ID: 915473197

View in Genome Browser
Species Human (GRCh38)
Location 1:156137892-156137914
Sequence CTCCTCCCTATACCTTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915473195_915473197 -6 Left 915473195 1:156137875-156137897 CCTGGCCTTTCTTCTCTCTCCTC 0: 1
1: 2
2: 13
3: 157
4: 1189
Right 915473197 1:156137892-156137914 CTCCTCCCTATACCTTGAACAGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915473197 Original CRISPR CTCCTCCCTATACCTTGAAC AGG Intronic
903125292 1:21243751-21243773 CTCCTGCATCTACCTTGGACTGG - Intronic
903182754 1:21613301-21613323 CTCCTCCCCAGACCTTGACCAGG - Intronic
903336092 1:22625787-22625809 CTCCTCCCTTTACCTTGTCAGGG - Intergenic
908041524 1:60118858-60118880 CTCCTCCCTAGACCTAAAATTGG - Intergenic
908146201 1:61247382-61247404 CTGCTCCCTATACGAAGAACCGG - Intronic
908172635 1:61522487-61522509 CTCCTACCTTTAATTTGAACAGG - Intergenic
908247329 1:62238206-62238228 CTCCTCCCTCGCCCTTGAAGAGG - Exonic
909531382 1:76685385-76685407 CACCTTGCTATTCCTTGAACAGG + Intergenic
913089672 1:115467991-115468013 CACCTCCCTATACCTTTACAGGG - Intergenic
914322474 1:146578427-146578449 CTCCTCCCTTTGCCTTCTACTGG + Intergenic
915473197 1:156137892-156137914 CTCCTCCCTATACCTTGAACAGG + Intronic
920919695 1:210288285-210288307 CTCCTTGCTCTTCCTTGAACAGG - Intergenic
923161600 1:231319007-231319029 CTCCCACCTATATCTAGAACTGG - Intergenic
923219423 1:231879718-231879740 TTCCTGCCTATGTCTTGAACAGG - Intronic
923361800 1:233219076-233219098 CTCTACCCTATACCTTGTATGGG - Intronic
924854803 1:247865575-247865597 CTCCTCGCCATGCCTGGAACGGG - Intronic
1065117564 10:22497462-22497484 CTCCTCCCTATAGCTTTTTCTGG - Intergenic
1065986456 10:30958150-30958172 CTCCTCCCTATTCACTCAACAGG + Intronic
1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG + Intronic
1069656965 10:70097146-70097168 CTCCTCCCAAGACCCTGAAGCGG - Intronic
1071458642 10:85870674-85870696 CTCTACCCTCTACCTGGAACAGG - Intronic
1072005651 10:91244307-91244329 CTGCTCCCTTTACCTGGAATAGG - Intronic
1079139797 11:17800826-17800848 CTCCTTGCTATATCTGGAACTGG - Intronic
1080380618 11:31768529-31768551 GTCCTCAATATACATTGAACTGG + Intronic
1080566470 11:33513969-33513991 CTTCTCCATATACCTTAAATTGG - Intergenic
1080947995 11:36996556-36996578 CTCCTCCCCATTGCTTGAGCTGG - Intergenic
1081585401 11:44380525-44380547 CCTCTCCCTTTACCTTGCACAGG - Intergenic
1082083405 11:48029434-48029456 CCCCTCCCAATTCCTTTAACAGG + Intronic
1084587714 11:70072749-70072771 CTCATCCCTGTACCTTCCACGGG - Intergenic
1084801632 11:71547940-71547962 CTCCTCCCTATTCCTGGACCAGG - Intronic
1084916028 11:72429695-72429717 CTCTGCCCTATACCTGGCACTGG + Intronic
1086917480 11:92547576-92547598 CTCCTCCCTCTACCTCGTGCTGG - Intronic
1089803708 11:121063161-121063183 CACCTCCCTATATCTTGAGATGG - Intronic
1090609785 11:128460559-128460581 CTCCTCCTTATCCTTTCAACTGG + Exonic
1097151686 12:56983966-56983988 CACCCCCCAATACCTTGAAATGG - Intergenic
1098634870 12:72770231-72770253 CTCCTCCCCATATGTTAAACTGG + Intergenic
1099576883 12:84393422-84393444 CTTCCCCCTATAGCTTGAATGGG + Intergenic
1101506007 12:105347132-105347154 CTCCTCCCAATATCTTTATCTGG - Intronic
1103623185 12:122201018-122201040 CTCCTCCCCATCCCGTGACCTGG - Intronic
1106101001 13:26695156-26695178 CTCCTCCCTAGGCCCTGAATAGG - Intergenic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1106621729 13:31376949-31376971 CTGCTCCCTAAATCTTGGACAGG - Intergenic
