ID: 915468127

View in Genome Browser
Species Human (GRCh38)
Location 1:156109638-156109660
Sequence GTCAGCCTCATCTGCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915468122_915468127 22 Left 915468122 1:156109593-156109615 CCAGTTCTGCACTGGGCCTGTTA 0: 1
1: 0
2: 1
3: 12
4: 131
Right 915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 250
915468124_915468127 6 Left 915468124 1:156109609-156109631 CCTGTTACTTACGGCCTAGTTTT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 250
915468126_915468127 -8 Left 915468126 1:156109623-156109645 CCTAGTTTTAGGAAAGTCAGCCT 0: 1
1: 0
2: 1
3: 15
4: 124
Right 915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 250
915468121_915468127 23 Left 915468121 1:156109592-156109614 CCCAGTTCTGCACTGGGCCTGTT 0: 1
1: 0
2: 2
3: 18
4: 197
Right 915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 250
915468119_915468127 29 Left 915468119 1:156109586-156109608 CCTGGTCCCAGTTCTGCACTGGG 0: 1
1: 0
2: 1
3: 33
4: 320
Right 915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915468127 Original CRISPR GTCAGCCTCATCTGCAAAGC AGG Intronic
900351588 1:2237574-2237596 GTCAGCCTCCTCTCAACAGCTGG - Intronic
901714714 1:11144135-11144157 GGCAACCCCATCTGAAAAGCTGG + Intronic
902048643 1:13544441-13544463 TTAGGCCTCATCTGCACAGCAGG - Intergenic
902227267 1:15004334-15004356 ACCAGCCTCTTCTGCACAGCGGG - Intronic
902838570 1:19061551-19061573 ATCATCATCATCTGAAAAGCAGG + Intergenic
903000391 1:20261374-20261396 CTCAGCCTCATCTGAAAATGGGG + Intergenic
903321999 1:22548780-22548802 CTAGGCCTCCTCTGCAAAGCGGG + Intergenic
903791426 1:25895826-25895848 CTCAGAGCCATCTGCAAAGCTGG + Intronic
904476865 1:30770745-30770767 TTCAGCCTCATCTGCGAGTCTGG + Intergenic
904591720 1:31618680-31618702 TTCGGTCTCATCTGCAAAGCAGG + Intronic
905844532 1:41217613-41217635 GTCAGTCTCCTGTGCAATGCAGG - Intronic
905861511 1:41355127-41355149 GTCAGCCACTTCTGCAGGGCTGG + Intergenic
906689987 1:47786130-47786152 CTCAGGCTCATCTGCAGAGTGGG + Intronic
911349275 1:96733191-96733213 GTTAGCTTCATCTTCAAAGAAGG + Intronic
911957372 1:104254971-104254993 GTCACCCACATTTACAAAGCTGG - Intergenic
912681847 1:111733896-111733918 GCCAGGCTCATGGGCAAAGCTGG - Intronic
912734877 1:112141827-112141849 ATCAGCCTCATGATCAAAGCAGG + Intergenic
914417494 1:147497381-147497403 AGCTGCCTCATCTGCAAAACAGG - Intergenic
915325039 1:155077477-155077499 GTCAGCCTCAGGTGCTAGGCTGG - Intergenic
915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG + Intronic
915478822 1:156171151-156171173 TTCAACCTCATCTGCAAAATAGG - Intronic
915545904 1:156597666-156597688 TTTAGCCACATCTGCAAAGCAGG + Intronic
919745783 1:201008444-201008466 CTGAGCCTCATCTGCAAAATGGG - Intronic
920226570 1:204443416-204443438 GGCAGCCCCATCTGCAAGGCAGG - Exonic
921630382 1:217425476-217425498 GTCGGCCTCATCTGCATTCCAGG - Intergenic
923208090 1:231777854-231777876 AGCAGCCTCATCTGCAAAATGGG - Intronic
