ID: 915468130

View in Genome Browser
Species Human (GRCh38)
Location 1:156109661-156109683
Sequence GAAATAATTTCCAACCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915468129_915468130 -5 Left 915468129 1:156109643-156109665 CCTCATCTGCAAAGCAGGGAAAT 0: 1
1: 0
2: 11
3: 125
4: 707
Right 915468130 1:156109661-156109683 GAAATAATTTCCAACCCATGAGG 0: 1
1: 0
2: 0
3: 22
4: 197
915468124_915468130 29 Left 915468124 1:156109609-156109631 CCTGTTACTTACGGCCTAGTTTT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 915468130 1:156109661-156109683 GAAATAATTTCCAACCCATGAGG 0: 1
1: 0
2: 0
3: 22
4: 197
915468126_915468130 15 Left 915468126 1:156109623-156109645 CCTAGTTTTAGGAAAGTCAGCCT 0: 1
1: 0
2: 1
3: 15
4: 124
Right 915468130 1:156109661-156109683 GAAATAATTTCCAACCCATGAGG 0: 1
1: 0
2: 0
3: 22
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915468130 Original CRISPR GAAATAATTTCCAACCCATG AGG Intronic
900733949 1:4283008-4283030 ATAATAATACCCAACCCATGGGG - Intergenic
902247792 1:15132933-15132955 GAAATAATTTTTAACACAAGGGG + Intergenic
906328048 1:44860844-44860866 GGAAAAATTCCCAACCCAAGAGG + Intronic
906917480 1:50026503-50026525 CAATTAATTTCCAAACAATGTGG + Intergenic
907647991 1:56263342-56263364 GAAAAAATCTCCACCCCATCTGG - Intergenic
910578130 1:88790451-88790473 AAAGTAATTTCCAACCTATTAGG - Intronic
911740757 1:101384608-101384630 AAAATAAATTTCAACCAATGTGG - Intergenic
912142279 1:106745395-106745417 GAAATATGTTCTAACCTATGAGG - Intergenic
913441076 1:118898379-118898401 GAAATAAGTCACAACCCATCTGG + Intronic
915468130 1:156109661-156109683 GAAATAATTTCCAACCCATGAGG + Intronic
916668880 1:166993631-166993653 TTAATATTTTACAACCCATGTGG - Intronic
917147674 1:171910377-171910399 GAGATAATTTACATTCCATGTGG - Intronic
917606453 1:176635654-176635676 GAATTAATTTCCAAGCCAAAGGG - Intronic
918616915 1:186554961-186554983 GAAATACTTTAAAACCCAAGTGG - Intergenic
920083796 1:203398904-203398926 GAAATAATTTCAAACATATATGG - Intergenic
921411388 1:214839822-214839844 TAAAAAGTTTCCACCCCATGAGG - Intergenic
921765429 1:218967211-218967233 GAAAACATCTCCATCCCATGAGG - Intergenic
923166007 1:231362508-231362530 GAAACTATTTCCAGCTCATGAGG + Intergenic
923951722 1:238963534-238963556 GAAATAATTCCAAACTCAGGGGG + Intergenic
924260413 1:242223978-242224000 GAAATAATTTTCATCCTATTGGG + Intronic
924957076 1:248940038-248940060 GGAATAACTTCCAACCCAAGAGG + Intergenic
1065915618 10:30352388-30352410 AATATAGTTTCCAAACCATGAGG - Intronic
1068281943 10:54883928-54883950 AAAATAATTTCCCACCAATAAGG - Intronic
1068529535 10:58169280-58169302 GAAATAATTTTCTACACATTAGG + Intergenic
1068946198 10:62731759-62731781 GATATGATTTCAAACCCCTGAGG - Intergenic
1069408604 10:68128723-68128745 GAAAACCTTCCCAACCCATGAGG - Intronic
