ID: 915469274

View in Genome Browser
Species Human (GRCh38)
Location 1:156115869-156115891
Sequence AACCCTTAGAACCCAGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 1, 1: 0, 2: 0, 3: 51, 4: 647}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915469274_915469281 16 Left 915469274 1:156115869-156115891 CCTTGTCCTGGGTTCTAAGGGTT 0: 1
1: 0
2: 0
3: 51
4: 647
Right 915469281 1:156115908-156115930 CTCTGCCACTCTGCGTGTCTGGG 0: 1
1: 0
2: 0
3: 15
4: 248
915469274_915469283 27 Left 915469274 1:156115869-156115891 CCTTGTCCTGGGTTCTAAGGGTT 0: 1
1: 0
2: 0
3: 51
4: 647
Right 915469283 1:156115919-156115941 TGCGTGTCTGGGACCTTCCTTGG 0: 1
1: 0
2: 0
3: 13
4: 168
915469274_915469284 28 Left 915469274 1:156115869-156115891 CCTTGTCCTGGGTTCTAAGGGTT 0: 1
1: 0
2: 0
3: 51
4: 647
Right 915469284 1:156115920-156115942 GCGTGTCTGGGACCTTCCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 113
915469274_915469280 15 Left 915469274 1:156115869-156115891 CCTTGTCCTGGGTTCTAAGGGTT 0: 1
1: 0
2: 0
3: 51
4: 647
Right 915469280 1:156115907-156115929 ACTCTGCCACTCTGCGTGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915469274 Original CRISPR AACCCTTAGAACCCAGGACA AGG (reversed) Intronic
900649318 1:3723255-3723277 CACCCTTTGAACCCGGCACAGGG + Intronic
901014905 1:6223192-6223214 AATCCTTTGAACCCAGGAGGCGG - Exonic
901187009 1:7380485-7380507 AACTGCTTGAACCCAGGACATGG + Intronic
901378900 1:8859798-8859820 AATCGTTTGAACCCAGGACGTGG - Intergenic
901523762 1:9806201-9806223 AATCGTTTGAACCCAGGGCAGGG + Intronic
902030733 1:13420295-13420317 AACCGCTTGAACCCAGGAGATGG - Intronic
902252843 1:15166630-15166652 AACCCCTTGAACCCAGGAGGCGG + Intronic
902421982 1:16288057-16288079 AACCACTTGAACCCAGGAGATGG + Intronic
902778299 1:18688825-18688847 AACCATTTGAACCCGGGAGATGG + Intronic
903078461 1:20789590-20789612 AACCCCTTGAACCCAGGAGGCGG + Intergenic
903095440 1:20968264-20968286 AATCGTTTGAACCCAGGAGACGG - Intronic
903101580 1:21035190-21035212 AACCTTTGGCTCCCAGGACACGG - Intronic
903203003 1:21758661-21758683 AATCCCTTGAACCCAGGACACGG + Intronic
903209208 1:21806875-21806897 AATCGTTTGAACCCAGGAGACGG - Intergenic
903224119 1:21885267-21885289 AACCCCTAGAACCCAGCCCAGGG + Intronic
903518079 1:23926062-23926084 AATCGTTTGAACCCAGGAGACGG - Intergenic
903684251 1:25119488-25119510 ATCCCTTAGAACCCAGGAGGTGG - Intergenic
903838037 1:26218658-26218680 AACCCCTTGAACCCAGGAGGCGG - Intergenic
903908826 1:26707118-26707140 AACCCCTTGAACCCAGGAGGCGG - Intronic
903957015 1:27032699-27032721 AATCGTTAGAACCCAGGAGGCGG - Intergenic
904162131 1:28529984-28530006 AACCCTAAGAACCCGGGACTGGG + Intronic
904720199 1:32501766-32501788 AACCCCTTGAACCCAGGAGGTGG - Intronic
905209391 1:36363066-36363088 AATCGCTTGAACCCAGGACACGG + Intronic
905439533 1:37986033-37986055 AATCGCTTGAACCCAGGACATGG - Intronic
905560596 1:38924004-38924026 AATCCTTAGAACCCATGAAAGGG - Intronic
906063771 1:42965225-42965247 AACCTATTGAACCCAGGAGACGG + Intergenic
906470732 1:46128348-46128370 AATCCTTTGAACCCAGGATGTGG + Intronic
908496236 1:64697756-64697778 AATCCCTTGAACCCAGGAGACGG - Intergenic
908777638 1:67656599-67656621 AACCGCTTGAACCCAGGAGATGG - Intergenic
909019798 1:70418334-70418356 AACCATTTGAACCCAGGAGGCGG - Intronic
909188264 1:72517528-72517550 AATCCTTTGAACCCAGGAGGCGG - Intergenic
909786685 1:79622398-79622420 AATCACTTGAACCCAGGACACGG - Intergenic
910267719 1:85357234-85357256 AACCCTAAGAACACAGAACAAGG - Intronic
910825733 1:91405003-91405025 GACCCTTAGAACCCAGGATTAGG - Intergenic
911211994 1:95151064-95151086 AACCCTCAGAATCTAGCACAAGG - Intronic
911542458 1:99174313-99174335 AATCCTTTGAACCCAGGAGGTGG + Intergenic
911777694 1:101835613-101835635 AACTATTAGAAACCATGACAAGG - Intronic
912179094 1:107196048-107196070 AGCACTTAGAACCCAGGGCCTGG + Intronic
914229920 1:145756371-145756393 AATCACTTGAACCCAGGACACGG + Intronic
914256724 1:145966027-145966049 AATCATTAGAACCCAGGAGGCGG + Intronic
914352365 1:146851724-146851746 AATCGTTTGAACCCAGGAGATGG - Intergenic
915469274 1:156115869-156115891 AACCCTTAGAACCCAGGACAAGG - Intronic
915484984 1:156213996-156214018 AATCCTTTGAACCCGGGAGACGG - Intronic
915583393 1:156829736-156829758 ATCCCTTAGAACCCAGGAGGCGG - Intronic
915866316 1:159503111-159503133 AACCCTCAGCACCTAGGACAAGG - Intergenic
916029734 1:160865198-160865220 AATCATTTGAACCCAGGAAAAGG + Intergenic
916073976 1:161189570-161189592 GTCCCTCAGAACCCAGGATAGGG + Exonic
916817180 1:168365323-168365345 AATCGTTTGAACCCAGGAGATGG + Intergenic
917334663 1:173915042-173915064 AATCCTTTGAACCAAGTACAGGG + Intronic
917434153 1:175001826-175001848 AATCCTTTGAACCCGGGAGACGG - Intronic
917624125 1:176828914-176828936 AATCTTTTGAACCCAGGAGATGG + Intronic
918060828 1:181059960-181059982 TACCCTTGGAAACCAGTACAAGG - Exonic
918403659 1:184190869-184190891 GAGCCTTAGATCCCAGGAAAAGG - Intergenic
918780744 1:188697098-188697120 AACAATTTGAACCCAGGAGACGG + Intergenic
918887196 1:190210134-190210156 AACTCTTAGAAGCCATGACAAGG - Intronic
918901689 1:190429675-190429697 AATCGTTTGAACCCAGGAGATGG - Intronic
919868498 1:201802216-201802238 AATCGTTTGAACCCAGGAGACGG + Intronic
919886702 1:201940271-201940293 AATCCCTTGAACCCAGGAGATGG - Intronic
920043531 1:203118988-203119010 AGCCCTTACACCCCAGGACATGG + Intronic
920868784 1:209775673-209775695 GACCCTTGGGACCCAGCACAGGG + Exonic
920942769 1:210499554-210499576 AATCCTTGGAACCCAGGAGTTGG + Intronic
921552450 1:216554365-216554387 AATCCTTTGAACCCAGGAGGTGG + Intronic
922456702 1:225779229-225779251 AACCGTTTGAACCCAGGAAGTGG - Intronic
922780769 1:228250533-228250555 CAACCTCAGAACCCAAGACAAGG - Intronic
923235262 1:232026833-232026855 AACCGTTTGAACCCAGGAGGTGG - Intronic
923700344 1:236294228-236294250 AATCATTTGAACCCAGGAGATGG - Intergenic
924485127 1:244475318-244475340 AATCCCTTGAACCCAGGAGAAGG - Intronic
924583144 1:245339062-245339084 AATCACTTGAACCCAGGACACGG - Intronic
924699979 1:246441696-246441718 AACCGTTTGAACCCAGGAGGTGG - Intronic
924742469 1:246803103-246803125 AATCCTTTGAACCCAGGAGGCGG + Intergenic
1064540384 10:16398970-16398992 AACCACTTGAACCCAGGAGATGG + Intergenic
1064739361 10:18416501-18416523 AATCCTTTGAACCCAGGAGGTGG - Intronic
1064773979 10:18755226-18755248 AATCCGTTGAACCCAGGAGACGG - Intergenic