924591354 1:245407327-245407349 GACAGCCACAGCTGCAGAGCTGG - Intronic
924673551 1:246152804-246152826 CTCAGCCACATCTGCAAAATGGG + Intronic
1063202055 10:3793425-3793447 TTCAGTCTCATCTGTACAGCAGG - Intergenic
1065816039 10:29483352-29483374 TTCAGCCTCATTTGCTAAGAAGG + Intronic
1065956856 10:30701548-30701570 TTCAGCCTCATTTGCTAAGAAGG - Intergenic
1066243619 10:33561396-33561418 TTCTTCCTCATGTGCAAAGCAGG + Intergenic
1067213528 10:44281553-44281575 CTCAGCCTCATGGTCAAAGCAGG + Intergenic
1067325628 10:45263577-45263599 GTCAGTGTCCTCTGCAGAGCAGG - Intergenic
1068613711 10:59088849-59088871 GGCAGCCTCCTTTGCAATGCAGG - Intergenic
1070505913 10:77112521-77112543 GGCAGCCTCTCCTGCTAAGCGGG - Intronic
1070712621 10:78693806-78693828 CTCAGGGTCATCTGCAAAGGTGG - Intergenic
1072458407 10:95597380-95597402 TTCAGGCTCATCTGCAACTCGGG - Intergenic
1074057361 10:109934690-109934712 CTAAGCCTCATCTGTAAAGTGGG + Intergenic
1075593164 10:123707326-123707348 GGCAGCCTGATCAGCTAAGCTGG - Intronic
1075716420 10:124558369-124558391 GTCGCCCTCATCTGGAAAGTGGG - Intronic
1076121782 10:127942055-127942077 GTCAGCCTCCCCTGAAATGCAGG + Intronic
1076219193 10:128719413-128719435 TTCAGCCTCACCTGCAAGCCAGG + Intergenic
1077250915 11:1560286-1560308 ACCAGCCTCTTCTGCAAACCAGG - Intronic
1077330044 11:1980190-1980212 GCCATCCTCATCTGCAAAACGGG + Intronic
1077607651 11:3622904-3622926 TTCAGGGTCATCTACAAAGCAGG - Intergenic
1080662437 11:34308090-34308112 GGCCTCCTCATCTGCAAAACGGG + Intronic
1082855370 11:57801644-57801666 ATTACCCTCATCTGCAAAGGAGG - Intronic
1082888319 11:58111695-58111717 GTCAGCCCCAACTGCAACCCAGG - Intronic
1083287297 11:61668339-61668361 TTCAGACTCATCGGGAAAGCAGG - Intergenic
1083725477 11:64625776-64625798 GTCTTCCTCATCAGCCAAGCAGG + Intronic
1084488020 11:69462434-69462456 GTCTGTCTCATGTGCAAACCTGG + Intergenic
1084506456 11:69571415-69571437 GTCAACATCATATGAAAAGCTGG - Intergenic
1085369891 11:75992077-75992099 ATCATCCTCATCTGCAAACTGGG - Intronic
1085523607 11:77152000-77152022 GCCTCTCTCATCTGCAAAGCGGG + Intronic
1086837805 11:91647283-91647305 GGCAGCCTTATCTGTAATGCAGG - Intergenic
1087786591 11:102361560-102361582 GTCAGTGTCCTCTGCAAAGTAGG + Intronic
1088888993 11:114030146-114030168 TTCAGCCTCATCTGGAAGGCAGG - Intergenic
1089082358 11:115787453-115787475 CCCAGCTCCATCTGCAAAGCTGG + Intergenic
1090252191 11:125259571-125259593 GTCAGCCTCATGTGGGGAGCAGG - Intronic
1090269277 11:125374569-125374591 GTCAGCATCAGTTGCAAGGCTGG - Intronic
1090493442 11:127187218-127187240 GCGAGCCTCATCTGCAAAATGGG - Intergenic
1090908375 11:131096885-131096907 GCCAGCCTCAGGTGGAAAGCAGG - Intergenic
1202813021 11_KI270721v1_random:35369-35391 GCCATCCTCATCTGCAAAACGGG + Intergenic
1091680449 12:2523082-2523104 TTCAGCCTAATATGCAAAGCAGG + Intronic
1091800166 12:3320079-3320101 GGCCTCCTCATCTGTAAAGCAGG + Intergenic
1095317250 12:40780120-40780142 ATCAGCCGTATCTCCAAAGCAGG - Intronic
