ID: 915468128

View in Genome Browser
Species Human (GRCh38)
Location 1:156109639-156109661
Sequence TCAGCCTCATCTGCAAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 7, 3: 43, 4: 390}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915468121_915468128 24 Left 915468121 1:156109592-156109614 CCCAGTTCTGCACTGGGCCTGTT 0: 1
1: 0
2: 2
3: 18
4: 197
Right 915468128 1:156109639-156109661 TCAGCCTCATCTGCAAAGCAGGG 0: 1
1: 0
2: 7
3: 43
4: 390
915468119_915468128 30 Left 915468119 1:156109586-156109608 CCTGGTCCCAGTTCTGCACTGGG 0: 1
1: 0
2: 1
3: 33
4: 320
Right 915468128 1:156109639-156109661 TCAGCCTCATCTGCAAAGCAGGG 0: 1
1: 0
2: 7
3: 43
4: 390
915468124_915468128 7 Left 915468124 1:156109609-156109631 CCTGTTACTTACGGCCTAGTTTT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 915468128 1:156109639-156109661 TCAGCCTCATCTGCAAAGCAGGG 0: 1
1: 0
2: 7
3: 43
4: 390
915468126_915468128 -7 Left 915468126 1:156109623-156109645 CCTAGTTTTAGGAAAGTCAGCCT 0: 1
1: 0
2: 1
3: 15
4: 124
Right 915468128 1:156109639-156109661 TCAGCCTCATCTGCAAAGCAGGG 0: 1
1: 0
2: 7
3: 43
4: 390
915468122_915468128 23 Left 915468122 1:156109593-156109615 CCAGTTCTGCACTGGGCCTGTTA 0: 1
1: 0
2: 1
3: 12
4: 131
Right 915468128 1:156109639-156109661 TCAGCCTCATCTGCAAAGCAGGG 0: 1
1: 0
2: 7
3: 43
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915468128 Original CRISPR TCAGCCTCATCTGCAAAGCA GGG Intronic
900607064 1:3528520-3528542 TCAGTCCCATCTGCAAAGGTAGG - Intronic
900869713 1:5293305-5293327 GCAGCCTCTTCTTCAAAGCCTGG + Intergenic
901667441 1:10834856-10834878 CCAGCCTCCTCTGCAATGCGAGG - Intergenic
902127481 1:14228312-14228334 GCTTCCTCATCTGAAAAGCAAGG - Intergenic
902387237 1:16082921-16082943 GCTTCCTCACCTGCAAAGCAAGG + Intergenic
902838571 1:19061552-19061574 TCATCATCATCTGAAAAGCAGGG + Intergenic
904211872 1:28891165-28891187 GTTGCCTCATCTGTAAAGCATGG + Intronic
904356910 1:29946295-29946317 TCAGATTCATCGGCACAGCAGGG + Intergenic
904417648 1:30372995-30373017 GCTGCCTCATCTGCAAAGTGAGG + Intergenic
904591721 1:31618681-31618703 TCGGTCTCATCTGCAAAGCAGGG + Intronic
904804369 1:33120401-33120423 TCTGCCTCCTCTGCAGTGCAAGG + Intronic
904967006 1:34381934-34381956 TCAGCCTCATCTGAAACAGATGG - Intergenic
905004099 1:34696455-34696477 GCAGCCTCCTCAGCACAGCAAGG + Intergenic
905533953 1:38704103-38704125 TCAACCTAATCTTTAAAGCAGGG - Intergenic
906860372 1:49352821-49352843 TTAGCCTCATCTGTAAAATAAGG - Intronic
907123985 1:52033166-52033188 TCAGAGAAATCTGCAAAGCATGG - Exonic
907333875 1:53688025-53688047 TCAGCCTCGACAGCACAGCACGG - Intronic
908104321 1:60825698-60825720 TGAGCCTCCTCTGTAATGCAAGG - Intergenic
913202257 1:116504492-116504514 ACAGCCTCAGCTGCTAATCATGG - Intergenic
914887490 1:151597368-151597390 TTAGCCTCATCTGCAAACTTCGG + Intergenic
914985125 1:152449867-152449889 TCAGCCTCCTCTAGAAGGCAGGG - Intergenic
915468128 1:156109639-156109661 TCAGCCTCATCTGCAAAGCAGGG + Intronic
915545905 1:156597667-156597689 TTAGCCACATCTGCAAAGCAGGG + Intronic
915584592 1:156837514-156837536 TCTGCCTCCTGTGCAAAGAAAGG + Intronic
916603942 1:166322643-166322665 TCAGGCTCATTTGCAGACCAAGG - Intergenic
918645564 1:186900253-186900275 GCATCCTCATCTGTAAAACAGGG + Intronic
919745782 1:201008443-201008465 TGAGCCTCATCTGCAAAATGGGG - Intronic
919823347 1:201486574-201486596 GCTGCCTCCTCTGTAAAGCAGGG + Intronic
919876212 1:201870752-201870774 CCACCCTCATCTCCAAGGCAGGG + Exonic
921261598 1:213389375-213389397 GCTGCCTCCTCTGCCAAGCAAGG - Intergenic
922338980 1:224640447-224640469 CCAACCTCCTCTGCAAAGAAAGG - Intronic
922897763 1:229113710-229113732 GCATCCTCATCTGTAAAGCGAGG - Intergenic
922933422 1:229407444-229407466 TCTGCCACATCTGTAAAGCAAGG - Intergenic
923968123 1:239166999-239167021 TCAGAGTGTTCTGCAAAGCAAGG + Intergenic
924673552 1:246152805-246152827 TCAGCCACATCTGCAAAATGGGG + Intronic
1063003837 10:1949806-1949828 GCAGCCTCATTTTCAGAGCAGGG - Intergenic
1063202054 10:3793424-3793446 TCAGTCTCATCTGTACAGCAGGG - Intergenic
1064718459 10:18202530-18202552 ACATTCTCATCTGTAAAGCAAGG + Intronic