1069884613 10:71615847-71615869 GATAAAAGTTCCAACCCGTGTGG - Intronic
1070695329 10:78558902-78558924 GAAATAGTATCCATCTCATGGGG + Intergenic
1074296443 10:112193533-112193555 ATAATAGTTTCTAACCCATGGGG - Intronic
1074703250 10:116110452-116110474 GATTTTATTACCAACCCATGAGG - Intronic
1076059026 10:127398887-127398909 GAATTGATTTCTTACCCATGAGG - Intronic
1076962983 10:133781884-133781906 GGAATAACTTCCAACCCAAGAGG + Intergenic
1078674928 11:13401627-13401649 GAAATTATTTCCTTCCCAAGAGG - Intronic
1078911740 11:15739124-15739146 GAAATGCTTTCCAAGCCATCTGG - Intergenic
1079890897 11:26051613-26051635 GAAATTGATTCCAACCCTTGTGG + Intergenic
1080096272 11:28411421-28411443 GAAATAAATTCAAACATATGTGG + Intergenic
1080822334 11:35819286-35819308 GAAATAATTTGAAAGCCATTTGG - Intergenic
1085521900 11:77144004-77144026 GAAAGAATTGTCATCCCATGAGG + Intronic
1086814652 11:91354066-91354088 GAAATAATTTCCAAGATATAGGG + Intergenic
1087261250 11:96014829-96014851 GAAGCAATTTCCAAATCATGGGG + Intronic
1087433567 11:98083878-98083900 GAAATGATTTCTACCCCACGTGG + Intergenic
1087953366 11:104253256-104253278 GAAGTAATTTGAAACCCATGTGG + Intergenic
1088865576 11:113844702-113844724 GATATAATTTCACACCCATAGGG + Intronic
1089061063 11:115626515-115626537 CAAATTATTTCAAAGCCATGAGG - Intergenic
1089187104 11:116625593-116625615 GAAATAATTTCCACCATATTTGG + Intergenic
1090567672 11:128013254-128013276 AAAATAAATACCAAGCCATGCGG + Intergenic
1091184754 11:133637339-133637361 GAAATAATACCCATCCCATAGGG + Intergenic
1092957204 12:13561754-13561776 GAAACAATTGCCAACCACTGAGG + Exonic
1093560097 12:20528181-20528203 GGAATAATTTCCAACCTAGGAGG + Intronic
1094642921 12:32293877-32293899 GTAACAATTTACACCCCATGAGG + Intronic
1095723381 12:45425748-45425770 GAAATACTCTCCAACTCATTTGG + Intronic
1096156429 12:49343893-49343915 GATGTGATCTCCAACCCATGTGG + Intergenic
1096232993 12:49907473-49907495 GAAATAATTTCCACCACATAAGG + Intergenic
1100048701 12:90417135-90417157 GAAATAAATTCAAACATATGTGG + Intergenic
1102158658 12:110750956-110750978 GAAATAATTTATAACCCAGCTGG + Intergenic
1102359261 12:112269565-112269587 GAAATTATCCCCAATCCATGAGG + Intronic
1106528540 13:30565954-30565976 GAAATAATTTCCAGCACTGGTGG + Intronic
1107381643 13:39862947-39862969 GAAGCAATTTCCATCCCTTGAGG - Intergenic
1108110923 13:47071718-47071740 AAATTAAGTTCCTACCCATGTGG - Intergenic
1108722275 13:53144489-53144511 AAACTATTTTCCAACCCAAGAGG - Intergenic
1110048046 13:70856422-70856444 GAAATATTTTGAAACCCCTGAGG + Intergenic
1110531959 13:76608164-76608186 GAAATAAATTGAAATCCATGAGG - Intergenic
1111367989 13:87275468-87275490 GAAATTTTATCCAAACCATGTGG + Intergenic
1115024542 14:28727468-28727490 GAGATATTTTACAACCCATTTGG + Intergenic