1095383078 12:41617627-41617649 TTCAGATTCATCTGCAAAGTGGG + Intergenic
1095647827 12:44569997-44570019 ACAAGCCTCATCTGAAAAGCAGG + Intronic
1095691072 12:45089321-45089343 GTTAGCATCATCTGGCAAGCAGG - Intergenic
1096894121 12:54802952-54802974 GTCAGTCTCGTCTGGACAGCAGG - Intergenic
1097585473 12:61510590-61510612 CTCAGTGTCATCTGTAAAGCAGG + Intergenic
1098657385 12:73050261-73050283 GTTAGCTTCATCTGAAAAGATGG - Intergenic
1101405398 12:104424203-104424225 ATCAGCCTCCCTTGCAAAGCTGG - Intergenic
1102410850 12:112717069-112717091 GTGAGCCTCATCTGGAAAATGGG - Intronic
1102530696 12:113544383-113544405 GTCCTCCTCATCTGTAAAGTGGG - Intergenic
1106671446 13:31910258-31910280 GTCAGCATCTTCTCAAAAGCAGG + Intergenic
1108257390 13:48623756-48623778 GGCATCTTCATGTGCAAAGCAGG - Intergenic
1108338505 13:49472172-49472194 GTCATCCTCTTCTGAAAGGCAGG - Intronic
1113696637 13:112350633-112350655 TGCTGCCTCATCTGCACAGCGGG - Intergenic
1113728658 13:112624352-112624374 GTCTGTCTGAGCTGCAAAGCTGG - Intergenic
1114058552 14:18998923-18998945 GGCATCGTCACCTGCAAAGCCGG - Intronic
1114103995 14:19402831-19402853 GGCATCGTCACCTGCAAAGCCGG + Exonic
1114461617 14:22889760-22889782 GGGAGCCTCAGATGCAAAGCTGG - Intergenic
1115352675 14:32412308-32412330 CTCAGACTCTTCTGCATAGCAGG - Intronic
1115445860 14:33488702-33488724 GTTAGCCTGAGCTGGAAAGCTGG + Intronic
1119759849 14:77142458-77142480 CTCAGCCTGATCTGTGAAGCTGG + Intronic
1119890846 14:78181049-78181071 AACAGCCTCTCCTGCAAAGCAGG + Intergenic
1121620669 14:95345973-95345995 GTCAGCTTCATCTGGAGAGGTGG + Intergenic
1122830021 14:104391312-104391334 GGCTCCCTCATCTGTAAAGCAGG - Intergenic
1122905284 14:104798839-104798861 GTAATCCTCATCTGCAAAATGGG - Intergenic
1124992067 15:34684880-34684902 GTTAGCCTCATCTCCCAAACAGG - Intergenic
1125538912 15:40458712-40458734 ATCAGCCTCATCTGCACTCCGGG - Exonic
1125749836 15:42020762-42020784 GGCAGCCTCATCTTAAAACCTGG - Intronic
1125979861 15:43990107-43990129 GGCATCGTCACCTGCAAAGCTGG + Intronic
1128110640 15:65074034-65074056 GGGATGCTCATCTGCAAAGCAGG + Intronic
1128655129 15:69455191-69455213 GGGAGCCTCATCTGCAATGTAGG + Exonic
1128760962 15:70215651-70215673 GTCAGCCTTATGTCCAAAGCTGG - Intergenic
1129701966 15:77773421-77773443 ACCAGCCTCATCTGTAAAGTCGG - Intronic
1130848468 15:87769473-87769495 GTAAGCCTCATAAGCAAAGGAGG + Intergenic
1131738431 15:95359856-95359878 GTCAGCCTCACCCAGAAAGCAGG - Intergenic
1135149921 16:19996443-19996465 TTTAGTCTCATCTGCAAAGTGGG + Intergenic
1135967925 16:27051403-27051425 GTCATCATCATCTGCAACGTGGG + Intergenic
1139465963 16:67154403-67154425 GTGAGGCTGATCTCCAAAGCAGG + Exonic
1140322624 16:73968257-73968279 TTTAGCCAAATCTGCAAAGCAGG - Intergenic
1142626164 17:1193450-1193472 TTGAGCCTCTTCTGTAAAGCGGG - Intronic
1147787697 17:42991537-42991559 GTGAACCTCATCTGCAAGTCCGG + Exonic
1147982672 17:44284229-44284251 TTCTGCCTCATCTGCCCAGCAGG + Intergenic
1149624038 17:58067005-58067027 GTGGGCCTCATCTGCAAAGGAGG + Intergenic