1065622210 10:27593915-27593937 TCAGCCTCATCTCCAATTCACGG + Intergenic
1065666258 10:28064996-28065018 TAAGCCTAAACTCCAAAGCAGGG - Intronic
1065956855 10:30701547-30701569 TCAGCCTCATTTGCTAAGAAGGG - Intergenic
1067673381 10:48346852-48346874 TCTGCCTCAGCTGCCAGGCAGGG + Intronic
1068613710 10:59088848-59088870 GCAGCCTCCTTTGCAATGCAGGG - Intergenic
1069832853 10:71291617-71291639 TCAGCCCCATCTGCCAGGCCTGG - Exonic
1069941192 10:71956623-71956645 TCTGCCTCAGCTGCCAAACAGGG + Intergenic
1070554033 10:77514431-77514453 TCAGCCTCTTCCTCCAAGCAGGG + Intronic
1070712620 10:78693805-78693827 TCAGGGTCATCTGCAAAGGTGGG - Intergenic
1070821066 10:79354848-79354870 TGAGCCTCATCTCTAAGGCAGGG - Exonic
1070852958 10:79582810-79582832 TAAGCCTCAGCTGCAGAGCCTGG + Intergenic
1070888122 10:79922495-79922517 TAAGCCTCAGCTGCAGAGCCTGG - Intergenic
1072697409 10:97614076-97614098 TGAGCCTCATCTGTAATACAGGG + Intronic
1072753532 10:98001372-98001394 GTTTCCTCATCTGCAAAGCAGGG + Intronic
1074543709 10:114386498-114386520 GCAGCAGCAGCTGCAAAGCAAGG + Intronic
1074792009 10:116898774-116898796 TCACCAACATATGCAAAGCAAGG - Intronic
1075314330 10:121439807-121439829 TTCTCCTCATCTGCAAAACAGGG - Intergenic
1075515310 10:123103665-123103687 TGAGCCTCATCTGAAAATGAAGG + Intergenic
1075887257 10:125911772-125911794 TCTTCCTCATCTGCACAACATGG + Intronic
1076121783 10:127942056-127942078 TCAGCCTCCCCTGAAATGCAGGG + Intronic
1076159493 10:128232440-128232462 TAGGCCTCATCTGTAAAACAGGG - Intergenic
1076219194 10:128719414-128719436 TCAGCCTCACCTGCAAGCCAGGG + Intergenic
1076628750 10:131839889-131839911 TCTGCCTCAGCTGCCAGGCAGGG - Intergenic
1077330046 11:1980191-1980213 CCATCCTCATCTGCAAAACGGGG + Intronic
1079345244 11:19646117-19646139 TCAACCCCATTTGCAAAGCCAGG - Intronic
1079717298 11:23764467-23764489 GCAGCCTCATCTACATAACAAGG - Intergenic
1079817815 11:25084379-25084401 GCAGCCTCTCCTGCAAAGCCCGG + Intergenic
1079978267 11:27120468-27120490 TCAGCCTCATCTGAATCACACGG + Intronic
1080135230 11:28846202-28846224 TGATCCTCATTTGCAAAGTAGGG - Intergenic
1080791029 11:35522802-35522824 TGAACCTCATCTGTAAAACACGG + Intronic
1083168296 11:60905690-60905712 GCATCCTCATCTGCAAAACCAGG + Intronic
1083195505 11:61083441-61083463 TTTACTTCATCTGCAAAGCAGGG - Intergenic
1083287296 11:61668338-61668360 TCAGACTCATCGGGAAAGCAGGG - Intergenic
1083290870 11:61689263-61689285 TCAGCCTCATCTGCAGAGGCTGG + Intronic
1083349441 11:62017007-62017029 TCTGCCTCAGCTGCCAGGCAGGG + Intergenic
1083605988 11:63979250-63979272 TCAGCCTCATATACAAAGTCTGG - Intronic
1083992079 11:66252619-66252641 GCTTCCTCATCTGTAAAGCAGGG - Intergenic
1084028807 11:66468656-66468678 TCATCCCCATTTGCAAAACAGGG - Intronic
1084457360 11:69275754-69275776 GTATCCTCATCTGCAAAACAGGG + Intergenic
1084692993 11:70737704-70737726 TCAGCCCCATCTGGAATGCGAGG + Intronic
1085732687 11:79012915-79012937 TCAGTGTCATCTGCAAAAGAGGG - Intronic
1085806974 11:79645270-79645292 TCAGCCTCATGTTCAAAATATGG - Intergenic
1086249923 11:84800518-84800540 GCATCCTTATCTGCAAAACAAGG - Intronic
1088559699 11:111100942-111100964 TGTGCCTCATCTGTAAAGCAAGG + Intergenic
1088888992 11:114030145-114030167 TCAGCCTCATCTGGAAGGCAGGG - Intergenic
1089062880 11:115640512-115640534 GCAGCCTGATCTCCAAAGCCTGG + Intergenic
1090252190 11:125259570-125259592 TCAGCCTCATGTGGGGAGCAGGG - Intronic
1090908373 11:131096884-131096906 CCAGCCTCAGGTGGAAAGCAGGG - Intergenic
1091306837 11:134541732-134541754 TCAGATTCATCTGCAAAACAAGG - Intergenic
1202813023 11_KI270721v1_random:35370-35392 CCATCCTCATCTGCAAAACGGGG + Intergenic
1091457058 12:615836-615858 TCAGGGTCATCTGACAAGCAAGG + Intronic
1091800167 12:3320080-3320102 GCCTCCTCATCTGTAAAGCAGGG + Intergenic
1092224949 12:6742232-6742254 TCTGCCTCAGCTGCCAGGCAGGG + Intergenic
1094364695 12:29667918-29667940 TCCGCCTCATTTGCAAGACAGGG - Intronic
1096160214 12:49370162-49370184 TGAGCCTCATCTGAAAAATAAGG - Intronic
1096197318 12:49657022-49657044 TCTGCCTCATCTGCAAAACCAGG - Intronic
1096878283 12:54647150-54647172 TCTGGATCATCTGCAAAGGAGGG + Exonic