1064918388 10:20487598-20487620 AATCATTTGAACCCAGGAGATGG - Intergenic
1065529581 10:26654594-26654616 AATCCTTTGAACCCAGGAGGTGG + Intergenic
1065557361 10:26930331-26930353 AATCCTTTGAACCCAGGAGGTGG - Intergenic
1066201817 10:33149219-33149241 AATCCCTTGAACCCAGGAGATGG + Intergenic
1066294140 10:34039627-34039649 AATCCTTGGAACCCAGGAAGTGG - Intergenic
1066378070 10:34876580-34876602 AATCATTTGAACCCAGGAGATGG + Intergenic
1066383305 10:34919865-34919887 ACTCCCTGGAACCCAGGACATGG + Intergenic
1066659162 10:37722619-37722641 AATCACTTGAACCCAGGACATGG + Intergenic
1068183331 10:53551106-53551128 TACCCTTAGAACTCAGAAAAAGG + Intergenic
1068858977 10:61827470-61827492 AATCCTTTGAACCCAGGAGGCGG + Intergenic
1068936943 10:62645050-62645072 AATCGCTTGAACCCAGGACACGG + Intronic
1068983530 10:63086146-63086168 AATCGCTTGAACCCAGGACAGGG + Intergenic
1069485517 10:68820232-68820254 AACCCCTTGAACCCAGGAGGCGG - Intergenic
1069563747 10:69449925-69449947 AGCCCTGGGAACCCAGGACTGGG + Intergenic
1070102889 10:73405154-73405176 AACCCCTTGAACCCAGGAGGTGG + Intronic
1070245186 10:74724334-74724356 AATCATTTGAACCCGGGACATGG + Intergenic
1070733560 10:78848166-78848188 ATCGCTTAGAACCCAGGAGGCGG + Intergenic
1072133766 10:92523292-92523314 AATCGTTTGAACCCAGGAGATGG + Intronic
1072640867 10:97210092-97210114 AATCATTTGAACCCAGGAGACGG + Intronic
1072701952 10:97648696-97648718 AACCCTCCGGACCCTGGACAGGG - Intronic
1072944941 10:99801321-99801343 AACCGCTTGAACCCAGGAGATGG - Intronic
1073062002 10:100738835-100738857 ATCCCTCAGGAGCCAGGACAGGG - Intronic
1073156246 10:101349325-101349347 AACCCCTTGAACCCGGGAGATGG - Intergenic
1073237198 10:102027190-102027212 AATCGCTTGAACCCAGGACAGGG + Intronic
1073331046 10:102669938-102669960 CACCCTTACAACCAAGGAAAGGG - Intergenic
1074496200 10:113982236-113982258 AACAGTAAGAACCCAGGCCATGG + Intergenic
1075022874 10:118964301-118964323 AATCCCTAGAACCCATGAAAAGG + Intergenic
1075063592 10:119273858-119273880 AATCATTTGAACCCAGGAGATGG - Intronic
1075261990 10:120970947-120970969 AGCCCTTTCAACCCAGGACCAGG - Intergenic
1075750626 10:124767897-124767919 AATCGTTTGAACCCAGGAAACGG + Intronic
1075819506 10:125294360-125294382 ATCCCTTAGAACCCAGCAGTTGG + Intergenic
1075898493 10:126019075-126019097 ATCACTTAGAACCAAGGAGATGG - Intronic
1076375907 10:129984480-129984502 AATCCTTTGAACCCAGGAGGTGG + Intergenic
1077809169 11:5620262-5620284 AATCCATAGAACCCAGGAGGCGG - Intronic
1078262622 11:9725084-9725106 AATCCCTTGAACCCAGGAGATGG - Intronic
1078305604 11:10182858-10182880 AATCACTTGAACCCAGGACACGG - Intronic
1078999494 11:16739197-16739219 AACATTTAGAACCCAAAACAGGG - Intronic
1079063519 11:17270447-17270469 AATCGCTTGAACCCAGGACACGG - Intronic
1079793417 11:24768218-24768240 AATCCTTTGAACCCAGGAGGTGG - Intronic
1081537573 11:44006590-44006612 AATCATTTGAACCCAGGAGATGG - Intergenic
1081885925 11:46496293-46496315 AATCCCTTGAACCCAGGAGATGG + Intronic
1082770422 11:57203466-57203488 AACTCTGGGAACCCATGACATGG + Intergenic
1083266302 11:61548421-61548443 AACCCTGGGAGCCAAGGACAAGG + Intronic
1083306067 11:61762587-61762609 GCCCCCAAGAACCCAGGACAGGG - Intronic
1083458504 11:62795387-62795409 AACCACTTGAACCCAGGAGACGG + Intronic
1083830713 11:65231557-65231579 AATCCCTTGAACCCGGGACACGG - Intergenic
1083943625 11:65911949-65911971 AACCCTCAGAGGCCAGGAGAGGG - Intergenic
1084604796 11:70166229-70166251 AACCCCTTGAACCCAGGAGGTGG + Intronic
1085194158 11:74657961-74657983 AAACCTTACAAGCCAGGAGAGGG - Intronic
1085782164 11:79419407-79419429 CACCCTTAGCACCCACGGCACGG + Intronic
1086373782 11:86180264-86180286 AATCCTTTGAACCCAGGAGGCGG - Intergenic
1087393381 11:97567678-97567700 AACCACTTGAACCCAGGAAACGG + Intergenic
1087972206 11:104498181-104498203 AATCATTTGAACCCAGGAGACGG + Intergenic
1088646420 11:111920106-111920128 AATCCCTTGAACCCAGGAGACGG + Intronic
1088886948 11:114015242-114015264 AACCCTCAGAACCCAGTGGATGG + Intergenic
1089999931 11:122947843-122947865 AACCCTCAGAACCTTGGCCAAGG - Intronic
1090457040 11:126859164-126859186 CATCCTTGGAACCAAGGACAGGG - Intronic
1090863663 11:130676341-130676363 AACCCTTATACCCCAGGAGTTGG - Intronic
1091018541 11:132077456-132077478 AGCCCTTAGAAGCCAGGAACTGG + Intronic
1091112397 11:132982044-132982066 GAGCCGTAGAATCCAGGACAAGG - Intronic
1091613743 12:2033378-2033400 ACACCCTGGAACCCAGGACATGG + Intronic
1091895714 12:4102663-4102685 AATCGCTTGAACCCAGGACACGG - Intergenic
1092234055 12:6794871-6794893 ATCGCTTAGAACCCAGGAGGCGG - Intronic
1092359989 12:7828460-7828482 ATCGCTTAGAACCCAGGAGGCGG + Intronic
1092372405 12:7928017-7928039 AATCATTTGAACCCAGGAGATGG + Intronic
1092452543 12:8616427-8616449 AATCCTTTGAACCCAGGAGGCGG - Intergenic
1092477697 12:8833058-8833080 AATCCTTTGAACCCAGGAGGGGG - Intronic
1093462276 12:19417789-19417811 AATCGTTTGAACCCAGGACGTGG - Intronic
1093883471 12:24432723-24432745 AATCCTTTGAACCCAGGAGGCGG + Intergenic
1093970960 12:25375665-25375687 AATCACTTGAACCCAGGACACGG - Intergenic
1094219283 12:27975230-27975252 AACCCCGAGACCCAAGGACAGGG + Intergenic
1094513783 12:31115614-31115636 AATCCTTTGAACCCAGGAGCTGG + Intergenic
1095285360 12:40404259-40404281 AATCATTTGAACCCAGGAGACGG - Intronic
1096001898 12:48137146-48137168 AATCCCTTGAACCCAGGAGATGG - Intronic
1097224621 12:57470219-57470241 ACCCCTGAGAATCCAGGGCAAGG + Intronic
1097239545 12:57565709-57565731 AATCGTTTGAACCCAGGACAGGG - Intronic
1097903575 12:64897549-64897571 GGGCCTTAGAACCAAGGACAAGG + Intergenic
1098574039 12:72020573-72020595 AATCATTTGAACCCAGGAGACGG - Intronic
1098860748 12:75707436-75707458 AATCATTTGAACCCAGGAGACGG - Intergenic
1098868577 12:75789405-75789427 AATCCTTTGAACCCAGGAGGTGG + Intergenic
1098888087 12:75980833-75980855 AACCACTTGAACCCAGGAGATGG - Intergenic
1099767428 12:87005919-87005941 AATCATTTGAACCCAGGAGATGG + Intergenic
1099953826 12:89333262-89333284 TCCCTTTAGAACCCAGGACTTGG - Intergenic
1100070356 12:90709081-90709103 ATGCCTGAGAACCCAGGGCAGGG + Intergenic
1100495529 12:95121361-95121383 AACCCCTTGAACCCAGGAGGTGG + Intronic
1100515406 12:95322743-95322765 AATCATTTGAACCCAGGAGACGG + Intergenic
1100874610 12:98949037-98949059 AATCCCTTGAACCCAGGAGAGGG - Intronic
1101456384 12:104835928-104835950 ATCACTTAGAACCCAGGAGGCGG - Intronic
1101895036 12:108749918-108749940 AATCATTTGAACCCAGGAGATGG + Intergenic
