ID: 915475949

View in Genome Browser
Species Human (GRCh38)
Location 1:156152974-156152996
Sequence GGGTGAGCAGCCACCTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 148}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915475930_915475949 24 Left 915475930 1:156152927-156152949 CCTCATTAACCCCGCGTTATGAG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 915475949 1:156152974-156152996 GGGTGAGCAGCCACCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 148
915475944_915475949 -5 Left 915475944 1:156152956-156152978 CCTGGAGCCTTTAGGGAGGGGTG 0: 1
1: 0
2: 2
3: 15
4: 200
Right 915475949 1:156152974-156152996 GGGTGAGCAGCCACCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 148
915475943_915475949 -4 Left 915475943 1:156152955-156152977 CCCTGGAGCCTTTAGGGAGGGGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 915475949 1:156152974-156152996 GGGTGAGCAGCCACCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 148
915475932_915475949 15 Left 915475932 1:156152936-156152958 CCCCGCGTTATGAGGCTCCCCCT 0: 1
1: 0
2: 0
3: 2
4: 26
Right 915475949 1:156152974-156152996 GGGTGAGCAGCCACCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 148
915475933_915475949 14 Left 915475933 1:156152937-156152959 CCCGCGTTATGAGGCTCCCCCTG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 915475949 1:156152974-156152996 GGGTGAGCAGCCACCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 148
915475934_915475949 13 Left 915475934 1:156152938-156152960 CCGCGTTATGAGGCTCCCCCTGG 0: 1
1: 0
2: 2
3: 1
4: 75
Right 915475949 1:156152974-156152996 GGGTGAGCAGCCACCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 148
915475941_915475949 -3 Left 915475941 1:156152954-156152976 CCCCTGGAGCCTTTAGGGAGGGG 0: 1
1: 0
2: 3
3: 21
4: 255
Right 915475949 1:156152974-156152996 GGGTGAGCAGCCACCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 148
915475939_915475949 -2 Left 915475939 1:156152953-156152975 CCCCCTGGAGCCTTTAGGGAGGG 0: 1
1: 1
2: 3
3: 24
4: 215
Right 915475949 1:156152974-156152996 GGGTGAGCAGCCACCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915475949 Original CRISPR GGGTGAGCAGCCACCTTTGG GGG Intronic
900609055 1:3536795-3536817 GGGGGAGCAGTGACATTTGGGGG - Intronic
901496881 1:9627355-9627377 GGGTGTGAAGCCAGCTGTGGAGG - Intergenic
902323087 1:15682700-15682722 GGCTGGGGAGCGACCTTTGGAGG + Intergenic
902384199 1:16067183-16067205 GGGGGAGCAGGCAGCTTTGGTGG - Intronic
903100567 1:21025002-21025024 TGTTGATCTGCCACCTTTGGAGG - Intronic
904947795 1:34212324-34212346 GGGTTGGCAGACATCTTTGGAGG - Exonic
905940053 1:41856036-41856058 GGGGCAGCAGGCCCCTTTGGTGG - Intronic
906698114 1:47838375-47838397 TGGTGAGCATCCATCTCTGGAGG + Intronic