1097089978 12:56497287-56497309 TCTGCCTCAGCTGCCAGGCAGGG + Intergenic
1097090529 12:56500983-56501005 TCTGCCTCAGCTGCCAGGCAGGG - Intergenic
1097585474 12:61510591-61510613 TCAGTGTCATCTGTAAAGCAGGG + Intergenic
1097789232 12:63796586-63796608 TAGGCCTCATCTTCAGAGCAAGG + Intronic
1098935344 12:76472645-76472667 TCTGCCTCAGCTGCCAGGCAGGG - Intronic
1101405397 12:104424202-104424224 TCAGCCTCCCTTGCAAAGCTGGG - Intergenic
1101860064 12:108475528-108475550 TCAGCATCTGCTGCAAACCAGGG - Intergenic
1102196106 12:111026214-111026236 TTAGTCTCATCAGCAAAACATGG - Intergenic
1103955394 12:124573678-124573700 TCAACCTCATGTGCTAAGCAAGG + Intergenic
1104319664 12:127738678-127738700 CCAGCCTCATGTGCAAACCCAGG - Intergenic
1104404491 12:128506246-128506268 TCAGCATCATCTGCATTACATGG + Intronic
1105856367 13:24376095-24376117 TCTGCCTCAGCTGCCAGGCAGGG + Intergenic
1106412802 13:29523015-29523037 TCAGCATCATCTGCTTAGCAAGG - Intronic
1107124218 13:36828323-36828345 TCAGTCTTAACTGCAAAGAAAGG - Exonic
1107698034 13:43019881-43019903 TCACCCTCCTCAGCAAAGAAAGG - Intergenic
1108514814 13:51191083-51191105 ACGCCCTTATCTGCAAAGCATGG + Intergenic
1109170831 13:59095541-59095563 TAAGCAGCAGCTGCAAAGCAAGG + Intergenic
1109295545 13:60526006-60526028 TCTGCCACATCTGCCAAGCCTGG + Intronic
1110484443 13:76021648-76021670 TCTGCCTGATCTCCAAAGCCAGG + Intergenic
1110566260 13:76960058-76960080 TTAGCCTCATCTGGGATGCAGGG + Intergenic
1111326402 13:86702227-86702249 ACAGACTCAGCTGCAAACCAGGG + Intergenic
1111522341 13:89422766-89422788 TGATGCTCATCTGCAAAGGATGG - Intergenic
1111660328 13:91201956-91201978 GATACCTCATCTGCAAAGCATGG + Intergenic
1112355794 13:98674009-98674031 GCAGCCCCATCTGCGACGCAAGG - Intergenic
1113402299 13:110005248-110005270 TGAGCTTCATCTGAATAGCAAGG + Intergenic
1114301672 14:21384403-21384425 TCCACCCCATCTGCAAAGGAAGG + Intergenic
1114431398 14:22664797-22664819 CCAGCCTCCACTGCAAACCACGG + Intergenic
1114823155 14:26045910-26045932 TAGGGCTCATTTGCAAAGCATGG - Intergenic
1115051879 14:29072738-29072760 TCAGCCACATCTGGGATGCAGGG + Intergenic
1115746271 14:36440945-36440967 TTAGCCTCAACTGCAAACTAAGG + Intergenic
1117632561 14:57708882-57708904 TCTGCCTCAGCTGCCAGGCAGGG - Intronic
1117844208 14:59894047-59894069 TCAGACTTATCTGGGAAGCAGGG - Intergenic
1118003941 14:61548431-61548453 CCAGCCTCAGCTGCAGAGCTTGG - Intronic
1119529925 14:75352915-75352937 TCAGCCTCCTAAGCTAAGCAGGG - Intergenic
1119733914 14:76968852-76968874 GGAGCCTCATCTGCAATGTAGGG + Intergenic
1122059533 14:99127410-99127432 GTTTCCTCATCTGCAAAGCAGGG - Intergenic
1202870862 14_GL000225v1_random:162210-162232 TCTTCCTCATCTGCACAACATGG - Intergenic
1124072473 15:26408770-26408792 TAAGCCTCTGCTGCATAGCATGG - Intergenic
1124337840 15:28870388-28870410 TGAGCCTCCTCTTCAAATCAAGG + Intergenic
1125538911 15:40458711-40458733 TCAGCCTCATCTGCACTCCGGGG - Exonic
1128110641 15:65074035-65074057 GGATGCTCATCTGCAAAGCAGGG + Intronic
1128655130 15:69455192-69455214 GGAGCCTCATCTGCAATGTAGGG + Exonic
1129048477 15:72757916-72757938 ACAGGCTCTTCTGCAAGGCAAGG + Intronic
1129574906 15:76732886-76732908 TCTGCCTCAGCTGCCAGGCAGGG + Intronic
1129701964 15:77773420-77773442 CCAGCCTCATCTGTAAAGTCGGG - Intronic
1129923282 15:79339177-79339199 TCTGCCTCAGCTGCCAGGCAGGG + Intronic
1131023021 15:89115763-89115785 TCAGCCTGCTCTGCAAATAAAGG + Intronic
1133108177 16:3527813-3527835 TCTGCCTCAGCTGCCAGGCAGGG + Intronic
1133675814 16:8070719-8070741 TCAGCCACACCTGCTTAGCAGGG - Intergenic
1134045512 16:11098270-11098292 TCAGCCCCATCTCCAAGGAACGG + Intronic
1134640864 16:15828178-15828200 TTATCCTCATCTACAAAACAGGG + Intronic
1135149922 16:19996444-19996466 TTAGTCTCATCTGCAAAGTGGGG + Intergenic
1135199511 16:20424746-20424768 TCAGCCTCATCTGTAAGAAAGGG + Intronic
1135219184 16:20598859-20598881 TCAGCCTCATCTGTAAGAAAGGG - Intergenic
1135420522 16:22302918-22302940 TCAGCTCGATCTGCAAAGGAGGG - Exonic
1136009253 16:27352257-27352279 TCAATCTCATCTGTAAAACAAGG - Intronic