1116641627 14:47470710-47470732 GAACTAATTTACAATCCCTGTGG + Intronic
1116897752 14:50333793-50333815 TAAATAATTTTTAAACCATGTGG + Exonic
1117187129 14:53251470-53251492 GATATAATTTACATTCCATGAGG + Intergenic
1117372303 14:55089694-55089716 TAAAGGATTGCCAACCCATGAGG - Intergenic
1122644855 14:103187678-103187700 AAAATTATTTCAAAACCATGAGG + Intergenic
1122653408 14:103240086-103240108 AAAATTATTTCAAAACCATGAGG - Intergenic
1123696336 15:22881583-22881605 GAAAGAATTGCCACCCAATGAGG - Intronic
1123701234 15:22916218-22916240 GAAAATCTTTTCAACCCATGCGG - Intronic
1124101454 15:26697948-26697970 GAAATAATTTAGAACTCATCTGG + Intronic
1126415631 15:48415075-48415097 TAAATAATTTTCAACCCAAAGGG + Intronic
1126509760 15:49455911-49455933 GTAGTAATTTCCAACACATTTGG - Intronic
1127168640 15:56275183-56275205 GAAAAAACTTCCAACCGTTGGGG - Intronic
1127345352 15:58091005-58091027 GAGATATTTTTCATCCCATGTGG - Intronic
1129915127 15:79262805-79262827 GCAATAAATCCCAAACCATGTGG + Intergenic
1130027070 15:80279268-80279290 AAAATAATTTCCTATCCATATGG + Intergenic
1130746306 15:86657538-86657560 GAGTCACTTTCCAACCCATGGGG - Intronic
1132126412 15:99229779-99229801 GAAAAAATTTCTAATTCATGAGG + Intronic
1134344692 16:13378893-13378915 GATATAATTTCCATCCCCAGAGG - Intergenic
1135633899 16:24057674-24057696 GAGGTTAATTCCAACCCATGGGG + Intronic
1136541422 16:30929538-30929560 AAAATAATTTCCAGCCCTTATGG - Intronic
1137928773 16:52566921-52566943 GAAAGAATTTAAAACCCATCTGG + Intergenic
1140177446 16:72676998-72677020 GAAACACTTTCTAACTCATGAGG + Intergenic
1144226348 17:13151336-13151358 GACGTAATTTTCAACCCATTTGG + Intergenic
1149736611 17:59000826-59000848 GAAATGATTGCCAATCCCTGGGG - Intronic
1150024653 17:61660471-61660493 GAAATAATACCTAACTCATGGGG - Intergenic
1152952125 17:83244110-83244132 GGAATAACTTCCAACCCAAGAGG + Intergenic
1155770149 18:29686736-29686758 TACATAATTTGCAACCCATTTGG - Intergenic
1158395210 18:57074171-57074193 GAAATTATTTGCAACACATAAGG - Intergenic
1160654013 19:251374-251396 GGAATAACTTCCAACCCAAGAGG - Intergenic
1167216250 19:48167387-48167409 GAAATCTTCTTCAACCCATGGGG + Intronic
1168708953 19:58486782-58486804 GAAATCATTTTCAACTCTTGAGG - Intronic
1168728114 19:58602332-58602354 GGAATAACTTCCAACCCAAGAGG + Intergenic
930498740 2:52183347-52183369 AAAATAATTTACATTCCATGTGG + Intergenic
930900685 2:56504426-56504448 TAAATATTTTCTACCCCATGGGG + Intergenic
931022471 2:58063909-58063931 GAAGTTGTTTCCAACCCTTGTGG + Intronic
936570438 2:113608676-113608698 GGAATAACTTCCAACCCAAGAGG - Intergenic
937023146 2:118676754-118676776 CAAATAACTTCCAACCCAATGGG + Intergenic
941027214 2:160470030-160470052 GATATATTTTTAAACCCATGAGG + Intronic
941622960 2:167799144-167799166 GAAATGATTTCAAAACCAAGGGG - Intergenic