1150490653 17:65572297-65572319 GTCTTCCTTATCTGAAAAGCTGG - Intronic
1150654142 17:67028706-67028728 GTCAGTCTCATCTGTAAAGTGGG - Intronic
1150788011 17:68178275-68178297 GTCAGCCTCATCTGGGAAATGGG + Intergenic
1150880926 17:69026986-69027008 GTCAGCCTCATCTATAAACTGGG + Exonic
1151627048 17:75283429-75283451 CTCACCCTGAGCTGCAAAGCGGG + Exonic
1151886521 17:76926069-76926091 CTGAGCCTCCTCTGCAAGGCTGG - Intronic
1152064418 17:78102601-78102623 GACAGCCTCATCTGCATTGGGGG - Intronic
1152306891 17:79526319-79526341 GCCAGCCTCATCTACGAAACGGG + Intergenic
1152799656 17:82324863-82324885 GACAGCCCCATCTGCACAGAGGG - Exonic
1152966518 18:120261-120283 GTCACCCACATCTTCCAAGCAGG + Intergenic
1156624043 18:38886995-38887017 GTCAGCCTCATCTCCACAAGGGG - Intergenic
1157081314 18:44528662-44528684 GCTAACCTCATCTGCAAAGTTGG + Intergenic
1157248541 18:46073497-46073519 GTCATCCACAACTGCAAAGATGG + Intergenic
1157554090 18:48601513-48601535 GCCAGCCTCATCTGTAAACATGG + Intronic
1160591764 18:79948956-79948978 GCCAGCCACGTCTCCAAAGCAGG + Intronic
1161838794 19:6665966-6665988 GTTTCCCTCCTCTGCAAAGCAGG - Intronic
1162828247 19:13267634-13267656 GTTATCCTCATCTGCAAAACAGG + Intronic
1163522448 19:17799575-17799597 AGCATCCTCCTCTGCAAAGCTGG - Intronic
1163735329 19:18976713-18976735 GTTAACCACATCTGCAAGGCCGG - Intergenic
1165800723 19:38548059-38548081 GTCAGCCTCCTGTGCCAACCTGG - Intronic
1166282041 19:41800693-41800715 CTCTGCCTCATCTGCCAGGCAGG + Intronic
1166352622 19:42207245-42207267 TGCTGCCTCATCTACAAAGCAGG + Intronic
1166717318 19:44976826-44976848 GTTTGCCTCATCTGCAAAATGGG + Intronic
1166889373 19:45981153-45981175 ATCATCCTCATCTGTAAATCGGG - Intergenic
1167041765 19:47027048-47027070 CTCAGCCTCATCTGTAAAATGGG - Intronic
1167711648 19:51115406-51115428 GTCAGACCCCTCTGCAGAGCCGG + Intergenic
1168406194 19:56111866-56111888 AGCTGCCTCCTCTGCAAAGCAGG + Intronic
1168689912 19:58369918-58369940 GGCAGCCTCATCTACAAAATGGG + Exonic
926132125 2:10310142-10310164 GTCTGCCACATCTGCAGACCTGG - Intronic
926459977 2:13117058-13117080 CTCAGCTTCATCTGCAAATTGGG + Intergenic
926709839 2:15870107-15870129 GGGAGCCTCATCTGCAATGTAGG + Intergenic
927102803 2:19800877-19800899 GTGCTCCTCATCTGCAAAACGGG - Intergenic
927210812 2:20638028-20638050 GGCTGCATCATCTGCATAGCAGG - Intronic
932438945 2:71719667-71719689 CTCAGCCTCATTTGAAAAGAGGG - Intergenic
933421536 2:82052650-82052672 ATCAGCCTGATATCCAAAGCTGG - Intergenic
935095965 2:99944559-99944581 GTCAGCCTCACCTTCCATGCAGG + Intronic
937459052 2:122069833-122069855 TTCAGCCTCCTCTGCAAAGGTGG + Intergenic
938257316 2:129869317-129869339 GCCAGCCTCATCCTCAAGGCTGG - Intergenic
938307997 2:130267697-130267719 GAGAGTCTCATCTGCAAAACAGG - Intergenic
938447332 2:131389139-131389161 GAGAGTCTCATCTGCAAAACAGG + Intergenic
941447793 2:165624093-165624115 TTCATCCTCGTCTGTAAAGCAGG + Intronic
941461783 2:165780610-165780632 TTCAGATTCATCTGCAAATCAGG + Intronic