1137983272 16:53087543-53087565 TCTTCCTTATCTGTAAAGCAGGG + Intronic
1138607197 16:58097001-58097023 TCAGCCTCCCCTGAAAAGCCAGG + Intergenic
1139235556 16:65334863-65334885 GGAGCCACATCTGCAAGGCACGG + Intergenic
1139305383 16:65981393-65981415 TCAGTGTCATCTTCAAAGGATGG + Intergenic
1140757446 16:78080679-78080701 TTAGCCTCAACTGTAAAGTAGGG + Intergenic
1141131875 16:81443059-81443081 TCATCCTCAACCACAAAGCATGG - Intergenic
1141715665 16:85725364-85725386 GCAGCCCCATCTGGAAGGCAAGG + Intronic
1142384324 16:89753162-89753184 TCTGCCTCAGCTGCCAGGCAGGG + Intronic
1142640203 17:1281012-1281034 TCAGCCTCGTCTTCAGGGCAGGG + Intronic
1143607091 17:7993472-7993494 ACATCCTCATCTGTAGAGCAAGG + Intergenic
1143662776 17:8337026-8337048 TCAGTGGCATCTGCAAATCATGG - Intergenic
1144053051 17:11514549-11514571 TCAGCCTCATCTGCAGTGGATGG + Intronic
1145223439 17:21107709-21107731 TCTGCCTCAGCTGCCAGGCAGGG - Intergenic
1145732031 17:27198132-27198154 TCTGCCTCAGCTGCCAGGCAGGG + Intergenic
1145736232 17:27233683-27233705 CCTGCCTCTTCTGCAATGCATGG - Intergenic
1145907752 17:28525545-28525567 TGAGCCTCATCTGAAAAGTAAGG + Intronic
1146158109 17:30541351-30541373 TGACAATCATCTGCAAAGCAGGG - Intergenic
1148204118 17:45768851-45768873 GCTGCCTCATCTGCAAACGAAGG + Intergenic
1148503906 17:48112530-48112552 TCAGCTTCAGCTACACAGCAAGG - Intronic
1149265852 17:54926770-54926792 GCAGCCTCAACTGCAAAGAAAGG - Intronic
1149470492 17:56912190-56912212 TCAGCCTAAGATCCAAAGCATGG - Intronic
1149516492 17:57284817-57284839 TCAGCCTCATCTGCTGGGGATGG + Intronic
1151246298 17:72797605-72797627 GCAGCCTCATCTACCAAGCCAGG + Intronic
1151431915 17:74069501-74069523 TGAGCCTCCTCTACAAAGCCAGG - Intergenic
1151745607 17:76010153-76010175 GCAGCCTCATCTGCTGACCAAGG - Exonic
1152232887 17:79123712-79123734 CAAGCCTCATCTGCAGAGCAAGG - Intronic
1152498627 17:80693474-80693496 TCTGCCTCTTCTGCAAATTAAGG + Intronic
1155043881 18:22087197-22087219 ACAGCCTCATCAGCTAAGAAAGG - Intergenic
1155294369 18:24371732-24371754 TGAGCCTCATCTGCAATGGGTGG - Intronic
1155444260 18:25894396-25894418 CCAGCCTCATCCCAAAAGCAAGG + Intergenic
1155753346 18:29457438-29457460 TCAGCCTCTTTTGAAAATCACGG + Intergenic
1155990610 18:32275436-32275458 TCACCGTCATCTGCAATGGACGG - Intronic
1157116265 18:44865207-44865229 TCAGCTTCTTCTGCAAAATAAGG + Intronic
1157727550 18:49976614-49976636 TCAGCTTCATCTGAATAGTAAGG - Intronic
1158044238 18:53135865-53135887 ACAGCCTAAGCTGCAAAGCTTGG - Intronic
1158255611 18:55545137-55545159 GTTGCCTCATCTGCAAAACAGGG + Intronic
1161070446 19:2257278-2257300 TGAGCCCTACCTGCAAAGCATGG + Intronic
1161469541 19:4449345-4449367 CCACCCTCAACTGCACAGCAGGG + Intronic
1161838793 19:6665965-6665987 TTTCCCTCCTCTGCAAAGCAGGG - Intronic
1162290488 19:9776472-9776494 TCTGCCTCAACTGCCAGGCAGGG + Intronic
1162967396 19:14162371-14162393 TCAGTGTCATCTGTAAAACAGGG + Intronic
1163256340 19:16158097-16158119 TCAGTCTCTTCTTCAAAACATGG - Exonic
1163479357 19:17545629-17545651 TCTGCCTCAGCTGCCAGGCAGGG - Intronic
1163522447 19:17799574-17799596 GCATCCTCCTCTGCAAAGCTGGG - Intronic
1164033730 19:21434959-21434981 TCAGCCTCCTGGGCAAACCAGGG + Intronic
1164083470 19:21880528-21880550 TCTGCCTCAGCTGCCAGGCAGGG - Intergenic
1164084624 19:21889798-21889820 TCTGCCTCAGCTGCCAGGCAGGG - Intergenic
1164261569 19:23572401-23572423 TCTGCCTCAGCTGCCAGGCAGGG + Intronic
1165334109 19:35157056-35157078 GTTGCTTCATCTGCAAAGCAGGG - Intronic
1165543906 19:36517197-36517219 TCAGCCTAAGCAGCACAGCAAGG + Intronic
1166282042 19:41800694-41800716 TCTGCCTCATCTGCCAGGCAGGG + Intronic
1166449324 19:42884664-42884686 TCTGCCTCAGCTGCCAGGCAGGG - Intronic
1166453739 19:42922899-42922921 TCTGCCTCACCTGCCAGGCAGGG - Intronic
1166842556 19:45707172-45707194 GCAGCCTCATCTGTACAACAGGG - Intergenic
1167999787 19:53435808-53435830 TCAACCTCCTCTGCCAGGCAAGG - Intronic
1168004214 19:53473121-53473143 TCAACCTCCTCTGCCAGGCAAGG - Intronic
1168083097 19:54024680-54024702 GCAGCCTCAGCTGCAAAGACTGG + Intergenic
1168185155 19:54695876-54695898 TCAGCCTCGGCTGCACAGCCAGG + Intronic