906731564 1:48086078-48086100 GGGTCAGAAATCACCTTTGGAGG + Intergenic
907676784 1:56525152-56525174 AGGTGAGCAGCCTCCTTTTATGG - Intronic
912452738 1:109777233-109777255 GGGTGAGCATCCACCCTTCCTGG + Intergenic
915041313 1:152970416-152970438 GTTTGAGCAAACACCTTTGGTGG + Intergenic
915286933 1:154859070-154859092 GGTTGAGCCACCGCCTTTGGAGG - Intronic
915475949 1:156152974-156152996 GGGTGAGCAGCCACCTTTGGGGG + Intronic
921345987 1:214185597-214185619 GGGTGAGAAGCAACCTTTGCAGG - Intergenic
924479150 1:244412070-244412092 GGGGCAGCAGCTCCCTTTGGTGG - Intronic
1063366360 10:5493289-5493311 GGGAGAGCAGACACCTGAGGTGG + Intergenic
1068462040 10:57341587-57341609 TGGTGAGCAGCCACACTTGCTGG + Intergenic
1069599132 10:69692301-69692323 GGGTGACCAGCCACCTCTGCAGG + Exonic
1069627172 10:69875503-69875525 GGGTGAGCTGCCAGCTTTGGGGG - Intronic
1069820241 10:71223023-71223045 GAGTGAGCAGTGACCTGTGGTGG + Intronic
1071419701 10:85479929-85479951 GGGTGATCAGCTAAGTTTGGTGG + Intergenic
1074463150 10:113657099-113657121 GGGAAAGCAGCCACCTTGGGAGG + Intronic
1074768472 10:116717936-116717958 GGGTGAGCAGACAGCTTGGGGGG - Intronic
1076546295 10:131247632-131247654 GGGTGTGCTGCCACCATTGAGGG - Intronic
1076563428 10:131382047-131382069 GGTGCAGCTGCCACCTTTGGGGG + Intergenic
1078436115 11:11327360-11327382 GGGAGACCAGCCTCCTTTGCAGG + Intronic
1085463551 11:76709511-76709533 GGCTGAGCATCCAGCTCTGGTGG + Intergenic
1085693916 11:78687994-78688016 GGGTGGGAAGACCCCTTTGGAGG - Intronic
1089456309 11:118627879-118627901 GGGTGGGCAGCTGCCTGTGGTGG + Exonic
1089968488 11:122673203-122673225 GGCAGAACAGCCACCTTAGGAGG + Intronic
1096542142 12:52313843-52313865 GTGCCAGCAGCCACCCTTGGGGG - Intergenic
1096614111 12:52822023-52822045 GGTGGCGCAGCCAGCTTTGGAGG - Exonic
1097107215 12:56632937-56632959 GGGTGATCAGCCACATCTGATGG - Intronic
1103036910 12:117664222-117664244 GGGTGCCCAGCCACCTTGAGTGG - Intronic
1103443713 12:120980663-120980685 CGGTCAGCAGCCCCCTTTGGTGG + Intronic
1107392516 13:39982013-39982035 GAGTGTGCAGACATCTTTGGAGG + Intergenic
1112589194 13:100748363-100748385 GGCTTAGCAGGCACCTCTGGTGG - Intergenic
1113333816 13:109358321-109358343 GAGTGAGCAGACATTTTTGGGGG + Intergenic
1114542173 14:23469213-23469235 GGATGAGCAGCCAGCAATGGCGG + Intergenic
1115135112 14:30098505-30098527 GGGTGAGCACGATCCTTTGGAGG - Intronic
1122267494 14:100553542-100553564 GTGGGGGCAGCCACATTTGGGGG - Intronic
1122965603 14:105123627-105123649 GGGTGTGCAGCCTCCTTTTGGGG + Intergenic
1124088983 15:26579890-26579912 GGGTTAGCAGCCAGCCTTAGTGG - Intronic
1126353541 15:47770856-47770878 GGAAGAGCAGCCAACTCTGGAGG - Exonic
1127631016 15:60827697-60827719 GGGTGAGCAGCTGCCTGTGCGGG + Intronic