1102079146 12:110084119-110084141 AATCCTTTGAACCCAGGAGGTGG - Intergenic
1102149794 12:110680841-110680863 AACCATTTGAACCCAGGAGACGG + Intronic
1102244633 12:111347722-111347744 ACCCCTGACCACCCAGGACAAGG + Exonic
1102365352 12:112329452-112329474 AATCATTTGAACCCAGGAGACGG - Intronic
1102417994 12:112781071-112781093 AATCGTTTGAACCCAGGAGAAGG + Intronic
1102877229 12:116458001-116458023 AATCCCTTGAACCCAGGAGATGG - Intergenic
1103072310 12:117954928-117954950 AACCACTTGAACCCAGTACACGG + Intronic
1103325035 12:120114943-120114965 GTCCCTCAGAACCCAGGCCAGGG + Intronic
1103500618 12:121399262-121399284 AATCCTTTGAACCCGGGAGACGG + Intronic
1103504010 12:121428277-121428299 AATCGCTTGAACCCAGGACACGG - Intronic
1103516385 12:121511095-121511117 AATCCCTTGAACCCAGGAGATGG - Intronic
1103758304 12:123228599-123228621 AATCCCTTGAACCCAGGACACGG + Intronic
1104639802 12:130460131-130460153 AACCCTGAGACCCCTGCACAGGG + Intronic
1105381648 13:19892799-19892821 AATCGCTTGAACCCAGGACACGG - Intergenic
1106605409 13:31224038-31224060 ACCCCTCAGAACCCAGGCCCAGG - Intronic
1106727222 13:32498431-32498453 AATCATTTGAACCCAGGACACGG - Intronic
1106941735 13:34787536-34787558 AATCCCTTGAACCCAGGAGACGG + Intergenic
1108077137 13:46693056-46693078 AACCCCTTGAACCCAGGAGGCGG - Intronic
1110226597 13:73126067-73126089 AATCCCTTGAACCCAGGAGATGG - Intergenic
1111807139 13:93051686-93051708 AATCATTTGAACCCAGGAGATGG + Intergenic
1112105400 13:96234321-96234343 AATCGTTTGAACCCAGGAGACGG + Intronic
1113393395 13:109919512-109919534 AATCGTTTGAACCCAGGAGACGG + Intergenic
1114021941 14:18487859-18487881 AACACTCAGAACCCAGGAACTGG - Intergenic
1115785578 14:36821728-36821750 AATCAGTTGAACCCAGGACATGG + Intronic
1116257607 14:42577019-42577041 AATCGTTTGAACCCAGGAAACGG + Intergenic
1117047766 14:51829927-51829949 AATCCTTTGAACCCAGGAGGCGG - Intronic
1118294743 14:64558720-64558742 AACCCCTTGAACCCAGGATGGGG - Intronic
1118404094 14:65406620-65406642 AATCATTTGAACCCAGGAGAAGG - Intergenic
1118959195 14:70513063-70513085 AATCGTTTGAACCCAGGAGACGG + Intergenic
1119247635 14:73126601-73126623 AATCGTTTGAACCCAGGAAACGG - Intergenic
1119247652 14:73126796-73126818 AATCGTTTGAACCCAGGAAATGG - Intergenic
1119867205 14:77983784-77983806 AATCATTTGAACCCAGGACCTGG - Intergenic
1120788672 14:88559576-88559598 AATCCTTTGAACCCAGGAGATGG + Intergenic
1120943966 14:89976621-89976643 AATCGTTTGAACCCAGGAGATGG - Intronic
1121165496 14:91792405-91792427 AACCCTTAGCACACAGGAAATGG - Exonic
1121487093 14:94325296-94325318 AATCCCTTGAACCCAGGAGACGG - Intergenic
1121531296 14:94656080-94656102 AACCTTTAGGAGCCAGGGCATGG + Intergenic
1121624928 14:95376941-95376963 AATCGCTTGAACCCAGGACATGG + Intergenic
1123044532 14:105504844-105504866 AATCCTTTGAACCCAGGAGGTGG - Intergenic
1123192375 14:106583523-106583545 CAGCCTGAGAACCCAGAACATGG - Intergenic
1124380546 15:29161361-29161383 CACCCTGAGACCCCAGGGCATGG + Intronic
1125700236 15:41676267-41676289 AATCACTTGAACCCAGGACATGG - Intronic
1126031039 15:44497908-44497930 AATCACTAGAACCCAGGAGACGG + Intronic
1126698571 15:51346977-51346999 AACCGCTTGAACCCAGGAGATGG + Intronic
1126755244 15:51919460-51919482 AACTGCTCGAACCCAGGACATGG - Intronic
1126788452 15:52198666-52198688 AATCTCTTGAACCCAGGACATGG - Intronic
1128223812 15:65987795-65987817 AATCCTTTGAACCCAGGAGGTGG - Intronic
1128285725 15:66435410-66435432 AATCGTTTGAACCCAGGAGATGG - Intronic
1128930747 15:71703065-71703087 AATCCTTCGAACCCAGGAGGCGG - Intronic
1128962208 15:72018379-72018401 AATCGCTAGAACCCAGGAGATGG + Intronic
1129265603 15:74391678-74391700 AACCCATAGAACACAGGGGAAGG - Intergenic
1129572420 15:76702532-76702554 AATCCTTTGAACCCAGGAGGTGG - Intronic
1129591516 15:76919216-76919238 AATCCCTTGAACCCAGGAGATGG - Intergenic
1129703026 15:77778809-77778831 AATCCTTAAAACCCAAGTCATGG + Intronic
1129991923 15:79972705-79972727 AATCCTTTGAACCCAGGAGGCGG + Intergenic
1130819090 15:87473917-87473939 AGCCCTTAGAGCTCAGGCCAAGG - Intergenic
1131235101 15:90689859-90689881 AATCACTTGAACCCAGGACATGG - Intergenic
1131542530 15:93287170-93287192 AACCGCTTGAACCCAGGAGATGG + Intergenic
1132980903 16:2738261-2738283 AAACCTGAGAACCCAGCACGGGG + Intergenic
1133122235 16:3616532-3616554 AATCCCTTGAACCCAGGAGATGG + Intronic
1133151158 16:3831908-3831930 AACTGTTTGAACCCAGGACGTGG + Intronic
1133264414 16:4574843-4574865 TACCCTCAGCACCCAGGACCCGG - Intronic
1133571657 16:7046690-7046712 AATCGTTTGAACCCAGGAGACGG - Intronic
1133797295 16:9056475-9056497 AACCGCTTGAACCCGGGACACGG + Intergenic
1133988080 16:10683675-10683697 AACCCCTTGAACCCAGGAGGCGG - Intronic
1134272972 16:12750374-12750396 AACGCTTAGAAGCCAGTATAGGG + Intronic
1134442905 16:14309864-14309886 AACCCTTTGAAGCCAGAGCAGGG - Intergenic
1134491224 16:14696898-14696920 AATCCCTTGAACCCAGGAGAAGG + Intergenic
1134496605 16:14736016-14736038 AATCCCTTGAACCCAGGAGAAGG + Intronic
1134622509 16:15700181-15700203 AACCGTTTGAACCCAGGAGGCGG - Intronic
1135109033 16:19676163-19676185 AATCATTTGAACCCAGGAGATGG + Intronic
1135235220 16:20748963-20748985 AATCATTTGAACCCAGGAAATGG + Intronic
1135594667 16:23732585-23732607 AATCGTTTGAACCCAGGAGATGG + Intergenic
1135743918 16:24999500-24999522 AATCCTTAGAGCCCAGGAGCCGG - Intronic
1135892057 16:26366114-26366136 CCCCCATAGAACCCAGCACAGGG - Intergenic
1136082502 16:27861288-27861310 AATCGTTTGAACCCAGGAGACGG + Intronic
1136519064 16:30784773-30784795 AAGCCTTTGAACCCAGGATGGGG + Intronic
1137623751 16:49894385-49894407 AACCGCTAGAACCCAGGAGGTGG + Intergenic
1137974483 16:53019788-53019810 AATCTTTTGAACCCAGGAGATGG - Intergenic
1138669104 16:58598480-58598502 AATCACTTGAACCCAGGACAAGG + Intronic
1139940048 16:70598650-70598672 AATCGCTTGAACCCAGGACACGG + Intronic
1139981664 16:70863795-70863817 AATCGTTTGAACCCAGGAGATGG + Intronic
1140031315 16:71341360-71341382 AATCGTTTGAACCCAGGACACGG + Intergenic
1140326852 16:74012723-74012745 AACTGTTTGAACCCAGGAGACGG + Intergenic
1140521834 16:75588493-75588515 AACCATTTGAACCCAGGAGAAGG - Intergenic
1141291706 16:82723820-82723842 AACACTGAGAACCTAGCACATGG - Intronic
1141491038 16:84373031-84373053 AATCCTTTGAACCCAGGAGGCGG + Intronic
1141528674 16:84630332-84630354 AATCCCTTGAACCCAGGACGTGG - Intergenic
1142862711 17:2772943-2772965 AATCATTTGAACCCAGGAAACGG - Intergenic