1168406195 19:56111867-56111889 GCTGCCTCCTCTGCAAAGCAGGG + Intronic
925195004 2:1915599-1915621 TCTTCCTCATCTGCAAAGTGAGG - Intronic
926148599 2:10411958-10411980 CCAGCCCCATCTCCAAAGCTTGG - Intronic
926222636 2:10946321-10946343 GTTTCCTCATCTGCAAAGCAAGG - Intergenic
926459978 2:13117059-13117081 TCAGCTTCATCTGCAAATTGGGG + Intergenic
926547857 2:14264121-14264143 ACAGCCTCATGTCCACAGCAGGG + Intergenic
926676794 2:15631463-15631485 TATGCATCATCTGGAAAGCAAGG - Intergenic
927253349 2:21018142-21018164 TCAGCCTAATCTTCAAAATATGG + Intronic
927499907 2:23575718-23575740 TCAAACTCACCTTCAAAGCAGGG - Intronic
927979381 2:27364590-27364612 TCAGGGTCATCTGCAATGGAAGG + Exonic
929667613 2:43845407-43845429 TGAGCCTCATCTGTAAAACAAGG + Intronic
930197898 2:48527908-48527930 TCTGACACTTCTGCAAAGCAAGG - Intergenic
932106109 2:68944204-68944226 GCAGCCTCAGCTGCTCAGCATGG - Intergenic
932438944 2:71719666-71719688 TCAGCCTCATTTGAAAAGAGGGG - Intergenic
932714484 2:74091433-74091455 TCTGCCTCATCTGTAAAGTGAGG - Intronic
934817975 2:97346922-97346944 TCAGACTCAGCTGCACAGCCAGG - Intergenic
934819721 2:97361562-97361584 TCAGACTCAGCTGCACAGCCAGG + Intergenic
937459053 2:122069834-122069856 TCAGCCTCCTCTGCAAAGGTGGG + Intergenic
940293551 2:152099534-152099556 TCAGCCTAATGTGTAAGGCATGG + Intergenic
940527925 2:154841262-154841284 TCAGCTTCATCTGGGATGCAAGG - Intronic
941268749 2:163398502-163398524 TTTTCCTCATCTGCAAACCACGG + Intergenic
941662944 2:168214161-168214183 CAAGCCTCATCTGCAGAACAGGG + Intronic
941672881 2:168313982-168314004 TTTGCCTCAGTTGCAAAGCAAGG - Intergenic
941792052 2:169563080-169563102 TTATCCTCATCTGCAAAAGAGGG - Intronic
942465239 2:176201061-176201083 GGAGCCTCATCTGCAATGTAGGG - Intergenic
942794912 2:179806489-179806511 TCAGCCTTATCTGCAAAGACCGG - Intronic
943069899 2:183128310-183128332 TCACCCACATCTCCAAAGCCAGG + Exonic
943524227 2:188996580-188996602 TCAGTCTCCTCTTCAAAGCATGG + Intronic
945753223 2:213814113-213814135 TCAGCCTGATCTGCAAATTTAGG - Intronic
946302620 2:218833146-218833168 TAAGCCTGATCAGCAAAGCCTGG + Intergenic
946656215 2:221950948-221950970 TCAGTCTCATGTGCAAAGCAAGG - Intergenic
946759751 2:222981750-222981772 TCAGCTTCATCTGCAGAACTAGG + Intergenic
948334686 2:237198704-237198726 TGAGCCTCATCTGCAAATCCAGG - Intergenic
948880698 2:240855877-240855899 ACGTCCTCATCTGCACAGCAGGG - Intergenic
949019479 2:241733366-241733388 CCACACTCATCTGCAGAGCAAGG + Intergenic
1169465299 20:5832714-5832736 TCAGTCTCATCCTGAAAGCAGGG + Intronic
1169988348 20:11471891-11471913 TCAGCCTCATCTGAACTACATGG + Intergenic
1170671274 20:18435874-18435896 TCTGCCTCCCCTGCAAGGCATGG - Intronic
1170893616 20:20395761-20395783 TCACCCTCCTCTGCTAGGCAGGG - Intronic
1172128243 20:32638315-32638337 CCAGCCTCATCTGCAAAATGGGG - Intergenic
1172175740 20:32970867-32970889 CTAGCCTCATCTGCAAAACTGGG + Intergenic
1172322995 20:34011707-34011729 TTAGTTTCATCTGCAAAACAAGG - Intronic
1172509479 20:35490488-35490510 GTTGCCTCATCTGTAAAGCAAGG - Intronic
1172770990 20:37382606-37382628 GCGTCCTCATCTGCAAAGCAGGG - Exonic
1173347308 20:42212906-42212928 TCAGCCAAAGCTGAAAAGCATGG - Intronic
1173671815 20:44804297-44804319 TGAGCCTCATCTGGAAAAAAAGG - Intronic
1175270108 20:57727915-57727937 TTAGCCTCATCGGGAAAGCAAGG + Intergenic
1175299129 20:57930407-57930429 CCAGCCTCCTCTGCTAAGCCAGG + Intergenic
1175877587 20:62237774-62237796 TCAGTTTCATCTGCAAACCAGGG - Intronic
1175953534 20:62596438-62596460 TCAGCATCAGATGCAAAGAAAGG + Intergenic
1176863164 21:14025397-14025419 TAAACCTCATCTGCAAAAAAAGG + Intergenic
1178051532 21:28753021-28753043 ACAGCCTCATTTCCATAGCAGGG - Intergenic
1179000418 21:37452515-37452537 CAAGCCTCAGCTGGAAAGCACGG - Intronic
1180027955 21:45179183-45179205 GCAGCGGCATCTGCAATGCAGGG - Intronic
1180105949 21:45618153-45618175 GCAGCCTCATCTGAACAGCCTGG + Intergenic
1181729873 22:24837279-24837301 TCTGCCTCAGCTGCCAGGCAGGG - Intronic
1181763281 22:25072695-25072717 GCTTCCTCATCTGCAAAGCGAGG + Intronic
1181918582 22:26301111-26301133 TGAGCCTCATCTGCAAAATGGGG - Intronic
