ID: 915468127

View in Genome Browser
Species Human (GRCh38)
Location 1:156109638-156109660
Sequence GTCAGCCTCATCTGCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915468121_915468127 23 Left 915468121 1:156109592-156109614 CCCAGTTCTGCACTGGGCCTGTT 0: 1
1: 0
2: 2
3: 18
4: 197
Right 915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 250
915468124_915468127 6 Left 915468124 1:156109609-156109631 CCTGTTACTTACGGCCTAGTTTT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 250
915468126_915468127 -8 Left 915468126 1:156109623-156109645 CCTAGTTTTAGGAAAGTCAGCCT 0: 1
1: 0
2: 1
3: 15
4: 124
Right 915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 250
915468119_915468127 29 Left 915468119 1:156109586-156109608 CCTGGTCCCAGTTCTGCACTGGG 0: 1
1: 0
2: 1
3: 33
4: 320
Right 915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 250
915468122_915468127 22 Left 915468122 1:156109593-156109615 CCAGTTCTGCACTGGGCCTGTTA 0: 1
1: 0
2: 1
3: 12
4: 131
Right 915468127 1:156109638-156109660 GTCAGCCTCATCTGCAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915468127 Original CRISPR GTCAGCCTCATCTGCAAAGC AGG Intronic