ID: 915468124

View in Genome Browser
Species Human (GRCh38)
Location 1:156109609-156109631
Sequence AAAACTAGGCCGTAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915468124_915468130 29 Left 915468124 1:156109609-156109631 CCTGTTACTTACGGCCTAGTTTT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 915468130 1:156109661-156109683 GAAATAATTTCCAACCCATGAGG 0: 1
1: 0
2: 0
3: 22
4: 197
915468124_915468128 7 Left 915468124 1:156109609-156109631 CCTGTTACTTACGGCCTAGTTTT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 915468128 1:156109639-156109661 TCAGCCTCATCTGCAAAGCAGGG 0: 1
1: 0
2: 7
3: 43
4: 390
915468124_915468127 6 Left 915468124 1:156109609-156109631 CCTGTTACTTACGGCCTAGTTTT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915468124 Original CRISPR AAAACTAGGCCGTAAGTAAC AGG (reversed) Intronic