1183018535 22:35009044-35009066 TCAGCATCCTCTACAAAGCCAGG + Intergenic
1183080523 22:35452952-35452974 GTTTCCTCATCTGCAAAGCAGGG - Intergenic
1183122398 22:35740110-35740132 TTAGCCTCATTTGCAAAGAAAGG + Intronic
1183271434 22:36864987-36865009 CCAGCTTGCTCTGCAAAGCATGG - Exonic
1183911363 22:41081926-41081948 TCAGCCTTTCCTGCACAGCAGGG - Intergenic
1184027472 22:41868615-41868637 TCAGCCTCAAGTCCAAAGCCTGG + Exonic
1184244043 22:43226972-43226994 TCAGCCTCCTCAGCAAGACAAGG + Intronic
1184322825 22:43756185-43756207 TCAGTCTCCTCGGTAAAGCAGGG - Intronic
1184351616 22:43947772-43947794 TCTGCCTCAGCTGCCAGGCAGGG - Intronic
1184939178 22:47748454-47748476 TCTGCCACATCAGCACAGCAGGG - Intergenic
1185242476 22:49754138-49754160 TCAGCCTCCTCCACAAAGCAGGG + Intergenic
1185383698 22:50522027-50522049 TCAGCCTCACCTGCAAAGGACGG - Exonic
949186389 3:1197217-1197239 TCTCACCCATCTGCAAAGCAAGG + Intronic
952650603 3:35722552-35722574 CCTGTCTTATCTGCAAAGCAGGG - Intronic
952751293 3:36827089-36827111 TCAGCCTGGTATGGAAAGCAAGG - Exonic
953851152 3:46466318-46466340 TCAGACTCACCTGCCAAGAAAGG - Intronic
953908819 3:46881974-46881996 TCATTCTCTTCTGGAAAGCACGG - Intronic
954383290 3:50230975-50230997 GCTGACTCAGCTGCAAAGCAAGG + Intronic
954436011 3:50496719-50496741 GGAGCCTCATCTGTAAAACAGGG - Intronic
954839821 3:53500641-53500663 CCAGCCTCATCTGCAATTCCTGG - Intronic
954899265 3:54005229-54005251 CAAACCTCATTTGCAAAGCAGGG - Intergenic
955192050 3:56770612-56770634 GCAGAATGATCTGCAAAGCATGG - Intronic
955412175 3:58662804-58662826 TCATACTCATCTGCTAAGCCAGG - Intronic
955692419 3:61603758-61603780 GGAGCCACATCTGCAAGGCAAGG - Intronic
956504219 3:69920588-69920610 TCTGCCTCAGCTGCCAGGCAGGG + Intronic
956578126 3:70778613-70778635 TCAGCCTCCTCTGCGTAGCTAGG - Intergenic
956945777 3:74221250-74221272 TCATCCTCATCTGGGAAACAGGG + Intergenic
957437278 3:80194726-80194748 AAAGACACATCTGCAAAGCACGG + Intergenic
957529550 3:81423863-81423885 TCACCTTCACCTGCAAAACATGG - Intergenic
957903791 3:86532800-86532822 TCAGTCTCATCTGGAACTCAAGG + Intergenic
958657270 3:97018529-97018551 TCTGCCTCAGCTGCCAGGCAGGG - Intronic
959947311 3:112139186-112139208 CCAGCCTCATCTTCAGGGCATGG - Intergenic
959969963 3:112398431-112398453 TCAGCCTTCTCTCCAAAGCAGGG - Intergenic
960122297 3:113959031-113959053 TCAGGGTCATCTGCAAAGTGGGG + Intronic
961315815 3:126034946-126034968 TCAGGCTCACATGCACAGCAAGG - Intronic
962022861 3:131518317-131518339 TCTCCCTCATCTGCAAGGCCTGG + Intergenic
962771962 3:138620207-138620229 TAAGCCTCATCTGTAAAATAAGG + Intronic
964637442 3:158872658-158872680 TAGGGCTCATCTGCAAAACAGGG - Intergenic
965644001 3:170860785-170860807 TCTGCCTCAGCTGCCAGGCAGGG + Intergenic
966153324 3:176890072-176890094 TCAGCCTAATATGAAAATCAGGG + Intergenic
966923699 3:184630825-184630847 TCAGCCTCCTGCTCAAAGCAGGG + Intronic
967306774 3:188067085-188067107 TCATCCTCATCTTAAAATCAAGG - Intergenic
968074705 3:195810015-195810037 TCAACCACATCTGCAGGGCAGGG + Intronic
969642401 4:8406675-8406697 TCTGCCTCAGCTGCCAGGCAGGG - Intronic
970694212 4:18657347-18657369 TGAGCCTCATCTATAAACCAGGG + Intergenic
972295778 4:37736405-37736427 TGAGCCGAATCTTCAAAGCATGG + Intergenic
973947243 4:55970862-55970884 TCAGCCTCATATGCACAACAAGG - Intronic
975377796 4:73665733-73665755 TCCGCCTCAGCTGCCAAACAGGG - Intergenic
975378433 4:73671142-73671164 TCCGCCTCAGCTGCCAAACAGGG - Intergenic
975632296 4:76416157-76416179 TCTGCCTCAGCTGCCAGGCAGGG + Intronic
975740515 4:77424962-77424984 TCAGCCACATCTGCACAGGGAGG + Intronic
976773715 4:88683503-88683525 TCAGCCACATAAGCAAAGTAAGG - Intronic
980340100 4:131533347-131533369 GCAGCTTCATCTACAAAACAAGG - Intergenic
980893983 4:138843861-138843883 GTAGCCTCATTTGCAAAGCTCGG + Intergenic
981327538 4:143467784-143467806 TCAGCATCACCTCCAATGCAGGG + Intronic
982961247 4:161840154-161840176 TCAGCCATATCTGCCAAACACGG - Intronic
983821310 4:172196607-172196629 TCAGCTTCATCCTCAATGCAAGG + Intronic
984677903 4:182571163-182571185 ACAGCCTCATCTTCATAGCCTGG - Intronic
984955675 4:185043251-185043273 TCAGCCCTAACTACAAAGCAGGG + Intergenic