1143507427 17:7375520-7375542 AATCATTTGAACCCAGGAGATGG + Intergenic
1143560463 17:7691120-7691142 AATCATTTGAACCCAGGAGATGG + Intronic
1143697954 17:8634125-8634147 AATCATTTGAACCCAGGAGATGG + Intergenic
1143799368 17:9365884-9365906 AATCGTTTGAACCCAGGAGATGG + Intronic
1144558029 17:16298938-16298960 AACCATTCGAACCCAGGAGATGG + Intronic
1144769846 17:17753327-17753349 AACCCTGTCAAGCCAGGACAAGG - Intronic
1144859845 17:18294414-18294436 AACCGTTTGAACCCAGGAGGCGG - Intronic
1145042084 17:19584544-19584566 AATCGTTTGAACCCAGGAGATGG - Intergenic
1146794970 17:35774383-35774405 AGACCTGAGACCCCAGGACAAGG + Intronic
1146945886 17:36873220-36873242 AATCACTTGAACCCAGGACATGG - Intergenic
1147381789 17:40060618-40060640 AATCCCTTGAACCCAGGAGACGG + Intronic
1147523706 17:41200061-41200083 AATCGTTAGAACCCAGGAGGCGG - Intronic
1147641769 17:42006708-42006730 AATCCCTTGAACCCAGGAGACGG + Intronic
1147781353 17:42944836-42944858 AATCGCTTGAACCCAGGACAAGG + Intergenic
1148174661 17:45553209-45553231 AACCACTAGAACCCAGGAGGCGG - Intergenic
1148296710 17:46509818-46509840 AACCACTAGAACCCAGGAGGCGG + Intergenic
1150165004 17:62933032-62933054 AACCCCCAGAAGCCAGGAAAAGG + Intergenic
1150253918 17:63728803-63728825 AATCGTTTGAACCCAGGAGATGG + Intronic
1150259673 17:63778725-63778747 AATCTCTTGAACCCAGGACACGG - Intronic
1150332360 17:64304470-64304492 AACCATTTGAACCCAGGAGGCGG + Intergenic
1150378827 17:64704529-64704551 AATCGTTTGAACCCAGGAGACGG + Intergenic
1150416603 17:64993725-64993747 AACCCCTTGAACCCAGGAGGTGG + Intergenic
1150730534 17:67689113-67689135 AATCGTTTGAACCCAGGAGATGG + Intronic
1150749828 17:67850453-67850475 AACCGCTTGAACCCAGGAGACGG - Intronic
1151122621 17:71809038-71809060 AACCCTCAGGACCTAGGACCAGG - Intergenic
1151145255 17:72034540-72034562 AAACCTTAGAAGGCAGCACAGGG + Intergenic
1151615609 17:75208356-75208378 AAGCCTTTGAACCCAGGAGGCGG + Intronic
1151755670 17:76074227-76074249 AACCGTTTGAACCCGGGAGACGG + Intronic
1152100437 17:78298535-78298557 AATCGTTAGAACCCAGGAGGTGG + Intergenic
1152586966 17:81193513-81193535 ACCCCTCAGACCCCAGGCCAAGG + Intronic
1153344477 18:4011087-4011109 AACCACTTGAACCCAGGAGATGG + Intronic
1153838082 18:8982182-8982204 AATCGTTTGAACCCAGGAGATGG - Intergenic
1154948901 18:21188824-21188846 ATCCCTTAGAACCCGGGAGGTGG - Intergenic
1155453545 18:25987475-25987497 AATCGCTTGAACCCAGGACAGGG + Intergenic
1156539968 18:37899840-37899862 AACCCCTAGAGCCCAAGTCAAGG - Intergenic
1157937827 18:51892737-51892759 AATCCTTTGAACCCAGAAGATGG + Intergenic
1158706665 18:59798397-59798419 AATCGATAGAACCCAGGAAAAGG + Intergenic
1159195778 18:65112214-65112236 AATCGCTTGAACCCAGGACATGG - Intergenic
1159260764 18:66009188-66009210 ATCGCTTAGAACCCAGGAGGTGG + Intergenic
1159449410 18:68580967-68580989 AATCGTTAGAACCCAGGAGGCGG + Intergenic
1159690838 18:71485384-71485406 AACCAGAAGAGCCCAGGACAAGG - Intergenic
1160120463 18:76126238-76126260 CTCCCCTAGGACCCAGGACATGG - Intergenic
1160495684 18:79373574-79373596 AATCATTTGAACCCAGGAGACGG - Intronic
1160757989 19:767748-767770 AATCCTTTGAACCCAGGAGGTGG + Intergenic
1161082257 19:2317114-2317136 AATCCCTTGAACCCAGGAGATGG - Intronic
1161231438 19:3176895-3176917 CTCCCTTGGACCCCAGGACAGGG + Intronic
1161298930 19:3533468-3533490 CTCCCTAAGAACACAGGACAGGG - Intronic
1161911088 19:7194597-7194619 AATCGCTTGAACCCAGGACATGG - Intronic
1162121237 19:8470412-8470434 AATCACTAGAACCCAGGAAATGG - Intronic
1162203563 19:9038813-9038835 AATCGTTTGAACCCAGGAGACGG - Intergenic
1162409484 19:10496712-10496734 AATCGCTTGAACCCAGGACATGG + Intronic
1163100555 19:15093506-15093528 AACCATTTGAACCCAGGAGGTGG - Intergenic
1164052004 19:21591819-21591841 AACCCTTATAAACAAGGGCATGG + Intergenic
1164211614 19:23102580-23102602 AATCCCTAGAACCCAGGAGGTGG - Intronic
1164556508 19:29256762-29256784 AATCCTTGGCACCCAGGCCAGGG + Intergenic
1164676766 19:30106332-30106354 AATCACTTGAACCCAGGACACGG + Intergenic
1164825619 19:31282873-31282895 AACCCTCAGAAACCATGACATGG - Intronic
1165087099 19:33358042-33358064 AACCATTTGAACCCAGGAGGCGG - Intergenic
1165260432 19:34611734-34611756 AATCCTTTGAACCCAGGAGGCGG - Intronic
1165303513 19:34988719-34988741 AATCCCTTGAACCCAGGAGATGG - Intergenic
1165398656 19:35583262-35583284 ATCACTTAGAACCCAGGAGGTGG + Intergenic
1165478631 19:36047741-36047763 AATCCCTAGAACCCAGGAGGTGG + Intronic
1165502531 19:36201559-36201581 AATCGTTTGAACCCAGGAGATGG - Intronic
1166053486 19:40274919-40274941 AACCCCTTGCACCCAGGGCAGGG + Intronic
1166314695 19:41982537-41982559 AACCCCTTGAACCCAGGAGGTGG + Intronic
1166383965 19:42370170-42370192 TGCCCTGAGAACCCAGGACAGGG - Exonic
1166451839 19:42908577-42908599 AACTTAAAGAACCCAGGACAGGG - Intronic
1166454285 19:42927442-42927464 AACTTAAAGAACCCAGGACAGGG - Intronic
1166481363 19:43176874-43176896 AACTTAAAGAACCCAGGACAGGG - Intronic
1166483835 19:43195998-43196020 AACTTAAAGAACCCAGGACAGGG - Intronic
1166514494 19:43436204-43436226 AATCGCTTGAACCCAGGACAAGG + Intergenic
1167082384 19:47285777-47285799 AATCATTTGAACCCAGGAGACGG - Intergenic
1167252920 19:48410439-48410461 AACCGCTTGAACCCAGGAGACGG + Intronic
1167833377 19:52045906-52045928 AATCCCTTGAACCCAGGACGTGG + Intronic
1168011438 19:53536814-53536836 AACCCCTTGAACCCAGGAGGCGG + Intronic
1168068215 19:53932165-53932187 ATCGCTTTGAACCCAGGAGATGG + Intronic
1168256081 19:55166103-55166125 TCCCCTTAGAACCTAGGCCACGG - Intronic
1168608058 19:57775687-57775709 AATCATTTGAACCCAGGAGATGG - Intronic
1168723034 19:58565179-58565201 AACCGCTTGAACCCAGGAGATGG - Intronic
1202654294 1_KI270708v1_random:4826-4848 AATCGTTTGAACCCAGGACGCGG + Intergenic
925439691 2:3873908-3873930 AGCCCCTAGAACACAGGGCACGG - Intergenic
925759046 2:7166552-7166574 AATCGCTAGAACCCAGGAGATGG - Intergenic
927762316 2:25770293-25770315 AATCATTTGAACCCAGGACGTGG - Intronic
927868451 2:26608149-26608171 AATCCCTTGAACCCAGGAGACGG + Intronic
929269406 2:39957156-39957178 AATCCTTTGAACCCAGGAGGTGG - Intergenic
929409064 2:41676444-41676466 AATCATTTGAACCCAGGAGATGG + Intergenic
929720931 2:44366806-44366828 AATCGTTTGAACCCAGGACATGG - Intronic
929995868 2:46825907-46825929 ATCCCCTAGACCCCAGGCCAGGG - Intronic
930635803 2:53804358-53804380 AACCACTTGAACCCAGGAGATGG - Intronic
