ID: 915468130

View in Genome Browser
Species Human (GRCh38)
Location 1:156109661-156109683
Sequence GAAATAATTTCCAACCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915468124_915468130 29 Left 915468124 1:156109609-156109631 CCTGTTACTTACGGCCTAGTTTT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 915468130 1:156109661-156109683 GAAATAATTTCCAACCCATGAGG 0: 1
1: 0
2: 0
3: 22
4: 197
915468126_915468130 15 Left 915468126 1:156109623-156109645 CCTAGTTTTAGGAAAGTCAGCCT 0: 1
1: 0
2: 1
3: 15
4: 124
Right 915468130 1:156109661-156109683 GAAATAATTTCCAACCCATGAGG 0: 1
1: 0
2: 0
3: 22
4: 197
915468129_915468130 -5 Left 915468129 1:156109643-156109665 CCTCATCTGCAAAGCAGGGAAAT 0: 1
1: 0
2: 11
3: 125
4: 707
Right 915468130 1:156109661-156109683 GAAATAATTTCCAACCCATGAGG 0: 1
1: 0
2: 0
3: 22
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915468130 Original CRISPR GAAATAATTTCCAACCCATG AGG Intronic