941494190 2:166180817-166180839 GTCATCCTCTTCGGCAGAGCGGG + Intergenic
941792053 2:169563081-169563103 GTTATCCTCATCTGCAAAAGAGG - Intronic
942233933 2:173885960-173885982 GCTAGCCTTATCTGCTAAGCAGG + Intergenic
942465240 2:176201062-176201084 GGGAGCCTCATCTGCAATGTAGG - Intergenic
946662637 2:222018060-222018082 GACTGCCTCATCTGCAAGACAGG + Intergenic
947735127 2:232450296-232450318 GGCAGGCTCATGTGCAGAGCTGG - Intergenic
948094876 2:235325458-235325480 GGCAGCCTCAACTGCCAGGCTGG - Intergenic
948908940 2:240993510-240993532 TTCCTCCTCATCTGCAAACCAGG - Intergenic
1172128245 20:32638316-32638338 CCCAGCCTCATCTGCAAAATGGG - Intergenic
1172175739 20:32970866-32970888 GCTAGCCTCATCTGCAAAACTGG + Intergenic
1172751802 20:37256659-37256681 GTCTGCCTCCTCTGCAAGGACGG + Intronic
1172770991 20:37382607-37382629 AGCGTCCTCATCTGCAAAGCAGG - Exonic
1173002118 20:39111890-39111912 GGCAGCCTCCACTGGAAAGCTGG - Intergenic
1173025226 20:39301376-39301398 GTCATCACCATCTGCAAAGATGG - Intergenic
1174339238 20:49885761-49885783 GGCATTCTCATCTGCAAAGTGGG - Intronic
1175297348 20:57918088-57918110 GTCAGCCCCATCAGCACAGAGGG - Intergenic
1175877588 20:62237775-62237797 CTCAGTTTCATCTGCAAACCAGG - Intronic
1175926488 20:62474046-62474068 GTCCTCCTGTTCTGCAAAGCGGG + Intronic
1176950045 21:15033731-15033753 CTCAGCCTCATCTGTAAAATTGG - Intronic
1178312441 21:31540567-31540589 GAGAGCCTCATCTGCAGAGATGG - Intronic
1180027956 21:45179184-45179206 GGCAGCGGCATCTGCAATGCAGG - Intronic
1180477037 22:15721542-15721564 GGCATCGTCACCTGCAAAGCCGG - Intronic
1181306481 22:21920038-21920060 GTCAGCCACACCTGTAAGGCAGG + Exonic
1181592030 22:23891385-23891407 GTCCCCTTCATCTTCAAAGCCGG + Intronic
1181918583 22:26301112-26301134 ATGAGCCTCATCTGCAAAATGGG - Intronic
1181931640 22:26406357-26406379 GTCAGCCTCATCTGAGCAGCTGG + Intergenic
1182782688 22:32880715-32880737 GTTATCCTCATCTGCAAAATGGG - Intronic
1183300943 22:37058934-37058956 GTCAGCCACATCTGGAATGGGGG + Intronic
1183911364 22:41081927-41081949 GTCAGCCTTTCCTGCACAGCAGG - Intergenic
1184310436 22:43637736-43637758 GACAGGCTCCTCTGCAGAGCTGG - Intronic
1184322826 22:43756186-43756208 GTCAGTCTCCTCGGTAAAGCAGG - Intronic
1184552453 22:45211777-45211799 GACAGTCTCATGTGCAAATCTGG - Intronic
1185242475 22:49754137-49754159 CTCAGCCTCCTCCACAAAGCAGG + Intergenic
949908617 3:8881090-8881112 GTCTACCTCCTCTGCAAAGCTGG + Exonic
951615679 3:24540884-24540906 GCCAGCCCCAGATGCAAAGCTGG - Intergenic
951825835 3:26867148-26867170 CTCAGCCTCCTCTGGAAAGCAGG - Intergenic
953676752 3:45008547-45008569 GTCCCCCTCATCTGCAAAGTGGG + Intronic
954442858 3:50531166-50531188 CTGGGGCTCATCTGCAAAGCAGG + Intergenic
955316272 3:57941771-57941793 GGCAGCAGCATCTGCAAACCTGG - Intergenic
956857544 3:73290379-73290401 GTCTTCCTCATCTGTAAAGTGGG + Intergenic
959908143 3:111732848-111732870 ATCAGCCTGTTCTGGAAAGCAGG + Intronic
959969964 3:112398432-112398454 TTCAGCCTTCTCTCCAAAGCAGG - Intergenic
