenic
1018484685 6:164228847-164228869 CTCAGGCTCCTTCCTACCTTTGG + Intergenic
1018783531 6:167090511-167090533 CACAGGAAAATTGCTCCTTTGGG - Intergenic
1019416853 7:931873-931895 CTCAGGCCCGTTTCTCCCTTAGG + Intronic
1021420686 7:20442182-20442204 GACAGCCACATTCCTCCCAGAGG - Intergenic
1022556748 7:31305825-31305847 CAAAGGCACACTATTCCCTTAGG + Intergenic
1023366451 7:39469029-39469051 CACAGGCTCATTCCTGTCTGTGG + Intronic
1024504519 7:50150376-50150398 CACTGGCCCTTTCCTCCCTGGGG + Intronic
1028251357 7:88543034-88543056 CCCAGACACTTTCCTCCCTGAGG - Intergenic
1028344368 7:89761421-89761443 CACTGGAACACTCCTCCCATGGG + Intergenic
1029875712 7:103749397-103749419 TACAGGAACATTCCTCACTTTGG - Intronic
1030415302 7:109236745-109236767 CACAGGCTCTTTCCTTACTTTGG - Intergenic
1030735370 7:113041805-113041827 CAGTGGCACTTGCCTCCCTTAGG - Intergenic
1032151414 7:129433335-129433357 CACTTGCAGATTCCTCCCTGCGG - Intergenic
1032161278 7:129512842-129512864 CTTAGGAACATTCCTCTCTTGGG + Exonic
1032430507 7:131857406-131857428 GACAAGCTCATTCCTGCCTTGGG - Intergenic
1035407265 7:158607269-158607291 CACTGGCACTTTCCTCCCGCTGG - Intergenic
1039378933 8:37066936-37066958 CTCCAGCCCATTCCTCCCTTAGG + Intergenic
1041354243 8:56983384-56983406 ACCAGGCACATTCCCACCTTAGG - Intronic
1042761946 8:72280719-72280741 CCCAGCCACTTTCCTCCCTGAGG + Intergenic
1044235630 8:89826906-89826928 AAGAAGCACATTCCTCCCTCAGG + Intergenic
1045230512 8:100301976-100301998 ACCAGACACATTCCTCCCTTAGG - Intronic
1045917647 8:107491613-107491635 GACAGGCTCATTCCTGCCTCAGG - Intronic
1047207201 8:122812169-122812191 CTCAGGCACGCTCCTGCCTTAGG - Intronic
1048162925 8:132037581-132037603 CTCAGCCCCTTTCCTCCCTTGGG - Intronic
1049996280 9:1037103-1037125 ACCAGGAACATTCCTCCCTCAGG + Intergenic
1050261192 9:3842532-3842554 CACAGGCAAATTGCTTCCTTTGG + Intronic
1057000747 9:91506673-91506695 CACAGGGACATTACTGCCATAGG - Intergenic
1059322504 9:113480626-113480648 CTCAGGCCCATTCCTCCTTCAGG - Intronic
1062653009 9:137587972-137587994 CACAGGCACATGGCTCCCAGGGG + Intronic
1186351281 X:8742246-8742268 CACACGCACAATCCTGCCTCAGG + Intergenic
1186525536 X:10244784-10244806 CAAAGCCACATTCCTTGCTTCGG + Intergenic
1187368446 X:18683867-18683889 CCCAGGCACCTTCCTTCTTTAGG - Intronic
1187696830 X:21930651-21930673 AACTAACACATTCCTCCCTTGGG - Intergenic
1187707073 X:22019619-22019641 CCCAGGCACAGTCTTCCCTCAGG - Intergenic
1189047168 X:37605648-37605670 CACAGGTACACTCCCCACTTAGG + Intronic
1189301849 X:39957991-39958013 ACCAGGCACATTCCTGCCTCAGG - Intergenic
1191697261 X:64003056-64003078 CACAGGTGCCTTCCTGCCTTGGG - Intergenic
1193144887 X:78066420-78066442 CACAAGCACATTCTCTCCTTAGG + Intronic
1197355681 X:125435701-125435723 CCCAGCCACTTTCCTCCCTGAGG - Intergenic
1199248983 X:145637902-145637924 AACAGGCCCATGCCTCCCTGGGG + Intergenic
1200230499 X:154441575-154441597 CCCTGTCACATCCCTCCCTTAGG - Intronic
1201770213 Y:17611562-17611584 CACAGGCACATTGGTGGCTTGGG - Intergenic
1201831341 Y:18294425-18294447 CACAGGCACATTGGTGGCTTGGG + Intergenic
1202045412 Y:20732578-20732600 CACAGTCACATTCCTTTGTTGGG + Intergenic