931352723 2:61506334-61506356 AATCATTTGAACCCAGGAAATGG + Intronic
931680184 2:64740088-64740110 AACCGTTTGAACCCAGGAGGCGG + Intronic
931857195 2:66315155-66315177 AATCCTTTGAACCCAGGAGCCGG + Intergenic
932448402 2:71794578-71794600 AGGCCTTAGAACCCAGGCCTGGG + Intergenic
935033432 2:99344521-99344543 AATCCCTTGAACCCAGGAGACGG - Intronic
935285018 2:101556779-101556801 AATCCCTTGAACCCAGGAGATGG + Intergenic
936553315 2:113470076-113470098 AATCATTTGAACCCAGGAAATGG - Intronic
936558827 2:113518970-113518992 AATCCCTTGAACCCAGGAGACGG + Intergenic
937141281 2:119603448-119603470 CATCCTTACAACCCAGGGCATGG - Intronic
937479361 2:122242648-122242670 AACTCTTAGAAACAGGGACATGG + Intergenic
937670174 2:124530221-124530243 AATCCCTTGAACCCAGGAGATGG + Intronic
938126877 2:128680649-128680671 AATCGTTTGAACCCAGGACGTGG - Intergenic
938301448 2:130216939-130216961 AATCATTTGAACCCAGGAGACGG + Intergenic
938601493 2:132846389-132846411 AATCGTTTGAACCCAGGAGACGG - Intronic
939065300 2:137476655-137476677 AATCCCTTGAACCCAGGAGATGG - Intronic
941181841 2:162268674-162268696 AATCCCTTGAACCCAGGAGATGG - Intronic
941519389 2:166520545-166520567 AATCATTTGAACCCAGGAGACGG + Intergenic
942913314 2:181272173-181272195 AATCACTAGAACCCAGGAGATGG + Intergenic
943494464 2:188603696-188603718 AATCGTTTGAACCCAGGAGATGG + Intergenic
943992290 2:194711886-194711908 AATCTTTTGAACCCAGGAGATGG + Intergenic
944173774 2:196806767-196806789 AATCCTTTGAACCCAGGAGGTGG + Intronic
945755800 2:213845282-213845304 AATCATTTGAACCCAGGAGATGG - Intronic
946497932 2:220214716-220214738 AACACTTAGAACCAGGCACATGG + Intergenic
946834211 2:223756248-223756270 AATCGTTTGAACCCAGGAGACGG + Intronic
947717097 2:232346406-232346428 AATCACTTGAACCCAGGACATGG + Intergenic
947879167 2:233490248-233490270 AATCACTTGAACCCAGGACAGGG - Intronic
948074204 2:235153117-235153139 AACCACTTGAACCCAGGAGACGG - Intergenic
1170576657 20:17668054-17668076 AATCCTTAGAACCCCAGAAATGG - Intronic
1170649823 20:18229041-18229063 AATCCCTTGAACCCAGGAGATGG + Intergenic
1171007258 20:21478701-21478723 AATCCTTTGAACCCGGGAGATGG + Intergenic
1172473732 20:35221452-35221474 AACCGCTTGAACCCAGGAGACGG + Intergenic
1172503246 20:35442231-35442253 AACCCCTTGAACCCAGGAGGCGG - Intronic
1172514597 20:35524102-35524124 AACCATTTGAACCCAGGAGGCGG - Intronic
1172538144 20:35690010-35690032 AATCATTAGAACCCAGGAGGCGG + Intronic
1172926617 20:38542786-38542808 AATCGCTTGAACCCAGGACACGG + Intronic
1173062340 20:39674671-39674693 AACCCTTCAAAGCCAGGATAAGG + Intergenic
1173762548 20:45576484-45576506 AATCATTTGAACCCAGGAGAGGG - Intronic
1173995687 20:47336967-47336989 AACCCTTGGAATACAGGTCATGG + Intronic
1174235448 20:49086829-49086851 AGCCCTTTTAACCCAGGTCAGGG + Intronic
1174600988 20:51724680-51724702 CACCCCCAGAACCCAGCACAGGG + Intronic
1174846432 20:53947826-53947848 CACCTTTACAACCCAGGGCAGGG + Intronic
1174893900 20:54428445-54428467 AATCGTTTGAACCCAGGAGATGG + Intergenic
1175123947 20:56737839-56737861 AATCCCTTGAACCCAGGACGTGG - Intergenic
1175211778 20:57362864-57362886 ATCACTTAGAACCCAGGAGGTGG - Intronic
1175823538 20:61924518-61924540 CGCCCACAGAACCCAGGACACGG - Intronic
1177018678 21:15824701-15824723 AATCATTTGAACCCAGGAGATGG - Intronic
1177434425 21:21033029-21033051 AAACCTTTGAACCCAGGAGGCGG - Intronic
1178125539 21:29511900-29511922 AATCCCTTGAACCCAGGAGACGG + Intronic
1178912888 21:36690374-36690396 AACCACTTGAACCCAGGAGATGG + Intergenic
1180373281 22:12066055-12066077 AATCGCTTGAACCCAGGACACGG + Intergenic
1180389205 22:12209599-12209621 AATCGTTTGAACCCAGGACGCGG - Intergenic
1180416738 22:12724877-12724899 AATCGTTTGAACCCAGGACGCGG + Intergenic
1180446400 22:15418205-15418227 AACACTCAGAACCCAGGAACTGG - Intergenic
1180572666 22:16742950-16742972 AACCCTTAGCAGAAAGGACAAGG - Intergenic
1180607567 22:17071265-17071287 AATCCCTAGAACCCAGGAGGTGG - Intergenic
1180635778 22:17261911-17261933 AATCATTTGAACCCAGGAGACGG + Intergenic
1180789575 22:18567622-18567644 AATCCCTTGAACCCAGGAGACGG + Intergenic
1181232167 22:21427690-21427712 AATCCCTTGAACCCAGGAGACGG - Intronic
1181246484 22:21507167-21507189 AATCCCTTGAACCCAGGAGACGG + Intergenic
1182479643 22:30598981-30599003 ATCGCTTCGAACCCAGGAAACGG - Intronic
1182518914 22:30874323-30874345 AATCGTTTGAACCCAGGAGATGG + Intronic
1182642169 22:31777047-31777069 AACCGTTTGAACCCAGGAGGCGG - Intronic
1182658699 22:31909810-31909832 AACCATTTGAACCCGGGAGATGG + Intergenic
1182861358 22:33562155-33562177 AACTATTAGAAGCCAGGTCATGG - Intronic
1183385356 22:37510993-37511015 AATCATTTGAACCCAGGAGATGG + Intronic
1183444003 22:37840798-37840820 AATCACTTGAACCCAGGACATGG + Intronic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1184360616 22:44015730-44015752 AATCATTTGAACCCAGGAGACGG + Intronic
1184532735 22:45066701-45066723 AACCATTAGCACCCAACACAGGG - Intergenic
1184616687 22:45642819-45642841 AACTCTTAGAATTCAGGACAGGG + Intergenic
1184743915 22:46445107-46445129 AATCCTTTGAACCCAGGAGGCGG + Intronic
949940658 3:9151829-9151851 AGCCCAGAGAGCCCAGGACAGGG + Intronic
950373294 3:12549328-12549350 AACCGCTTGAACCCAGGAGATGG - Intronic
950787686 3:15449814-15449836 CAGCCTTGGGACCCAGGACAGGG + Intronic
951733232 3:25834131-25834153 AATCATTTGAACCCAGGAGACGG - Intergenic
952283143 3:31942446-31942468 AATCCTTTGAACCCAGGAGTTGG + Intronic
952449725 3:33420573-33420595 AACCGTTTGAACCCAGGAGGCGG - Intronic
952463266 3:33552203-33552225 AGCCGTTTGAACCCAGGAGACGG - Intronic
952567614 3:34678375-34678397 AACTCTTAGAACCCTGGAGGTGG + Intergenic
954019804 3:47729470-47729492 AATCGTTTGAACCCAGGAGACGG - Intronic
954551253 3:51483351-51483373 AACCCCTTGAACCCAGGAGACGG + Intronic
954643682 3:52117671-52117693 AACCCTTAGAACTCAGAAAGTGG + Intronic
954669495 3:52281424-52281446 AATCACTTGAACCCAGGACATGG - Intronic
954780282 3:53053774-53053796 AATCCCTTGAACCCAGGAGATGG + Intronic
955303090 3:57802362-57802384 AATCGTTTGAACCCAGGAGACGG - Intronic
955311085 3:57887314-57887336 AACCGTTTGAACCCAGGAAGCGG - Intronic
955906183 3:63810057-63810079 AATCATTTGAACCCAGGATATGG + Intergenic
956144014 3:66173964-66173986 AATCATTTGAACCCAGGAGATGG + Intronic
956493172 3:69796066-69796088 AATCATTTGAACCCAGGAGACGG - Intronic
957105021 3:75875949-75875971 AACCCTTAGCAAAAAGGACAAGG + Intergenic