1130646775 15:85735096-85735118 CGGAGAGCAGAGACCTTTGGAGG + Exonic
1132855882 16:2044355-2044377 GGGTGGGCAGGCAGCCTTGGCGG + Intronic
1133017048 16:2948758-2948780 GGATGTGAAGCCACCTTGGGTGG - Exonic
1133384179 16:5355456-5355478 GGGTCAGGAGGCACCTTTGCTGG + Intergenic
1134114686 16:11539094-11539116 GGGCCAGGAGCCACCTTTGCAGG - Intergenic
1136174625 16:28508220-28508242 GAGTGAGCTGCCACCACTGGGGG - Intronic
1139402688 16:66695654-66695676 GGGAGGGCAGCCAGTTTTGGAGG - Intronic
1141522739 16:84592114-84592136 GGGTGTTCTGCCCCCTTTGGAGG - Intronic
1141564561 16:84892551-84892573 CAGTGAGCACCCACCGTTGGTGG - Intronic
1142274085 16:89106778-89106800 GGGTGACCAGACACCTGCGGTGG + Intronic
1142345715 16:89552772-89552794 GTGTGAACAGGCACCTGTGGTGG + Intronic
1143108501 17:4541114-4541136 GGGTGAGCAGCCAGGTTTCCAGG - Intronic
1143614810 17:8043404-8043426 GAAGGATCAGCCACCTTTGGAGG + Intronic
1144755155 17:17675589-17675611 GGGGGAGCAGCAACAGTTGGTGG + Intergenic
1146211841 17:30949217-30949239 GGGTGGGAAGCTACCTCTGGTGG - Intronic
1151416638 17:73970576-73970598 GAGGGAGCAGACCCCTTTGGGGG - Intergenic
1151995851 17:77608576-77608598 AGGTGTGGAGCCCCCTTTGGAGG - Intergenic
1152925482 17:83085709-83085731 TGGTGAGCATCCCCCTGTGGCGG + Intronic
1154453576 18:14501386-14501408 GAGCAACCAGCCACCTTTGGAGG - Intergenic
1156146316 18:34184939-34184961 CGGTGAGCAGAAACCTGTGGAGG + Intronic
1156640183 18:39085670-39085692 GCGTGAGCCACCGCCTTTGGTGG + Intergenic
1157330530 18:46700704-46700726 GGGTGAGCAGCCATCCTAGCTGG - Intronic
1159002973 18:62989371-62989393 GGGTGAGCAGCCAACTCAGTGGG - Intergenic
1160243020 18:77136521-77136543 GGGTCAGCAGCCAGCTCTGAGGG + Intergenic
1160865870 19:1255693-1255715 GGGTGAGTGGCCACCCTCGGGGG + Exonic
1160992534 19:1865558-1865580 GGGTGAGCAGCCTCCAGGGGTGG + Intergenic
1163623161 19:18372782-18372804 GGGTGAGGGGCCTCCTTAGGTGG - Intergenic
1163655191 19:18541802-18541824 GAGTGAGCTGCCACCGCTGGAGG - Exonic
1163739906 19:19005103-19005125 GGGTGAGGAGCCTCCTCGGGGGG - Intronic
1164436727 19:28236777-28236799 GGGTGGGCAGCCACTCTTGAGGG + Intergenic
1164640895 19:29824888-29824910 GTGTGAGCAGCCACCAGTGCAGG - Intergenic
1165068691 19:33242958-33242980 GGGTGAGGTGGCAGCTTTGGTGG + Intergenic
1165393270 19:35550354-35550376 GGGAAAGCCGCCACCTGTGGTGG - Exonic
1166312359 19:41969955-41969977 AGTGGAGCAGCCACCCTTGGGGG - Intronic
1168298337 19:55388811-55388833 GTGGGTGCAGCCACATTTGGAGG + Intronic
926001479 2:9336817-9336839 TGGGGAGCAGCCACCTTGGACGG - Intronic
926019973 2:9486188-9486210 GAGTCACCAGTCACCTTTGGAGG + Intronic
927142646 2:20140509-20140531 GGCTGTGCAGGCATCTTTGGGGG - Intergenic
928124827 2:28608032-28608054 GGTGGAGCAGCCTCCTTTTGGGG - Intronic
934925842 2:98381255-98381277 GGGTGAGAAGCCACCTGTTTGGG - Intronic
