ID: 915468124

View in Genome Browser
Species Human (GRCh38)
Location 1:156109609-156109631
Sequence AAAACTAGGCCGTAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915468124_915468127 6 Left 915468124 1:156109609-156109631 CCTGTTACTTACGGCCTAGTTTT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 250
915468124_915468128 7 Left 915468124 1:156109609-156109631 CCTGTTACTTACGGCCTAGTTTT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 915468128 1:156109639-156109661 TCAGCCTCATCTGCAAAGCAGGG 0: 1
1: 0
2: 7
3: 43
4: 390
915468124_915468130 29 Left 915468124 1:156109609-156109631 CCTGTTACTTACGGCCTAGTTTT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 915468130 1:156109661-156109683 GAAATAATTTCCAACCCATGAGG 0: 1
1: 0
2: 0
3: 22
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915468124 Original CRISPR AAAACTAGGCCGTAAGTAAC AGG (reversed) Intronic
907289305 1:53402664-53402686 AAAACTAGGCTGTCAGTTCCAGG + Intergenic
912363789 1:109116271-109116293 AAAACCACGTGGTAAGTAACAGG - Intronic
913557603 1:119983807-119983829 AAAACAAAGCCGTAACTATCAGG + Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
915682341 1:157593519-157593541 ATAACTAGGCCTCAAGTAAGAGG - Intronic
919485304 1:198138839-198138861 ATAAGTAGGCTGTAAGTATCTGG + Intergenic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1069132645 10:64726302-64726324 AAAACTGTGTAGTAAGTAACAGG - Intergenic
1085435648 11:76498865-76498887 AAAAGTAGGTTGAAAGTAACAGG - Intronic
1093187415 12:16036830-16036852 AAAATTGGGCAGTAGGTAACTGG + Exonic
1095364992 12:41392598-41392620 ATAACTAGGATGTAAGTAAGGGG - Intronic
1101937343 12:109069199-109069221 ACAACTAGGCCTTAAGGAAAGGG - Intronic
1108908377 13:55508814-55508836 AAAACTAGGCTTTATATAACCGG + Intergenic
1109842062 13:67931608-67931630 AAAATAATGCCGTAAGTAAATGG - Intergenic
1111131441 13:83982034-83982056 AAAAATAGGGTGTACGTAACAGG - Intergenic
1115581026 14:34758601-34758623 AAAACTAGACAGTGAGTAACAGG + Intronic
1116072736 14:40069835-40069857 AAAAATAAGAAGTAAGTAACAGG + Intergenic
1116281804 14:42917631-42917653 AAAAGAAGGCCCTAAGTAATTGG - Intergenic
1117670940 14:58105143-58105165 AAAACTATGCCAAAAATAACAGG + Intronic
1125189311 15:36971451-36971473 TAAATTTGGCCGTAAGAAACTGG + Intronic
1132306384 15:100817184-100817206 AAAACTAGCCTGTTAGGAACTGG + Intergenic
1138010842 16:53378417-53378439 AAAACAAGGGCTTAGGTAACAGG + Intergenic
1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG + Intronic
1149189775 17:54046777-54046799 TAAACTAGGCAGGATGTAACTGG + Intergenic
1150571322 17:66389503-66389525 AAAAATATGCCGGAAGTATCTGG + Intronic
1164387479 19:27787127-27787149 ACAACTAGGCTGAAAGTAAAAGG + Intergenic
935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG + Intergenic
937408138 2:121649360-121649382 AAAACAGGGCTGTAAGTACCCGG - Exonic
943877320 2:193086843-193086865 AAAACTAGGCTGAAATTAAAGGG + Intergenic
945765794 2:213976397-213976419 AAAACCAGTCCTTAACTAACAGG + Intronic
1169889416 20:10436166-10436188 GCAACAAGGCCCTAAGTAACTGG - Intronic
1174719306 20:52794505-52794527 AAAACAAAGCCGTAAATAAGTGG + Intergenic
1178149041 21:29773163-29773185 AAAACAAAGCAGTAAGGAACAGG + Intronic
1181661456 22:24352910-24352932 GAATCTAGGCTGTAAGTAAGTGG - Intronic
1183183584 22:36278243-36278265 AAAATTGGGCCCTGAGTAACAGG + Intergenic
952099288 3:29992886-29992908 AAAACTAGGCTATAAAGAACTGG + Intronic
959527417 3:107392754-107392776 ATAACTAGCCAGAAAGTAACTGG - Intergenic
960879484 3:122330195-122330217 AAAACTAGCAAGTAAGTGACAGG - Intronic
963559488 3:146844416-146844438 AAAACTAGGATGTAAAAAACTGG + Intergenic
970475011 4:16413072-16413094 AAGACTAAACCGTAAGTACCAGG - Intergenic
976515475 4:85959435-85959457 AAAACGAGGCTGCAAGTTACTGG - Intronic
988856680 5:35233926-35233948 AAACCTAGGCCATTAGAAACTGG - Intergenic
991466432 5:66917622-66917644 TTAACTAGGACTTAAGTAACTGG - Intronic
1002956361 6:1869315-1869337 AAATCAAGGGCGTAAGTCACAGG + Intronic
1006421545 6:33937208-33937230 CATATTAGGCAGTAAGTAACAGG - Intergenic
1008086595 6:47251811-47251833 AAAACTAGGCTTTAAGTAGCTGG - Intronic
1008279620 6:49580674-49580696 AAAACTAGTCCTTAAATAAGAGG - Intergenic
1010275255 6:73961675-73961697 ATAACTAGTCCTTAAGTAAGAGG - Intergenic
1013675113 6:112450794-112450816 ACAACTAGGCTGAAAGTAAAAGG - Intergenic
1014268207 6:119306187-119306209 AAAATTTGTCTGTAAGTAACAGG - Intronic
1018292037 6:162301677-162301699 TAAACTAGGCTGTAAGTATTGGG - Intronic
1020378771 7:7518585-7518607 AAAATTAGGCAATAAGTAAGAGG - Intronic
1021273426 7:18620748-18620770 ATATCGGGGCCGTAAGTAACAGG - Intronic
1024298840 7:47869391-47869413 AAAATTAGGTTGTAAGTAAAAGG + Intronic
1057443112 9:95096269-95096291 AAACCTAGGCAGTGAGTAGCGGG + Intergenic
1058189877 9:101900363-101900385 AAAACCAGGCTGTATCTAACAGG - Intergenic
1190044547 X:47101495-47101517 TAAACTGGGCCGTAAGTCCCTGG - Intergenic
1194376520 X:93140655-93140677 AAAACTAGGTTGAAAGTAAAAGG - Intergenic