957368007 3:79251861-79251883 AATCCCTAGAACCCAGGAGGTGG + Intronic
958716721 3:97792394-97792416 AATCATTTGAACCCAGGAGATGG + Intronic
959655089 3:108794905-108794927 AATCTTTTGAACCCAGGAGATGG - Intergenic
959824526 3:110777825-110777847 AACCATTTGAACCCAGGAGGTGG + Intergenic
960458448 3:117902635-117902657 AATCCTTTGAACCCAGGAGGAGG + Intergenic
961530663 3:127538085-127538107 TATCCTTAGCACCCAGCACAGGG + Intergenic
962313292 3:134341068-134341090 AGCCCTAAGGGCCCAGGACATGG + Intergenic
962544444 3:136418271-136418293 AATCACTTGAACCCAGGACACGG + Intronic
962800710 3:138888237-138888259 AATCATTTGAACCCAGGAGACGG - Intergenic
962860045 3:139390649-139390671 ATCGCTTAGAACCCAGGAGGTGG + Intergenic
964558338 3:157965422-157965444 AGCCCTTACACCCCAGGAAAGGG + Intergenic
966807153 3:183816684-183816706 AATCTTTAGAACCTAGCACAAGG + Exonic
967052547 3:185798112-185798134 AATCGCTTGAACCCAGGACATGG + Intronic
967784521 3:193476694-193476716 AACACTTAGAAACCAGGGTAGGG + Intronic
967938183 3:194746099-194746121 AACCCATAGCATCCAGCACAGGG + Intergenic
968325457 3:197810241-197810263 AATCCTTTGAACCCAGGAGGCGG - Intronic
969208059 4:5663832-5663854 AACCACTTGAACCCAGGAGACGG + Intronic
969853774 4:9982953-9982975 AACCACTTGAACCCAGGAGATGG - Intronic
970930042 4:21499242-21499264 AATCATTTGAACCCAGGAGACGG + Intronic
971313030 4:25542554-25542576 AATCCCTTGAACCCAGGAGAGGG - Intergenic
971366608 4:25982784-25982806 AACCATTTGAACCCAGGAGGTGG - Intergenic
971559430 4:28057379-28057401 AATCATTTGAACCCAGGAGACGG + Intergenic
971655624 4:29340503-29340525 AATCCCTTGAACCCAGGAGATGG + Intergenic
972367905 4:38393225-38393247 AACCGCTTGAACCCAGGAGATGG - Intergenic
972610847 4:40654045-40654067 AACCGTTTGAACCCAGGAGTTGG + Intergenic
974425604 4:61739393-61739415 AATCGTTTGAACCCAGGAAATGG - Intronic
975638290 4:76472779-76472801 AATCGCTTGAACCCAGGACACGG - Intronic
976555841 4:86450715-86450737 AACACTTACAACCCAGCATATGG + Intronic
977232220 4:94465485-94465507 AACCGCTTGAACCCAGGACGTGG - Intronic
979264862 4:118689727-118689749 ATCCCTTAGAATCCAGGAGGCGG - Intronic
979453877 4:120904101-120904123 AACCTCTTGAACCCAGGAGATGG + Intronic
979858766 4:125667438-125667460 AATCCCTTGAACCCAGGAGAGGG + Intergenic
981595332 4:146414634-146414656 AACCACTTGAACCCAGGAGACGG + Intronic
981654258 4:147093934-147093956 AACATTTGGAAACCAGGACAGGG + Intergenic
981729453 4:147882374-147882396 AACCATTTGAACCCAGGAGGCGG + Intronic
982043882 4:151422471-151422493 AATCCTGTGAACCCAGGAGACGG - Intronic
982219995 4:153116064-153116086 AAACCTCAGAAACCAGGGCAAGG - Intergenic
982232247 4:153219978-153220000 CATCCTTAGTGCCCAGGACAGGG - Intronic
982926062 4:161338390-161338412 AATCATTTGAACCCAGGAGATGG - Intergenic
982974802 4:162042061-162042083 AATCACTTGAACCCAGGACACGG + Intronic
983118841 4:163854436-163854458 AACACTTAGAACCTGGCACAAGG - Intronic
983865745 4:172764043-172764065 AATCGTTTGAACACAGGACATGG - Intronic
984519830 4:180788340-180788362 AATCATTTGAACCCAGGACGGGG - Intergenic
984775701 4:183480134-183480156 AATCATTTGAACCCAGGAGACGG - Intergenic
984943395 4:184953032-184953054 GACCCTGATAACCCAGGTCAAGG - Intergenic
984996545 4:185436621-185436643 AACCGCTTGAACCCAGGATACGG + Intronic
985021383 4:185694791-185694813 AATCCTTTGAACCCAGGAGGTGG - Intronic
985269995 4:188184766-188184788 AATCGCTTGAACCCAGGACAGGG - Intergenic
986132738 5:4945904-4945926 AACCCATTGAACCCAGGAGGTGG + Intergenic
986526712 5:8686384-8686406 AATCCCTTGAACCCAGGAGACGG + Intergenic
986810546 5:11353714-11353736 AACCGTTTGAACCCAGGAGGCGG + Intronic
986841087 5:11698373-11698395 AATCCTTTGAACCCAGGAGGCGG - Intronic
987199284 5:15558396-15558418 AAACCTTAGAGCACAGGGCATGG + Intronic
987676215 5:21075832-21075854 AATCGTTTGAACCCAGGAGATGG + Intergenic
988525029 5:31979491-31979513 AACCCCTTGAACCCAGGAGCTGG + Intronic
989597931 5:43174139-43174161 AATCCCTAGAACCCAGGAGACGG + Intronic
990782276 5:59378490-59378512 AATCCTTAGAACCTAGGAGATGG - Intronic
991118747 5:62985821-62985843 AAACCTTAAAAACCAGGACTTGG + Intergenic
991193676 5:63906245-63906267 AGCCCTTAGAAAACAGGCCAGGG - Intergenic
991214125 5:64142151-64142173 AACCCTTAGAACAAAACACAGGG + Intergenic
991731183 5:69589969-69589991 AATCGCTTGAACCCAGGACACGG - Intronic
991807615 5:70445124-70445146 AATCGCTTGAACCCAGGACACGG - Intergenic
991863766 5:71037883-71037905 AATCGCTTGAACCCAGGACACGG + Intronic
992728436 5:79633525-79633547 AACCGTTTGAACCCAGGAGACGG - Intronic
993623039 5:90190376-90190398 AATCCTCAGAACCCTGGAGATGG + Intergenic
993893317 5:93501438-93501460 AATCACTTGAACCCAGGACACGG - Intergenic
994143666 5:96368411-96368433 AATCCTTTGAACCCAGGAGTTGG + Intergenic
994606513 5:101973938-101973960 AATCCCTTGAACCCAGGAGATGG - Intergenic
995373704 5:111450245-111450267 AATCCCTAGAACCCAGGAGGCGG + Intronic
996809974 5:127505696-127505718 AATCCCTTGAACCCAGGAGACGG + Intergenic
996833759 5:127768441-127768463 AACCGTTAGAAGCTAGGAGAGGG + Intergenic
997404664 5:133635674-133635696 AACTGTTTGAACCCAGGAGACGG + Intergenic
997901963 5:137774903-137774925 AATCACTTGAACCCAGGACATGG + Intergenic
999176867 5:149638114-149638136 AGCCCTCAGGACCCAGGACAAGG - Intergenic
999342629 5:150785667-150785689 AATCATTTGAACCCAGGAGATGG - Intronic
999726203 5:154440331-154440353 AATCGTTTGAACCCAGGAAATGG + Intergenic
1000070752 5:157738909-157738931 AATCCCTTGAACCCAGGACGGGG - Intronic
1000352052 5:160359840-160359862 AAACATCAGAACCCAGGCCATGG + Intronic
1001389654 5:171368577-171368599 AATCCTTTGAACCCAGGAGGCGG + Intergenic
1002602698 5:180363077-180363099 AATTCTTAGAACTCAGTACAGGG + Intergenic
1002950925 6:1810367-1810389 AATCATTTGAACCCAGGAGATGG - Intronic
1002991059 6:2239240-2239262 AATCACTTGAACCCAGGACACGG + Intronic
1003213574 6:4089260-4089282 AATCCTTTGAACCCAGGAGGTGG + Intronic
1003950762 6:11113660-11113682 AACCTTTTGAACCCAGGAGGCGG - Intronic
1003975641 6:11341171-11341193 AACAATTAGAAAACAGGACAAGG + Intronic
1005230899 6:23700785-23700807 AATCCTTTGAACCCAGGAGTCGG + Intergenic
1005388482 6:25309854-25309876 AATCCCTTGAACCCAGGAGACGG - Intronic
1006018368 6:31101544-31101566 AACCTCTCGAACCCAGGAGACGG + Intergenic
1006018581 6:31103082-31103104 AACCTCTTGAACCCAGGAGACGG + Intergenic
1006031477 6:31179717-31179739 AATCCCTAGAACCCAGGAGGCGG + Intronic
1006063477 6:31442841-31442863 AACCCTCAGGATCCAGGGCAAGG - Intergenic