985080303 4:186258275-186258297 GGGTCCTCATCTGCAAAGCATGG + Exonic
985539723 5:482297-482319 GCTTCCTCCTCTGCAAAGCAGGG - Intronic
985613288 5:902857-902879 TCTGCCTCAGCTGCCAGGCAGGG - Intronic
985647775 5:1093213-1093235 TCAGACTCCTCTCCACAGCAGGG + Intronic
985971428 5:3381362-3381384 TCAGCCTCAGCTCCAGACCAGGG - Intergenic
987359698 5:17095651-17095673 TCTGCCTCAGCTGCCAGGCAGGG - Intronic
988708754 5:33752781-33752803 TCAGACTCATCTGCAGAGCAGGG - Intronic
988722244 5:33890840-33890862 GCATCCTCATCTGTACAGCAGGG + Intronic
989120719 5:38002054-38002076 TCAGCCTCAACTGCAGACAAAGG - Intergenic
989583036 5:43051350-43051372 CCAGCCTCAATTACAAAGCAAGG + Intergenic
990066070 5:51716337-51716359 TGTTCCTCATCTGCAAAGCAGGG + Intergenic
990759657 5:59114500-59114522 TTAACCTCTTCTGCAAAGCTTGG - Intronic
990990233 5:61676528-61676550 TCAGCCCCACCTGCCAACCAGGG + Intronic
991310178 5:65230069-65230091 TCAGCCTCTTCTGGCCAGCAGGG - Intronic
992774872 5:80080368-80080390 TCAGGCTTCTCTGCAGAGCATGG - Intronic
995260357 5:110096798-110096820 TCAGAATCATCTACAAAGAAAGG + Intergenic
995476711 5:112555437-112555459 TTCTCCTCATCTGCAAAGGAAGG + Intergenic
995993578 5:118272067-118272089 TCAGCCTCAGCTGGAATGTATGG - Intergenic
996291575 5:121858317-121858339 CCAGACCCATCTGCAAAGCAAGG + Intergenic
997284583 5:132669037-132669059 TCAGCCTCATCTGTGAAATAGGG - Intergenic
999462046 5:151766049-151766071 GAAGCCTCATCTGCAATGTAGGG - Intronic
999513626 5:152278431-152278453 TCACCCTAATATGCAAAGGAAGG - Intergenic
1000260538 5:159584369-159584391 TAATCCTCATCTGCAAAAGAAGG + Intergenic
1000409990 5:160928115-160928137 CCAGTCTCACCTCCAAAGCATGG - Intergenic
1000460849 5:161516357-161516379 ATTTCCTCATCTGCAAAGCAGGG - Intronic
1002041757 5:176519956-176519978 TTAGCCACATCTGCTGAGCATGG - Intergenic
1002128923 5:177067502-177067524 TCAGCCCCATCTACCAAGCAAGG + Intronic
1002312625 5:178323852-178323874 TTTGCTTCATCTGCAAAGGAGGG - Intronic
1003331242 6:5130331-5130353 TGAGCTTTATCTGCCAAGCAGGG + Intronic
1003400799 6:5788843-5788865 TCAGCCCCAGCTGGAAAGCCAGG + Intergenic
1003683615 6:8279633-8279655 AGAGCCTCATCTGCAATGCAGGG - Intergenic
1005313368 6:24580598-24580620 TCAGCTTCACCTTCGAAGCAGGG - Intronic
1006598095 6:35208250-35208272 TCATCCTCATCTGGAAAATAGGG - Intergenic
1006652104 6:35559990-35560012 TCTGCCTCAGCTGCCAGGCAGGG - Intergenic
1007053051 6:38852448-38852470 TTAGTCTAATCTGCATAGCATGG + Intronic
1008367941 6:50704522-50704544 TCAATGTCATCTGCAAAGGATGG - Intergenic
1011330677 6:86202832-86202854 TCAGACTCTTGTGCATAGCAGGG - Intergenic
1011931258 6:92716891-92716913 GCTGCCTCATCTGCAAATTAGGG + Intergenic
1012259184 6:97067789-97067811 TTAGCCTCATCTTCAAGGCCAGG + Intronic
1012372857 6:98528454-98528476 TCACCCTCATCTCCATAGAATGG + Intergenic
1013588225 6:111598037-111598059 TCAGGCTCATCAGCAAATCCTGG + Intronic
1013632515 6:111998991-111999013 CCAGCCACATCTGCAAATCAAGG + Intergenic
1013972438 6:116037916-116037938 TCCTCCAAATCTGCAAAGCAAGG - Intronic
1014268962 6:119314503-119314525 TCAGCTTCATATGTAAAACAGGG - Intronic
1015775432 6:136809367-136809389 TCAGTCTCATGAGAAAAGCATGG + Intergenic
1016199728 6:141394037-141394059 CCAGCTCCATGTGCAAAGCAAGG - Intergenic
1019869485 7:3746000-3746022 TTTCCCTCATCTGTAAAGCAGGG + Intronic
1020114962 7:5471079-5471101 CCGACTTCATCTGCAAAGCAAGG + Intronic
1021095216 7:16527679-16527701 TCTGACTCATCTGCAAAGATGGG + Intronic
1021142040 7:17038339-17038361 CCTGCCTCATCTGACAAGCAGGG - Intergenic
1021252741 7:18351663-18351685 TCTGCCTCATCTGTAAAAAAAGG + Intronic
1023298090 7:38737601-38737623 ACTTTCTCATCTGCAAAGCAGGG + Intronic
1025760680 7:64387889-64387911 TCTGCATCATCTCCTAAGCAGGG + Intergenic
1026539970 7:71271334-71271356 TCACCCTGATGTGGAAAGCAAGG - Intronic
1026563662 7:71471724-71471746 TAATCCTCAACTGCAAAGGATGG - Intronic
1028465243 7:91143849-91143871 TCAGTCTCCTCTGCAAAACGGGG - Intronic
1028739605 7:94258602-94258624 TCACCAGGATCTGCAAAGCATGG + Intergenic
1029940142 7:104471442-104471464 TAAGCCTCATCTGCAATATAAGG + Intronic