944331792 2:198477058-198477080 GAAATCATTTCAAAGCAATGAGG + Intronic
945624275 2:212181912-212181934 AAAAGTATTTCTAACCCATGTGG - Intronic
949088375 2:242177975-242177997 GGAATAACTTCCAACCCAAGAGG + Intergenic
1169922637 20:10751707-10751729 GAAATAATTTTTACCCCATAGGG - Intergenic
1171084303 20:22223042-22223064 GAAATAATTTACAATTCACGGGG + Intergenic
1171085048 20:22230751-22230773 GGAATAATTTCCCCCTCATGTGG + Intergenic
1172865407 20:38092820-38092842 GAGATAATTGCGAACCCAAGTGG + Intronic
1174782473 20:53402554-53402576 GAAATGATCTCTAAACCATGGGG - Intronic
1175007775 20:55703916-55703938 GAGATATCTTCCAACCCAGGAGG + Intergenic
1175796366 20:61773784-61773806 TAAATAATTCCCAACCGTTGTGG + Intronic
1176929191 21:14787882-14787904 ATAATAATTTCCACCACATGTGG + Intergenic
1176981736 21:15389756-15389778 GAGAAAATATCCAACCTATGGGG + Intergenic
1179986350 21:44922758-44922780 GGAATAATTTCAAACCCATCAGG + Intronic
1180133242 21:45841865-45841887 GAAATCACTTCCAACTCAGGAGG + Intronic
1180263538 21:46693934-46693956 GGAATAACTTCCAACCCAAGAGG + Intergenic
1185429768 22:50802295-50802317 GGAATAACTTCCAACCCAAGAGG + Intergenic
949177862 3:1088187-1088209 CAAATAATATCAAACCCATCAGG + Intergenic
955239461 3:57166081-57166103 GAAATAATATCCACTTCATGAGG - Intronic
956755081 3:72377725-72377747 GAAGTATGTTCCAATCCATGTGG - Exonic
957010372 3:74998537-74998559 GAATAAATTTTCAAACCATGAGG + Intergenic
958420678 3:93926796-93926818 GAAAATATTTGCAAACCATGAGG + Intronic
958420695 3:93926969-93926991 GAAAATATTTACAAACCATGAGG + Intronic
959140143 3:102476074-102476096 GCAATAATATCCAAACCATATGG + Intronic
959556532 3:107725836-107725858 GAAATAAATTGGAAGCCATGAGG + Intronic
960855812 3:122101098-122101120 AAAGTGATTTCCACCCCATGGGG + Intronic
961578967 3:127862525-127862547 GAAATAATTGCCAAGGCAGGAGG - Intergenic
962562263 3:136619159-136619181 GAAATAATTTCCAACACAGAAGG - Intronic
964677471 3:159299881-159299903 GTGATAATTGCCAACCCATGGGG + Intronic
965103191 3:164329047-164329069 GAAATTATTTCAAATGCATGAGG + Intergenic
965234255 3:166094803-166094825 GATATTATTTACAAGCCATGTGG + Intergenic
967231173 3:187338738-187338760 GAAATCATTTCCAGCCCTGGAGG + Intergenic
967404221 3:189098745-189098767 AAACTAATTTCCAAGCCTTGTGG + Intronic
969539727 4:7779994-7780016 CAAATGATTCCCAACCAATGTGG + Intronic
970021623 4:11575543-11575565 GAAGTTGTTTCCAACCCATGAGG - Intergenic
970382316 4:15520322-15520344 AAGATAAGTTCCAGCCCATGAGG + Intronic
972997066 4:44893500-44893522 GAAATAATTTTCAGTCCTTGGGG + Intergenic
973008836 4:45046797-45046819 GAATTAAGTTCCAATCCTTGAGG - Intergenic
973064466 4:45771198-45771220 AAAAAAACTTTCAACCCATGGGG + Intergenic
973303502 4:48616685-48616707 CAAATAATTTCTAATACATGAGG + Intronic