960122296 3:113959030-113959052 CTCAGGGTCATCTGCAAAGTGGG + Intronic
960521706 3:118662628-118662650 GACAGCCCCATCTGCTAGGCAGG + Intergenic
961535507 3:127568240-127568262 GACAGTCTCATCTTCAAAGCTGG - Intergenic
962696100 3:137948819-137948841 ATCATCCTCATCTTCAAAGAAGG + Intergenic
963851331 3:150213370-150213392 GTCTTCCTCACCTGCAAAGTGGG - Intergenic
964681963 3:159351281-159351303 GACTTCCTCATCTGCAAAACAGG - Intronic
964766276 3:160181133-160181155 GTCCTCCTCATCTGAAAAACTGG - Intergenic
966333861 3:178846400-178846422 GTCAGCATGATATGCACAGCAGG + Intergenic
966441453 3:179949721-179949743 GGGAGCCTCATCTGACAAGCAGG + Intronic
967589122 3:191251733-191251755 ATCAGCATCATCTTCAAAACAGG + Intronic
969226311 4:5800716-5800738 CTCTGCCCCATCTGCAAAGGGGG - Intronic
969870247 4:10100078-10100100 CTCAGCCCCATCTGCTAAGCAGG + Intronic
971427339 4:26529575-26529597 GTCGGGCTCCTCTCCAAAGCCGG + Intergenic
973025603 4:45266208-45266230 GGCAGCCTCATCTTTATAGCAGG - Intergenic
974814634 4:66988996-66989018 GTCAGGATCAGCTGCAGAGCTGG + Intergenic
975217069 4:71768322-71768344 GTCAGCCCCTTCCGCACAGCAGG + Exonic
979007217 4:115315090-115315112 ATCAGGCTCACATGCAAAGCTGG - Intergenic
985971429 5:3381363-3381385 GTCAGCCTCAGCTCCAGACCAGG - Intergenic
988708755 5:33752782-33752804 TTCAGACTCATCTGCAGAGCAGG - Intronic
990066069 5:51716336-51716358 ATGTTCCTCATCTGCAAAGCAGG + Intergenic
993304854 5:86264349-86264371 GTATCCCTCATCTGAAAAGCTGG - Intergenic
995218369 5:109620786-109620808 GAGAACCTCATCTGCAGAGCAGG - Intergenic
999462047 5:151766050-151766072 GGAAGCCTCATCTGCAATGTAGG - Intronic
999593729 5:153178715-153178737 GCCAGAGTCATCTGCCAAGCAGG + Intergenic
999697613 5:154200343-154200365 GTCAGCCTCCTCTGAGAGGCGGG + Intronic
1002093618 5:176818289-176818311 CTCGGCCTCATCTGTAAAACGGG - Intronic
1002442729 5:179272793-179272815 CTCAGCCTCAGCAGCCAAGCTGG + Intronic
1003331241 6:5130330-5130352 GTGAGCTTTATCTGCCAAGCAGG + Intronic
1003683616 6:8279634-8279656 CAGAGCCTCATCTGCAATGCAGG - Intergenic
1004748457 6:18536488-18536510 GTCAGCCTCATCTGGGGAGGGGG + Intergenic
1006006926 6:31010162-31010184 GTATGCCTCATTTTCAAAGCAGG - Intergenic
1008613357 6:53204350-53204372 GTCAGCCTCACCTGCAGCCCTGG - Intergenic
1008695505 6:54031614-54031636 TTCAGCCACATCTGGAGAGCTGG + Intronic
1009662225 6:66629033-66629055 GTCAACTTCCTCTTCAAAGCTGG - Intergenic
1011931257 6:92716890-92716912 GGCTGCCTCATCTGCAAATTAGG + Intergenic
1012841736 6:104337321-104337343 GTTTTCCTCATCTGCAAAACTGG + Intergenic
1015732689 6:136364305-136364327 GGGAGCCTCATCTGCAATGGAGG + Intronic
1019124619 6:169830006-169830028 GTGAGCCTCAGCTGCAGGGCTGG + Intergenic
1019490275 7:1309958-1309980 GTCAGTCTCATCTGTAAAATAGG - Intergenic
1019510328 7:1414443-1414465 GTTAGCCTCATCTGGAAAATGGG + Intergenic
1019603148 7:1895322-1895344 CTCTGCCTCATCTGTAAAGCAGG - Intronic
1019869484 7:3745999-3746021 GTTTCCCTCATCTGTAAAGCAGG + Intronic