940797708 2:158098240-158098262 CGGTGACCACCCACCCTTGGGGG + Intronic
940866328 2:158820926-158820948 GGTTGAGAAGCCACATCTGGGGG - Intronic
947118695 2:226796720-226796742 AGGAGAGCAGCCACCGCTGGGGG + Exonic
947740469 2:232482595-232482617 GGGGGAGCAGCCACCTGTGGAGG + Exonic
947791908 2:232873422-232873444 GGGTGAGCTGCCACCCTTGACGG - Intronic
1168848241 20:959626-959648 GGGTGGGCAGCCAGCCCTGGAGG - Exonic
1171180880 20:23089337-23089359 GGGTAAGCAGCCAGCTGTGAGGG + Intergenic
1173087746 20:39940493-39940515 GAGTGAGCATTCACCTTAGGAGG - Intergenic
1175419531 20:58822625-58822647 GGGTGACCAGCCTCCATTGTGGG - Intergenic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1175445673 20:59017979-59018001 CGGTGAGCAACCACCTCTTGAGG - Intergenic
1176227114 20:64007068-64007090 GGTTGAGCAGCCACCAGTGCAGG + Intronic
1177481906 21:21700988-21701010 GGGTGATCAGACACCCCTGGGGG - Intergenic
1178894492 21:36547815-36547837 GGGTGAGTGACCATCTTTGGAGG - Intronic
1178969152 21:37155828-37155850 GGGTGAGGACCCACATTTTGGGG + Intronic
1180029925 21:45200113-45200135 TGGGGAGCAGCCACCTTGGAGGG + Intronic
1180136232 21:45863608-45863630 GGGTGGGCAGCCTCCCTCGGTGG + Intronic
949517647 3:4821651-4821673 GGCTGAGCAGCCACCAATGCAGG - Intronic
953971980 3:47355151-47355173 GGATGGGCAGCCCCCTTTGGGGG + Intergenic
964255795 3:154772963-154772985 GGGTGGGCTGCCATCTTTGCTGG - Intergenic
968273240 3:197420966-197420988 GAGTAAGCACTCACCTTTGGGGG + Intergenic
968660334 4:1796147-1796169 AGGAGTGGAGCCACCTTTGGTGG + Intronic
969505320 4:7583117-7583139 GGGACAGCAGCCACCTCTGTGGG + Intronic
969529355 4:7722144-7722166 GGGTGAGGCGCCACCTCTCGGGG - Intronic
969637121 4:8375644-8375666 GGGAGAGAAGCCTGCTTTGGAGG - Intronic
969840013 4:9874405-9874427 GGGTAAGCAGACAGCTGTGGGGG - Intronic
982295276 4:153821765-153821787 GGGTGAGCCGCCACGCCTGGCGG + Intergenic
983453474 4:167934465-167934487 GGTTGAGCAGCCACCACTGTGGG - Intergenic
985900003 5:2780744-2780766 TGGGGAGCAGGCAGCTTTGGGGG + Intergenic
985921468 5:2980201-2980223 GAGTGAGCAGCCAGGTGTGGTGG - Intergenic
987831572 5:23102318-23102340 GGGTGAGGAGGCAACTTTGGTGG + Intergenic
997438383 5:133891459-133891481 GTGACAACAGCCACCTTTGGAGG - Intergenic
997697029 5:135869793-135869815 GGGGTAGTAGCCACCTTTGGGGG - Intronic
999200804 5:149814881-149814903 GGGTGAGCAGGCACGTTGAGGGG + Intronic
1001641110 5:173244724-173244746 GGATCAGCAGCCGCCTTTCGCGG + Intergenic
1003608800 6:7590263-7590285 GGGCGAGCCTCCACCTGTGGAGG + Exonic
1007148330 6:39660422-39660444 GGGTGAGTAACTACCTATGGGGG + Intronic
1007299643 6:40857128-40857150 GGGTCAACAGCCACCTTTGCCGG - Intergenic
1007396650 6:41581768-41581790 GGCTGAGCAGCTGCCTATGGAGG - Intronic