1007003279 6:38335337-38335359 AATCCTTTGAACCCAGGAGGCGG - Intronic
1008715107 6:54279528-54279550 AATCCTTTGAACCCAGGAGGAGG + Intergenic
1008772482 6:54995511-54995533 AATCATTTGAACCCAGGAGATGG + Intergenic
1010693644 6:78942394-78942416 AATCCTTTGAACCCAGGAGGCGG + Intronic
1010711626 6:79181854-79181876 AATCCTTTGAACCCAGGAGGAGG - Intergenic
1011494936 6:87928275-87928297 AACCCCTTGAACCCAGGAGGCGG + Intergenic
1011646064 6:89459163-89459185 AATCGTTTGAACCCAGGAGACGG - Intronic
1011729261 6:90244006-90244028 AATCATTTGAACCCAGGAGATGG - Intronic
1012186185 6:96219715-96219737 AATCCTTTGAACCCAGGAGCTGG + Intergenic
1012436699 6:99222567-99222589 GATCTTTAGAAGCCAGGACATGG + Intergenic
1012917891 6:105190134-105190156 AATCCCTTGAACCCAGGAGATGG + Intergenic
1013029197 6:106314468-106314490 AATCATTTGAACCCAGGAGAGGG + Intronic
1013491603 6:110651985-110652007 AATCACTTGAACCCAGGACATGG + Intronic
1013943332 6:115692332-115692354 AATCACTTGAACCCAGGACACGG - Intergenic
1014332107 6:120081954-120081976 AATCATTTGAACCCAGGAGATGG - Intergenic
1014440067 6:121463695-121463717 AATCCGTTGAACCCAGGACATGG - Intergenic
1015585341 6:134770534-134770556 AATCACTAGAACCCAGGAGATGG + Intergenic
1015612723 6:135042724-135042746 AACCGTTTGAACCCAGGAGGCGG + Intronic
1015969391 6:138729231-138729253 AACTGTTTGAACCCAGGACACGG - Intergenic
1015974778 6:138778852-138778874 AATCCTTTGAACCCAGGAGGTGG - Intronic
1018388613 6:163326805-163326827 AACCCTCTAAGCCCAGGACAAGG - Intergenic
1019231698 6:170570744-170570766 AATCATTCGAACCCAGGAGATGG + Intronic
1019444343 7:1063437-1063459 AACCCGTAGGACACGGGACACGG - Intronic
1019554541 7:1622287-1622309 AATCATTTGAACCCAGGAGACGG + Intergenic
1019665833 7:2252045-2252067 GACCCCGAGTACCCAGGACACGG + Exonic
1020044920 7:5033578-5033600 AACCCCTTGAACCCAGGAGGTGG - Intronic
1020145874 7:5642542-5642564 AACCGTTTGAACCCAGGAAATGG - Intronic
1020290322 7:6717955-6717977 AACCCCTTGAACCCAGGAGGTGG - Intergenic
1020445769 7:8265805-8265827 AATCCCTTGAACCCAGGAGATGG - Intergenic
1020957409 7:14759009-14759031 AACCGGTTGAACCCAGGAGATGG - Intronic
1021281118 7:18719424-18719446 AATCGTTTGAACCCAGGAAATGG - Intronic
1021473608 7:21034908-21034930 AATCCCTTGAACCCAGGAGATGG - Intergenic
1021636509 7:22699423-22699445 AACCATTTGAACCCAGGAGGCGG - Intergenic
1021674913 7:23070437-23070459 ATCCCTTACCACCCAGGAGAAGG - Intergenic
1021718933 7:23487376-23487398 AATCCCTTGAACCCAGGAGACGG - Intergenic
1021905862 7:25332562-25332584 AATCCCTTGAACCCAGGAGAAGG - Intergenic
1022563732 7:31375670-31375692 ACCCCTTAGGACCAAGTACATGG + Intergenic
1022979590 7:35591840-35591862 AACCGCTTGAACCCAGGAGACGG + Intergenic
1023143680 7:37128104-37128126 AATCACTTGAACCCAGGACACGG + Intronic
1023349615 7:39307866-39307888 AATCCCTTGAACCCAGGAGATGG + Intronic
1023825417 7:44005589-44005611 AACTCTTTGAACCCAGGAGGTGG + Intronic
1023859403 7:44208471-44208493 AACCCTAGGAACCCAGTAAATGG - Intronic
1024324760 7:48100991-48101013 AATCGCTTGAACCCAGGACAGGG - Intronic
1025174251 7:56789416-56789438 AATCGCTTGAACCCAGGACATGG - Intergenic
1025697552 7:63787006-63787028 AATCGCTTGAACCCAGGACATGG + Intergenic
1025710357 7:63902113-63902135 AACCCTAAAAACCCTGGTCATGG + Intergenic
1026042329 7:66878400-66878422 AATCCTTTGAACCCAGGAGGTGG - Intergenic
1026088967 7:67284360-67284382 AACCCTTTGAACCCAGGAGGTGG + Intergenic
1026725287 7:72865987-72866009 AACCCTTTGAACCCAGGAGGTGG - Intergenic
1026906421 7:74065525-74065547 AACCGCTTGAACCCAGGAGATGG + Intronic
1027033583 7:74909138-74909160 AACCCCTTGAACCCAGGAGGTGG - Intergenic
1027059965 7:75077285-75077307 ATCACTTAGAACCCAGGAGGCGG - Intergenic
1027118556 7:75499678-75499700 AACCCTTTGAACCCAGGAGGTGG + Intergenic
1027234314 7:76288848-76288870 AATCGCTAGAACCCAGGAGATGG + Intergenic
1027273242 7:76535788-76535810 AACCCTTTGAACCCAGGAGGTGG - Intergenic
1027326686 7:77054852-77054874 AACCCTTTGAACCCAGGAGGTGG - Intergenic
1028762142 7:94509008-94509030 AACCATTTGAACCCAGGAGGGGG + Intergenic
1029397371 7:100317516-100317538 AACCCCTTGAACCCAGGAGGTGG + Intronic
1029718933 7:102350344-102350366 AACCCTTTGAACCCAGGAGGTGG - Intergenic
1029753682 7:102558914-102558936 AACCCTTTGAACCCAGGAGGTGG + Intronic
1029771630 7:102657998-102658020 AACCCTTTGAACCCAGGAGGTGG + Intronic
1029821384 7:103150658-103150680 AATCCTTAGAGCCCAGGAGTTGG + Intergenic
1030069469 7:105686427-105686449 AATCCCTTGAACCCAGGAGATGG + Intronic
1030664936 7:112266231-112266253 AATCCCTTGAACCCAGGAGATGG - Intronic
1030956786 7:115862914-115862936 AAACACTTGAACCCAGGACATGG - Intergenic
1030998390 7:116385966-116385988 AATCTTTTGAACCCAGGAAAAGG + Intronic
1031566072 7:123298281-123298303 AAACCTTACAGGCCAGGACAGGG + Intergenic
1031615485 7:123874488-123874510 AATCATTTGAACCCAGGAGACGG - Intronic
1032187921 7:129743450-129743472 AACTCTTGGGACCAAGGACAGGG + Intronic
1033485988 7:141789724-141789746 AACCACTTGAACCCAGGAGATGG - Intergenic
1033762129 7:144447011-144447033 AATCATTTGAACCCAGGAGATGG + Intergenic
1033781209 7:144671503-144671525 AACCAATAGAAACAAGGACATGG + Intronic
1033868725 7:145723172-145723194 AACCACTTGAACCCAGGAAATGG + Intergenic
1034343228 7:150371108-150371130 AACCCCTAGAGCCCCGGACATGG - Intronic
1034824442 7:154248777-154248799 AATCGTTTGAACCCAGGAGACGG + Intronic
1035194133 7:157201235-157201257 AACCCCTTGAACCCAGGAGGTGG + Intronic
1035796996 8:2366848-2366870 AACCCTTAGAACCCAGAGAAAGG + Intergenic
1035846155 8:2867217-2867239 AGCCACTTGAACCCAGGACACGG + Intergenic
1036526858 8:9542950-9542972 AACCATTTGAACCCAGGAGGTGG - Intergenic
1036567418 8:9949314-9949336 GGCCCATAGATCCCAGGACAAGG - Intergenic
1036756152 8:11472524-11472546 AATCGCTAGAACCCAGGAGACGG - Intronic
1036822669 8:11952892-11952914 AACCCCTTGAACCCAGGAGGCGG + Intergenic
1036825916 8:11975847-11975869 AATCGTTCGAACCCAGGAGATGG - Intergenic
1038316432 8:26488539-26488561 AACCCACAGAACCTAGCACAGGG + Intronic
1038435634 8:27533952-27533974 AACCCATGGAAGCCTGGACAGGG - Intronic
1038522196 8:28243266-28243288 AACCATTTGAACCCAGGACTCGG - Intergenic
1038659004 8:29480565-29480587 AATCGCTAGAACCCAGGAGACGG + Intergenic
1039064003 8:33593904-33593926 AATCGTTTGAACCCAGGAGATGG - Intronic
1039082173 8:33744272-33744294 AATGCATAGAACCCAGTACAAGG - Intergenic