975045931 4:69804196-69804218 TAAATATTTTCCAACTCCTGAGG + Intergenic
975391990 4:73831111-73831133 GAAATAATTTCCCACATAGGAGG + Intergenic
975738697 4:77407252-77407274 GAAATTATTCCATACCCATGTGG + Intronic
976186007 4:82443425-82443447 GAAATAATAGCCCACCAATGGGG + Intronic
979836944 4:125382108-125382130 GAAATTGTTTCCAACCCTTAAGG - Intronic
979910006 4:126352785-126352807 GACAAAATTTCCACACCATGAGG + Intergenic
981396154 4:144252391-144252413 AAAAAAATTCCCAAACCATGTGG + Intergenic
983611823 4:169654637-169654659 TTTATAATTTCCAACACATGAGG + Intronic
985466204 4:190199179-190199201 GGAATAACTTCCAACCCAAGAGG + Intergenic
988060652 5:26163904-26163926 GAAATAATTGCCAACAAATCTGG - Intergenic
988092253 5:26559106-26559128 GAAATAATTTACAAACACTGTGG - Intergenic
988635545 5:32979510-32979532 GAAATAATGTACAAACCATCCGG + Intergenic
989094545 5:37769625-37769647 GACATAGTTTCCAAGGCATGTGG - Intergenic
990448503 5:55914903-55914925 GAAATCATCTCCATGCCATGTGG - Exonic
990854302 5:60246291-60246313 GATTTAATTTCAAATCCATGTGG + Intronic
991289852 5:65023089-65023111 GAAATAATTCCCAGCAGATGTGG - Intergenic
992390688 5:76328099-76328121 CAAATCATTTCCAAAGCATGTGG + Exonic
992755494 5:79901784-79901806 GAAACAATTTCTCACACATGTGG - Intergenic
992764314 5:79982155-79982177 GAAGTAATGTGCAACTCATGAGG + Exonic
993489812 5:88533498-88533520 GATACAATTTCACACCCATGAGG + Intergenic
994043037 5:95279229-95279251 GAAATCATTTTCAAACAATGAGG + Intronic
994512835 5:100728897-100728919 TATATAATTTCCTACCCATTTGG + Intergenic
994639912 5:102394962-102394984 GAAATAAACCCCAACTCATGTGG - Intronic
995844526 5:116479771-116479793 GTAATCATTTCCAACCAATCAGG + Intronic
995983284 5:118134865-118134887 GATATAATTTCAAACTCATCAGG - Intergenic
996909882 5:128643708-128643730 GACATAGTTTTCAACCCATTTGG - Intronic
997218920 5:132141273-132141295 GGAATAGTTCCCAACTCATGAGG + Intergenic
1001183463 5:169543370-169543392 GAAATAACCTCCTACCCATCAGG - Intergenic
1001432229 5:171671557-171671579 GTAATGATTTCTATCCCATGAGG + Intergenic
1002746155 5:181475513-181475535 GGAATAACTTCCAACCCAAGAGG + Intergenic
1003915736 6:10784927-10784949 AAAATAATTTACAATCAATGAGG + Intronic
1007842038 6:44724455-44724477 GAAATAATTTTTAGCCTATGAGG + Intergenic
1007945566 6:45823761-45823783 GAATTAATTTGCACCCCATAAGG - Intergenic
1008310465 6:49964792-49964814 GCAATAATTTCCTACCCACTAGG + Intergenic
1008854768 6:56070316-56070338 GAAATAAACATCAACCCATGTGG + Intronic
1010100415 6:72099016-72099038 AAAATACTTAACAACCCATGTGG + Intronic
1012533667 6:100269225-100269247 GTGATAATTTCCAACTCATTTGG - Intergenic
1014211362 6:118711719-118711741 GAAATAATTCCAAATCCATTTGG + Intergenic
1014445962 6:121528104-121528126 GAAACACTTTCCAACCTTTGTGG + Intergenic