1110320467 13:74154848-74154870 GTTCTCCGTATAGCTTGAACAGG + Intergenic
1114939899 14:27595727-27595749 CTACTCCATATACCTTAAACTGG - Intergenic
1118321095 14:64753793-64753815 CTCCTCCCTATGCCCTGAGCAGG - Exonic
1119614752 14:76091694-76091716 CTGCTCCCTATCCCTGTAACAGG - Intergenic
1120440908 14:84538090-84538112 CTCATCCCTATATCTAGAACTGG + Intergenic
1121661244 14:95636716-95636738 CTCTTCCCTCTACCTTCAGCAGG - Intergenic
1131114516 15:89785620-89785642 GTCCTGCCTATCCCTGGAACAGG - Intronic
1132251770 15:100340546-100340568 CTTCTCTCTGTACCTGGAACAGG - Intronic
1132631851 16:921600-921622 CCACTCCCTATACCTTGATGGGG + Intronic
1136746770 16:32597692-32597714 CACCTTCCTAGACCTTCAACTGG + Intergenic
1138098558 16:54232867-54232889 CTCTTCCCTCTCCCTAGAACTGG - Intergenic
1138835345 16:60428093-60428115 CTCCTCCATGTAGCTAGAACAGG - Intergenic
1140011148 16:71132742-71132764 CTCCTCCCTTTGCCTTCTACTGG - Intronic
1140583839 16:76263595-76263617 CCCCTCCCTATACCATGGACTGG - Intergenic
1145009225 17:19358007-19358029 CTCCTCCCCTTACCTTCAGCAGG + Intronic
1146486613 17:33248256-33248278 CTTCTCACTGTTCCTTGAACAGG - Intronic
1152115827 17:78386462-78386484 CTCCTTCCCATAACTAGAACTGG + Intronic
1154004448 18:10514989-10515011 CTCCACCCCACACCTTGCACAGG - Intergenic
1164187052 19:22879585-22879607 CTCCTTCCTTTCCCTTGAAGTGG - Intergenic
927287005 2:21367348-21367370 CTCCTCCCCATATATTGAAAGGG - Intergenic
931215868 2:60244060-60244082 CCCCTCCCTGTACCATGACCTGG + Intergenic
938128047 2:128688701-128688723 CTGCACCCTATACCTTTCACTGG + Intergenic
938973030 2:136449429-136449451 CTCCTGCCTTAACCTTGAAATGG + Intergenic
942076044 2:172358075-172358097 CTCCTCCCCAAACCCTGACCAGG - Intergenic
945271640 2:207946512-207946534 CTCTTCCTTTTTCCTTGAACAGG - Exonic
948892108 2:240912531-240912553 CTGCCCCCTGTACCTTGACCTGG - Intergenic
1170329418 20:15191787-15191809 CTCCTGCCTAATCCTTGAGCTGG - Intronic
1170944106 20:20874624-20874646 CTCCTCCCTTCACCTTTACCTGG - Intergenic
1171210880 20:23316072-23316094 GTCCTCCTGATACCTTGCACTGG - Intergenic
1177539202 21:22469541-22469563 CTCCTCCCAACACCTGGATCAGG + Intergenic
1181004200 22:20002254-20002276 CTCCTCCCTACACCTCGAAGTGG - Intronic
1183075972 22:35426909-35426931 CTCCTTCCCAGACCTGGAACTGG - Intergenic
1183478522 22:38050378-38050400 CTCCTCCCTCTCCCTTGGTCAGG - Intergenic
1183786860 22:40034348-40034370 CTCCTCACTCAACCTTGGACTGG - Exonic
1184224650 22:43122371-43122393 CTCCTTCATGTACTTTGAACAGG - Intronic
1184391888 22:44207546-44207568 CTCCTCCCTGGACCCTGAAGAGG + Exonic
1184761183 22:46545540-46545562 CTCCTCCCTATACCCAGCAGGGG - Intergenic
953491321 3:43354440-43354462 CTCCTTGCTAGTCCTTGAACAGG + Intronic
953777433 3:45832827-45832849 CTCTTCACTTTACCTTGAAAAGG + Intronic
956340523 3:68218441-68218463 CTCATCCCCATACCGTGACCTGG - Intronic
956478257 3:69646528-69646550 CTCCTCCTTCTTCCTTGAGCAGG - Intergenic
958446299 3:94219136-94219158 CTGCTCCTTAAACCTTGAGCAGG - Intergenic
965309493 3:167111888-167111910 CTCCTCCCTCTCCCTTCATCAGG + Intergenic
968357536 3:198120785-198120807 CTCCCCCCTTTACCTAGAAAAGG - Intergenic
968899242 4:3423173-3423195 CTCCTCCCTGTCCCGTGAACAGG + Intronic
970160589 4:13184880-13184902 CTTCTCCCAATACATTTAACAGG - Intergenic