1039377132 8:37045667-37045689 AATTCTTAGAACCCAGAAGAAGG - Intergenic
1039717966 8:40131770-40131792 AATCATTTTAACCCAGGACATGG - Intergenic
1039739910 8:40373015-40373037 AATCACTAGAACCCAGGAGATGG + Intergenic
1041355670 8:56996886-56996908 AATCCTTTGAACCCAGGAGGTGG + Intergenic
1043475528 8:80602031-80602053 AATCCCTTGAACCCAGGAGACGG - Intergenic
1044241002 8:89888675-89888697 AATCCCTTGAACCCAGGAGACGG - Intergenic
1044586434 8:93873134-93873156 AACCACTTGAACCCAGGAGACGG + Intronic
1044982082 8:97726989-97727011 AATCATTTGAACCCAGGAGACGG + Exonic
1045029364 8:98120556-98120578 AATCCTTTGAACCCAGGAGGCGG - Intronic
1045275104 8:100697044-100697066 AATCATTTGAACCCAGGAGACGG + Intronic
1045564011 8:103295339-103295361 AACCATTTGAACCCAGGAGGCGG + Intergenic
1046055970 8:109078842-109078864 AATCGTTTGAACCCAGGAGACGG + Intergenic
1046364701 8:113211600-113211622 AACCGCTTGAACCCAGGAGACGG + Intronic
1046678801 8:117143810-117143832 TAACCTTAGAACCCAAGACAGGG + Intronic
1047011091 8:120673375-120673397 AACCGCTTGAACCCAGGAGACGG - Intronic
1047602062 8:126435516-126435538 AATCACTAGAACCCAGGAGACGG - Intergenic
1047705376 8:127494020-127494042 ACTCCACAGAACCCAGGACAAGG + Intergenic
1047803795 8:128337791-128337813 GAGCCTTAGATCCCTGGACATGG + Intergenic
1049167946 8:141138470-141138492 AACCACTTGAACCCAGGAGAAGG - Intronic
1049812629 8:144582294-144582316 CACCCTTTGAAACCAGGCCAGGG + Intronic
1049894021 9:97211-97233 AATCCCTTGAACCCAGGAGACGG - Intergenic
1050369758 9:4909089-4909111 AATCGTTTGAACCCAGGAGATGG - Intergenic
1050615002 9:7392781-7392803 ATCACTTAGAACCCAGGAAGTGG - Intergenic
1051904898 9:22083829-22083851 AACGCTTAGAACAGAGGTCAAGG + Intergenic
1053701100 9:40691409-40691431 AATCCTTTGAACCCAGGAGGCGG + Intergenic
1053735248 9:41097295-41097317 AATCCCTTGAACCCAGGAGACGG - Intergenic
1054140283 9:61523036-61523058 AATCGTTTGAACCCAGGAGATGG + Intergenic
1054312393 9:63490807-63490829 AATCCTTTGAACCCAGGAGGCGG + Intergenic
1054411165 9:64814863-64814885 AATCCTTTGAACCCAGGAGGCGG + Intergenic
1054693131 9:68334102-68334124 AATCCCTTGAACCCAGGAGACGG + Intronic
1055091845 9:72371005-72371027 AATCGTTTGAACCCAGGAGACGG + Intergenic
1055128209 9:72743900-72743922 AACCGTTAGAAACCAGAATATGG - Intronic
1055893736 9:81151468-81151490 AATCGCTTGAACCCAGGACATGG + Intergenic
1055910477 9:81344848-81344870 AACCCATACCACACAGGACAGGG + Intergenic
1056010853 9:82328520-82328542 AACCATTTGAACCCAGGAGGCGG - Intergenic
1056197857 9:84245918-84245940 ACACCCTGGAACCCAGGACATGG + Intergenic
1056423003 9:86447716-86447738 AACCGTTTGAACCCAGGAGGTGG + Intergenic
1057061185 9:92004966-92004988 AACCCCTTGAACCCAGGAAGCGG - Intergenic
1057124967 9:92609825-92609847 AACCCCTTGAACCCAGGAGGCGG - Intronic
1057127938 9:92633964-92633986 TTCCCTTAGAACCGAGGCCAAGG - Intronic
1057370770 9:94471000-94471022 AACCCTTAGAAGCCATTGCAGGG + Intergenic
1057809617 9:98247640-98247662 AATCATTTGAACCCAGGAGACGG + Intronic
1058020261 9:100078666-100078688 AATCCTTTGAACCCAGGAAGCGG + Intronic
1058249477 9:102673619-102673641 AATCCCTTGAACCCAGGAGATGG - Intergenic
1058412227 9:104746770-104746792 AACCAATACAACCCAGGTCATGG + Intergenic
1059116791 9:111607135-111607157 AATCATTTGAACCCAGGAGATGG - Intergenic
1059185837 9:112270029-112270051 AATCATTTGAACCCAGGAGACGG - Intronic
1059261093 9:112977444-112977466 AATCATTTGAACCCAGGAGAGGG + Intergenic
1060076425 9:120594538-120594560 AATCATTTGAACCCAGGAGATGG - Intergenic
1061601590 9:131673901-131673923 GACCCTTAGATCTGAGGACATGG - Intronic
1061610387 9:131741494-131741516 AATCTCTTGAACCCAGGACATGG + Intergenic
1061682046 9:132247563-132247585 AATCCCTTGAACCCAGGAGACGG + Intergenic
1062434218 9:136539473-136539495 GATCCTTTGAACCCAGGAGACGG - Intronic
1203756186 Un_GL000218v1:129211-129233 AATCACTTGAACCCAGGACACGG - Intergenic
1185589697 X:1266544-1266566 AATCCCTTGAACCCAGGAGATGG - Intergenic
1185732493 X:2472680-2472702 AATCCTTGGAACCCGGGAGACGG + Intronic
1185739817 X:2522681-2522703 AATCGCTTGAACCCAGGACACGG + Intergenic
1185808411 X:3081421-3081443 AATCCCTTGAACCCAGGAGATGG - Intronic
1186507289 X:10103290-10103312 AACCCTTAGCAGCCTGGGCAAGG + Intronic
1187336947 X:18389594-18389616 ATCCCTTAGAACCCAGGAGGCGG + Intergenic
1187342095 X:18430528-18430550 AATCGTTTGAACCCAGGAGACGG - Intronic
1188383701 X:29530281-29530303 GACCCCTAGAACCCAAGACAAGG + Intronic
1188549293 X:31344761-31344783 AATCGCTAGAACCCAGGACGGGG + Intronic
1189986394 X:46557358-46557380 AATCCTTAGAAGGCAGGCCAAGG + Intergenic
1190759741 X:53429541-53429563 TATCATTAGAACCCAGCACATGG + Intronic
1191189701 X:57653567-57653589 AACCACTTGAACCCAGGACGTGG + Intergenic
1191250764 X:58259129-58259151 AATCCTTCGAGCCCAGCACAGGG - Intergenic
1192117367 X:68424078-68424100 AACCGTTTGAACCCAGGAGGCGG + Intronic
1193262992 X:79431897-79431919 AATCATTGGAACCCAGGAGACGG + Intergenic
1193531469 X:82659673-82659695 AGCCCTTATAACACAGGTCAGGG + Intergenic
1194573306 X:95579576-95579598 AATCCTTTGAACCCAGGAGGTGG + Intergenic
1195034701 X:100961769-100961791 AATCCCTTGAACCCAGGAGACGG + Intergenic
1195105727 X:101600108-101600130 AACCCTTAGGAACCGGGACAGGG - Intergenic
1195107156 X:101613659-101613681 AACCCTTAGGAACCGGGACAGGG + Intergenic
1195269257 X:103214823-103214845 AATCCTGGGAGCCCAGGACAGGG + Intergenic
1195373945 X:104207206-104207228 AACCATTAGAAACCAGCAGATGG - Intergenic
1195457192 X:105082418-105082440 AACGCTGTGAACCCAGGACCTGG - Intronic
1196729801 X:118929324-118929346 AATCCTTTGAACCCCGGAGACGG + Intergenic
1196747341 X:119083207-119083229 AACTCATAGTACCCAGGACAGGG - Intronic
1196768523 X:119271244-119271266 AATCATTTGAACCCAGGAGATGG + Intergenic
1196848001 X:119912015-119912037 AATCCTTCGAACCCAGGAGGCGG - Intronic
1198099156 X:133409066-133409088 AATCCTTTGAACCCAGGAGGTGG + Intronic
1198190894 X:134304458-134304480 AATCATTTGAACCCAGGAGATGG + Intergenic
1199359124 X:146897400-146897422 AATCACTAGAACCCAGGAGACGG - Intergenic
1200986756 Y:9309126-9309148 AACTGCTTGAACCCAGGACAGGG + Intergenic
1201169780 Y:11246836-11246858 AATCATTTGAACCCAGGACGCGG - Intergenic
1201579435 Y:15495340-15495362 TTCCCTTAGAACCCTGAACATGG - Intergenic
1202335796 Y:23809594-23809616 AACCGCTAGAACCCAGGAGATGG + Intergenic
1202534971 Y:25860473-25860495 AACCGCTAGAACCCAGGAGATGG - Intergenic