1014501541 6:122196336-122196358 TTAATAATTTCTTACCCATGAGG - Intergenic
1015956795 6:138607101-138607123 GAAATAATTCCCAAACAGTGTGG - Intronic
1016755605 6:147682166-147682188 GGAAGAATTTCCAGGCCATGAGG - Intronic
1019235049 6:170604799-170604821 GGAATAAGTTCCAACCCAAGAGG + Intergenic
1021802070 7:24316946-24316968 GAAATAACTTCCAACTCAGATGG - Intergenic
1022561121 7:31350760-31350782 AAGATTAATTCCAACCCATGAGG - Intergenic
1022947373 7:35300811-35300833 GAAAGGATTGCCAACCCATCTGG - Intergenic
1023240624 7:38142805-38142827 GAAATAATTTCGCACTCATCAGG + Intergenic
1023957815 7:44901794-44901816 GAAATAATATACAACCCAGGAGG - Intergenic
1026256027 7:68712108-68712130 GAAATGGATTCCAACCCTTGTGG - Intergenic
1033709082 7:143920065-143920087 GAAATTATTTCAAACCATTGAGG - Intergenic
1035513546 8:211166-211188 GGAATAACTTCCAACCCAAGAGG - Intergenic
1036825008 8:11969147-11969169 CAACTAATTGCCAACCCATCAGG - Intergenic
1039126400 8:34206725-34206747 GAAATAATTTTCAACTCCTTTGG - Intergenic
1048159856 8:132006650-132006672 GAAACATTTTCTAACTCATGAGG + Intronic
1048326491 8:133443113-133443135 GAAATGCTTGCCAACCCCTGTGG + Intergenic
1048611165 8:136024716-136024738 GATCTGATTTCCAGCCCATGTGG - Intergenic
1050112468 9:2231160-2231182 GTAATAATTTCTAACAAATGTGG - Intergenic
1050577682 9:7015564-7015586 AAAATAAGTTGCAATCCATGGGG - Intronic
1050763802 9:9107669-9107691 GAAAAACTTTCCAACCAAAGGGG - Intronic
1052822594 9:33149870-33149892 GAAATAATTCCCAAGCCCTTTGG - Intronic
1053094644 9:35314289-35314311 GAAATGATTTCAAGCCCCTGAGG + Intronic
1055004438 9:71489238-71489260 GAAATAATTTCCATCACCTTAGG + Intergenic
1055313624 9:75011109-75011131 CATATAATTTCCCACCCATCAGG + Intronic
1056337969 9:85595488-85595510 GAAATAATTTCCTACTTCTGTGG - Intronic
1056583329 9:87911209-87911231 GAAAGATATTCCAACTCATGAGG + Intergenic
1057159610 9:92879295-92879317 GAAAGATATTCCAACTCATGAGG + Intergenic
1058489017 9:105475257-105475279 AAAATAGTTTCCTATCCATGGGG + Intronic
1203580625 Un_KI270745v1:41571-41593 GGAATAACTTCCAACCCAAGAGG + Intergenic
1186656907 X:11622493-11622515 GAAATAGTTACCAAACCAGGGGG + Intronic
1188245820 X:27834810-27834832 GAAATAATTGCAAATACATGTGG + Intergenic
1188330056 X:28859127-28859149 GAAATAATATCTAACCTATAAGG - Intronic
1189314652 X:40046097-40046119 AAAATAATTACCTACTCATGGGG + Intergenic
1189531252 X:41885626-41885648 TAAATAATTTGCCACCCATTAGG + Intronic
1192413097 X:70952415-70952437 GAAACAATTTGCAATTCATGTGG + Intergenic
1192758639 X:74071946-74071968 GAAATAATTACCAATCCAGTAGG - Intergenic
1193194341 X:78612454-78612476 GCAACAATTGCAAACCCATGGGG - Intergenic
1196335987 X:114535296-114535318 GTAATAATTTTCAAACTATGGGG - Intergenic
1199151048 X:144487154-144487176 GAAACTACTTCCAAACCATGTGG - Intergenic