970883697 4:20962218-20962240 CTCTCCCCTACACCGTGAACTGG + Intronic
973967736 4:56181272-56181294 CTGCTTCCTCTACCTGGAACAGG - Intronic
977215380 4:94276932-94276954 CTCCTCCCTTCACCTTTCACTGG + Intronic
984483270 4:180333429-180333451 CTCCTTGCTGTTCCTTGAACAGG - Intergenic
986013170 5:3735144-3735166 CTCGTCCCTGTACCTGGAAGAGG - Intergenic
986182500 5:5406469-5406491 GTCCTCCCTCTGCCTTCAACAGG + Intergenic
986467377 5:8039236-8039258 TTCCTCCCTATACCCTCAAGTGG + Intergenic
986914926 5:12607811-12607833 CCTCTCCCTATACCCTGGACAGG + Intergenic
988357755 5:30199811-30199833 CTTCTCCCTACAACTTGAAGGGG - Intergenic
990364064 5:55051568-55051590 ATCCTCACTATAGCTGGAACTGG + Intergenic
996079482 5:119240641-119240663 CTCTTCACTATACCTTGATGGGG + Intronic
1001938918 5:175727351-175727373 CTCCTCCCCATACCATGTTCTGG + Intergenic
1004645821 6:17559757-17559779 CTCCTCCCTACATATAGAACTGG + Intergenic
1005385753 6:25282432-25282454 CTCCTTGCTGTTCCTTGAACAGG + Intronic
1005826453 6:29633940-29633962 CTCTTGGCTATACCTTGAAGTGG + Intronic
1005841277 6:29745981-29746003 CTCCTCCCTATATCCTGAGGGGG - Intergenic
1005870747 6:29972717-29972739 CTCCTCCCTATACCCTTAGGTGG - Intergenic
1006970091 6:38034454-38034476 ATGCTCCTTATATCTTGAACTGG - Intronic
1008023814 6:46610912-46610934 CTCCTTCCTATTCATTTAACTGG - Intronic
1008352472 6:50508233-50508255 CTGCTCTCTACACATTGAACAGG - Intergenic
1012646848 6:101695158-101695180 ATCCTGCCAATACCTTGATCTGG - Intronic
1016380759 6:143476232-143476254 CTCCTTGCTATTCCTTGAACAGG - Intronic
1018071756 6:160170875-160170897 CTCCTCTCTATGTCCTGAACTGG - Intergenic
1018395691 6:163376513-163376535 CTCCTCCTTGTTCCTAGAACAGG - Intergenic
1020543941 7:9499728-9499750 CTCCTAGCTATTTCTTGAACTGG + Intergenic
1020863968 7:13532681-13532703 CATCTCTCTATTCCTTGAACTGG + Intergenic
1022871701 7:34486951-34486973 CACCTCTCTATAGGTTGAACAGG - Intergenic
1028494609 7:91449388-91449410 CTCCTACCTTTAACTTGGACTGG - Intergenic
1028680422 7:93522685-93522707 TTCCTGCCTGTGCCTTGAACTGG - Intronic
1028689714 7:93637914-93637936 CTCCTCCCCATACTCTTAACAGG - Intronic
1029524086 7:101084652-101084674 CTGCTCCCAGTACCTGGAACAGG + Intergenic
1030631249 7:111898210-111898232 CTCCTTGCTATTCCTTGAAAAGG + Intronic
1030875745 7:114811036-114811058 CTCCTCCCTCTTCCTTTAAGAGG - Intergenic
1031850662 7:126858870-126858892 CTCCTTTCTGTTCCTTGAACAGG + Intronic
1041430062 8:57770082-57770104 TTCCTCCCTATAACTTAGACTGG - Intergenic
1041521324 8:58759629-58759651 CTCCTCCCTATGCCTATGACAGG + Intergenic
1045324533 8:101108569-101108591 CTCCTCCCTGAAGCTTGATCAGG - Intergenic
1052054624 9:23890371-23890393 CCTCTCCCTACACCTTCAACAGG + Intergenic
1052162074 9:25275103-25275125 CTCCTCCTTGTACCTTGGCCTGG - Intergenic
1057381622 9:94572404-94572426 CTCCTCCAGAAACCTAGAACTGG + Intronic
1057390553 9:94638924-94638946 CTCCTCCCTTGACCTTGGAGGGG - Intronic
1058956331 9:109952034-109952056 CACCTCTCTTTACCTGGAACAGG + Intronic
1062062125 9:134502355-134502377 CTCCTCCCTGTACCTACAGCCGG + Intergenic
1186836602 X:13444553-13444575 CTCTGCCCTACACCCTGAACAGG + Intergenic
1187833562 X:23407551-23407573 CCCATCACTATAGCTTGAACAGG + Intergenic
1196809962 X:119620998-119621020 CACCACCCAATACCTTGTACAGG + Intronic
1198398763 X:136250673-136250695 TTCCTCCCTGGACCTTGACCGGG + Intronic
1199413170 X:147548999-147549021 ATCCTCTCCATACCTTGAACAGG + Intergenic