1012997884 6:105992100-105992122 GGATGACAAGCCAGCTTTGGTGG + Intergenic
1017343259 6:153351193-153351215 GGGTGAGAGGCAACTTTTGGAGG - Intergenic
1019464553 7:1180194-1180216 GGGTGCGGAGGCCCCTTTGGCGG + Intergenic
1024316749 7:48027011-48027033 AGGAGAGCAGGTACCTTTGGAGG - Intronic
1024568747 7:50706877-50706899 GGGTGAGCACCCATCCCTGGTGG + Intronic
1026108131 7:67437138-67437160 GGCGGCGCAGCCACCTTTGCTGG + Intergenic
1029372115 7:100156853-100156875 GGGTGAGCAGCCCCCTCCAGGGG - Exonic
1032112010 7:129084044-129084066 GGGTGAGCAGCTACTTATGGAGG - Intergenic
1035046299 7:155969539-155969561 GGGTGTGCAGCCACCATTCCAGG - Intergenic
1036229638 8:6988780-6988802 GGGTGAGTAGCCTCCTGTAGGGG + Intergenic
1036232089 8:7007883-7007905 GGGTGAGTAGCCTCCTGTAGGGG + Intronic
1037771050 8:21800036-21800058 GGGAGAGCAGACTCATTTGGTGG - Intronic
1038331759 8:26614542-26614564 TGGTGATCGGCCAACTTTGGAGG - Intronic
1038771468 8:30485736-30485758 GGGTTAGGAGTCACTTTTGGTGG - Intronic
1040435596 8:47387911-47387933 GGGTGAGGAGCAAGCTGTGGAGG - Intronic
1040764796 8:50894460-50894482 GGATGAGCAGCCACTTTTAAGGG + Intergenic
1046711298 8:117514758-117514780 GGGAAAGCAGCCGGCTTTGGGGG - Intergenic
1047673276 8:127172075-127172097 GGGTGATCTGCCACCTATGAAGG + Intergenic
1049589845 8:143452445-143452467 GTGTGAGCAGCCACTTTCTGTGG - Intronic
1049820240 8:144629034-144629056 GTGTGAGCCAACACCTTTGGGGG - Intergenic
1050041794 9:1503789-1503811 GGGTGGGGAACCACCTTTGCTGG - Intergenic
1052102895 9:24472028-24472050 AGGTGAACAGCAACCTTTAGAGG - Intergenic
1052788484 9:32851942-32851964 GGGAGAGCAGCCCTCCTTGGAGG - Intergenic
1056556656 9:87695222-87695244 GCCTAAGCAGCCAGCTTTGGAGG + Intronic
1057738485 9:97690131-97690153 GTGTGAGAAGCCACCATTGCTGG - Intronic
1061803869 9:133127587-133127609 GGGTGAGCACACACCTTGGCAGG + Intronic
1062204480 9:135328595-135328617 GGGTGAGAACCCACAGTTGGGGG + Intergenic
1192264676 X:69530282-69530304 GGGTGAGCAGCCTCCTTCCCTGG - Exonic
1192326810 X:70139584-70139606 GGGTGAGGAGGCACATTTGGGGG - Intronic
1195143586 X:101989530-101989552 GTGTGAACAGCCACCTTTATGGG + Intergenic
1200684462 Y:6246427-6246449 GAGTGAGCAGGCGGCTTTGGGGG + Exonic
1200687104 Y:6266751-6266773 GAGTGAGCAGGCGGCTTTGGGGG + Intergenic
1200989985 Y:9337668-9337690 GAGTGAGCAGGCGGCTTTGGGGG + Exonic
1200992653 Y:9358001-9358023 GAGTGAGCAGGCGGCTTTGGGGG + Exonic
1200995307 Y:9378280-9378302 GAGTGAGCAGGCGGCTTTGGGGG + Intronic
1200997971 Y:9398625-9398647 GAGTGAGCAGGCGGCTTTGGGGG + Exonic
1201000480 Y:9467159-9467181 GAGTGAGCAGGCGGCTTTGGGGG + Exonic
1201003142 Y:9487471-9487493 GAGTGAGCAGGCGGCTTTGGGGG + Exonic
1201005801 Y:9507754-9507776 GAGTGAGCAGGCGGCTTTGGGGG + Intergenic
1201008461 Y:9528084-9528106 GAGTGAGCAGGCGGCTTTGGGGG + Exonic