1030338230 7:108348395-108348417 TAAGCCTTATCTGCCAAGTAAGG + Intronic
1030654992 7:112157605-112157627 TCAGGCTCATCAGCATACCAGGG - Intronic
1030978386 7:116155646-116155668 TTAGCAGCATCTCCAAAGCACGG + Intronic
1031044521 7:116873015-116873037 TCAGACTCACCTGGAAAGCTTGG - Intronic
1032305718 7:130731693-130731715 TCAGCCTCATCTCTAAAGAAAGG + Exonic
1033178599 7:139151559-139151581 TAAGCATCATCTGTAAAACAGGG + Intronic
1034504304 7:151474206-151474228 TCAGCCTGAGCGACAAAGCAAGG - Intronic
1034606372 7:152319843-152319865 TCTGCCTCAGCTGCCAGGCAGGG + Intronic
1034778914 7:153859241-153859263 TGTGCCTCTTCTGCAATGCATGG - Intergenic
1035277546 7:157757161-157757183 GCAGCCTCAGCTGCAAGGCTAGG - Intronic
1035765347 8:2100712-2100734 TCAGCCTCTCTTGCAGAGCAGGG - Intronic
1037001478 8:13724270-13724292 TGAGCCTCTTCTGCAAAACAGGG + Intergenic
1038165901 8:25084898-25084920 TCATCTTCTTCTGCAGAGCAAGG - Intergenic
1038507453 8:28097229-28097251 TCAGCATCATCAGCTCAGCAGGG - Exonic
1039378493 8:37061686-37061708 CCACCCTCATCTCCCAAGCATGG - Intergenic
1039449770 8:37663005-37663027 TCATACTTATCTCCAAAGCAGGG + Intergenic
1040020473 8:42736582-42736604 GTAGCCACATCTTCAAAGCAGGG - Exonic
1040523603 8:48198710-48198732 TCCTTCTCATCTGCAGAGCAAGG - Intergenic
1043742139 8:83827590-83827612 TCTGCCTCTTCTGCCCAGCACGG - Intergenic
1045550344 8:103165783-103165805 TGTGGCTCATCTGCCAAGCAGGG - Intronic
1046569311 8:115942934-115942956 TTAGGCTCATCTGAAAAGCATGG - Intergenic
1046573211 8:115992724-115992746 TCTGCCTCATTTTCAGAGCATGG + Intergenic
1046839687 8:118842623-118842645 TCAGCCTCATCTCCAACACTGGG - Intergenic
1047339721 8:123969195-123969217 TCAGTCTTATCTGTAAAACATGG + Intronic
1047791557 8:128208964-128208986 GCAGCCTCATCTTCCATGCAAGG + Intergenic
1048023964 8:130567134-130567156 TGAGCCTCATCCACAAAGCAAGG - Intergenic
1048416212 8:134230315-134230337 CCAGCCTTTTCTGCAAAGCAGGG + Intergenic
1048493058 8:134912481-134912503 TCAGCCTCATCAGCCAAGATTGG - Intergenic
1049441185 8:142610508-142610530 GTTTCCTCATCTGCAAAGCAGGG - Intergenic
1049516219 8:143058412-143058434 TCTGCCTCAGCTGCCAGGCAGGG - Intronic
1051250378 9:15152888-15152910 TCAGCCCCATCTGCTCAGGAGGG - Intergenic
1052269572 9:26613641-26613663 TCTGCCTCAGCTGCCAGGCAGGG - Intergenic
1052934477 9:34081490-34081512 TCAGCCTCCTCTGAATAGCTGGG - Intergenic
1053418527 9:37962096-37962118 GCTGCCTCATCTGCAAACCAGGG + Intronic
1055830864 9:80377228-80377250 TCAGGTGCATCTGCCAAGCAGGG - Intergenic
1055906646 9:81302319-81302341 TCAGCCTAAGCAACAAAGCAAGG + Intergenic
1056068987 9:82966431-82966453 GCAGCCTCCTCTCCAAAGTAAGG + Intergenic
1058503113 9:105642523-105642545 GCTTCCTCATCTGCAAAACAAGG - Intergenic
1059494405 9:114697596-114697618 TGAGCCACATCTACAAAACAGGG - Intergenic
1059669125 9:116476838-116476860 TCAGCCTGTTCTCCAAACCATGG + Intronic
1060221812 9:121768121-121768143 TGAGCATCATCTGCATACCAGGG + Intronic
1060742137 9:126106132-126106154 TCTGCCTCATTTGCAGTGCAAGG + Intergenic
1060883173 9:127133006-127133028 GTGTCCTCATCTGCAAAGCAGGG + Intronic
1061867924 9:133504663-133504685 TCGCCCTTATCTGCAAAGTAAGG + Intergenic
1062477203 9:136734253-136734275 TCTGCCTCGGCTGCCAAGCAGGG - Intergenic
1062501469 9:136853764-136853786 TCAGCCACATCTGCAATGTCAGG - Exonic
1062647997 9:137559690-137559712 TCTGCCTCGGCTGCCAAGCAGGG + Intronic
1203733593 Un_GL000216v2:114375-114397 TCTTCCTCATCTGCACAACATGG + Intergenic
1185687273 X:1939600-1939622 TCAGCCTCATCTGCAAAGTCAGG - Intergenic
1187392987 X:18897726-18897748 TCAGTCTCATCTGCACAGTGGGG + Intronic
1187573249 X:20527300-20527322 TCAGCTTCCTCTGTAAAACAAGG + Intergenic
1187986123 X:24813434-24813456 TCAGTCTCAGGTGCAAAGCTAGG - Intronic
1190442296 X:50486894-50486916 GCAGCCTCATCTCCAGTGCAGGG + Intergenic
1192808404 X:74529429-74529451 TCAGCCTCACCTGCAATGGGGGG - Exonic
1197077918 X:122375358-122375380 TCTGCCTCAGCTGCCAGGCAGGG - Intergenic
1198344688 X:135747852-135747874 TCTGCCTCAGCTGCCAGGCAGGG - Intergenic
1202627418 Y:56874043-56874065 TCTTCCTCATCTGCACAACATGG - Intergenic