1021095215 7:16527678-16527700 CTCTGACTCATCTGCAAAGATGG + Intronic
1021315451 7:19143679-19143701 TTCAACCTCATCTGCATGGCAGG + Intergenic
1021885766 7:25137200-25137222 GTCAGAATCATCTGCAGAGCTGG + Intronic
1026300794 7:69096365-69096387 GGCAACCTCAGTTGCAAAGCAGG - Intergenic
1028465244 7:91143850-91143872 CTCAGTCTCCTCTGCAAAACGGG - Intronic
1028652246 7:93162460-93162482 GTCATCCTCATCTGAATAGATGG - Intergenic
1032036609 7:128526086-128526108 GCCAGCCTCACCTGGAAAGTTGG + Intergenic
1033704875 7:143876718-143876740 GTCAGCCTCATCTGCATAGTGGG - Intronic
1037001477 8:13724269-13724291 GTGAGCCTCTTCTGCAAAACAGG + Intergenic
1038507454 8:28097230-28097252 GTCAGCATCATCAGCTCAGCAGG - Exonic
1039449769 8:37663004-37663026 GTCATACTTATCTCCAAAGCAGG + Intergenic
1042012378 8:64261747-64261769 CTCAGCATCATCTGGAAAGAGGG + Intergenic
1043562373 8:81508972-81508994 GACAGTGTCTTCTGCAAAGCAGG - Intergenic
1045420841 8:102013492-102013514 GTCACCCTTAGCTGCAAAGGAGG - Intronic
1045510448 8:102808697-102808719 GTCACCATCCTCTGCAACGCTGG + Intergenic
1045550345 8:103165784-103165806 GTGTGGCTCATCTGCCAAGCAGG - Intronic
1046839688 8:118842624-118842646 CTCAGCCTCATCTCCAACACTGG - Intergenic
1047514678 8:125543660-125543682 GTCATCTTCATCTGCAAAACAGG + Intergenic
1048390367 8:133957918-133957940 GTCAGCCTCATGTGAGAATCAGG + Intergenic
1048416210 8:134230314-134230336 TCCAGCCTTTTCTGCAAAGCAGG + Intergenic
1049396505 8:142403398-142403420 GTCATCCCCATATGCAAAACGGG - Intergenic
1051250379 9:15152889-15152911 GTCAGCCCCATCTGCTCAGGAGG - Intergenic
1052934478 9:34081491-34081513 CTCAGCCTCCTCTGAATAGCTGG - Intergenic
1053418526 9:37962095-37962117 AGCTGCCTCATCTGCAAACCAGG + Intronic
1053883241 9:42616718-42616740 GCCAGGCTCACCTGCCAAGCTGG - Intergenic
1053889428 9:42677581-42677603 GCCAGGCTCACCTGCCAAGCTGG + Intergenic
1054222265 9:62424191-62424213 GCCAGGCTCACCTGCCAAGCTGG - Intergenic
1054228448 9:62484981-62485003 GCCAGGCTCACCTGCCAAGCTGG + Intergenic
1056442754 9:86636942-86636964 GGCCTCCTCATCTGCAAAACGGG + Intergenic
1056817741 9:89813688-89813710 GGCAGCCTCCCCTGTAAAGCTGG - Intergenic
1060293874 9:122330013-122330035 TTCAACCTCATCTGCTAAGTCGG + Intergenic
1202798929 9_KI270719v1_random:155046-155068 GTTATCCTCATCTGCCATGCTGG + Intergenic
1187392986 X:18897725-18897747 CTCAGTCTCATCTGCACAGTGGG + Intronic
1187770435 X:22690028-22690050 TTTAGCATCATCTGCAAAGTTGG - Intergenic
1190492068 X:50992184-50992206 GTCAGCTTCATTTAAAAAGCAGG - Intergenic
1190501094 X:51079496-51079518 GTCAGCTTCATTTAAAAAGCAGG + Intergenic
1192808405 X:74529430-74529452 ATCAGCCTCACCTGCAATGGGGG - Exonic
1195035710 X:100970182-100970204 ATCAGCTTCATGTGCAAAACTGG + Intronic
1197727425 X:129785757-129785779 CTCAGCCTGATCTGCAGACCAGG - Intronic
1198686622 X:139234416-139234438 CTCAGCCTCACCTGCAAAATAGG - Intergenic
1201667785 Y:16478525-16478547 GACAGCATTATCTGCAGAGCTGG + Intergenic