ID: 915475956

View in Genome Browser
Species Human (GRCh38)
Location 1:156153007-156153029
Sequence GTGCTCACTGGACCACACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915475956_915475960 1 Left 915475956 1:156153007-156153029 CCAAAGTGTGGTCCAGTGAGCAC 0: 1
1: 1
2: 2
3: 17
4: 160
Right 915475960 1:156153031-156153053 AGTTCAGATGGGAAATGTTCTGG 0: 1
1: 0
2: 0
3: 27
4: 267
915475956_915475962 13 Left 915475956 1:156153007-156153029 CCAAAGTGTGGTCCAGTGAGCAC 0: 1
1: 1
2: 2
3: 17
4: 160
Right 915475962 1:156153043-156153065 AAATGTTCTGGGCTTTCTACTGG 0: 1
1: 0
2: 1
3: 21
4: 160
915475956_915475959 -10 Left 915475956 1:156153007-156153029 CCAAAGTGTGGTCCAGTGAGCAC 0: 1
1: 1
2: 2
3: 17
4: 160
Right 915475959 1:156153020-156153042 CAGTGAGCACGAGTTCAGATGGG 0: 1
1: 0
2: 0
3: 2
4: 86
915475956_915475961 2 Left 915475956 1:156153007-156153029 CCAAAGTGTGGTCCAGTGAGCAC 0: 1
1: 1
2: 2
3: 17
4: 160
Right 915475961 1:156153032-156153054 GTTCAGATGGGAAATGTTCTGGG 0: 1
1: 0
2: 3
3: 29
4: 237
915475956_915475964 26 Left 915475956 1:156153007-156153029 CCAAAGTGTGGTCCAGTGAGCAC 0: 1
1: 1
2: 2
3: 17
4: 160
Right 915475964 1:156153056-156153078 TTTCTACTGGCCTGATTTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 194
915475956_915475963 25 Left 915475956 1:156153007-156153029 CCAAAGTGTGGTCCAGTGAGCAC 0: 1
1: 1
2: 2
3: 17
4: 160
Right 915475963 1:156153055-156153077 CTTTCTACTGGCCTGATTTCTGG 0: 1
1: 0
2: 0
3: 19
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915475956 Original CRISPR GTGCTCACTGGACCACACTT TGG (reversed) Intronic
901803614 1:11724059-11724081 GTGTTCTATGGAACACACTTTGG - Exonic
903534635 1:24058803-24058825 GTGGTCACTTGGCCACTCTTTGG + Intronic
903680497 1:25093225-25093247 GAGATCACTGGACCTCACCTGGG + Intergenic
904291588 1:29489318-29489340 GTGTTCTCTGGAACACGCTTTGG - Intergenic
904471995 1:30741771-30741793 AGGCTCCCAGGACCACACTTGGG + Intronic
904774214 1:32896716-32896738 TTCCTCACTGGACCAGGCTTGGG + Intronic
905108928 1:35580323-35580345 CTGCTCCCTGGCCCACACTGGGG - Intronic
907942785 1:59105439-59105461 CTGATCAACGGACCACACTTTGG - Intergenic
907951658 1:59189252-59189274 CTGGTCTGTGGACCACACTTTGG - Intergenic
909033928 1:70574886-70574908 GTGGAAACTGGACTACACTTTGG - Intergenic
911168304 1:94744774-94744796 CTGCTCAAAGCACCACACTTGGG - Intergenic
913114316 1:115682524-115682546 GTGCTCACAGGGGCACAGTTGGG + Intronic
915475956 1:156153007-156153029 GTGCTCACTGGACCACACTTTGG - Intronic
917361353 1:174179791-174179813 GGGGTCCATGGACCACACTTTGG + Intronic
917445091 1:175099994-175100016 GTTCTCCATGGACCAGACTTGGG - Intronic
920856078 1:209663130-209663152 CTGCTCTCTCAACCACACTTAGG + Intergenic
921900749 1:220448184-220448206 GTGGTCTATGGAACACACTTCGG + Intergenic
922354634 1:224764213-224764235 GTGCTCAATAAACAACACTTTGG - Intergenic
922859430 1:228803505-228803527 ATGCTGCCAGGACCACACTTTGG - Intergenic
1063682833 10:8206627-8206649 GGGCTTATTCGACCACACTTTGG + Intergenic
1067095133 10:43294882-43294904 GTGCTCAGGGGACCACACAGAGG - Intergenic
1067713976 10:48672363-48672385 GTGTTCACTGGGCCAAACTGAGG + Intergenic
1069818156 10:71211693-71211715 GTGCTCCTTGGACCACCTTTGGG + Intergenic
1072907168 10:99465076-99465098 GTGCTTGGTGGAACACACTTTGG - Intergenic
1075659916 10:124186095-124186117 GAGGTCACTGGAACAGACTTGGG + Intergenic
1078855940 11:15206491-15206513 GTGTTCTCTGGACCTCACTTGGG + Intronic
1079981481 11:27155680-27155702 GAGCTCCCTGGGCCACACATGGG - Intergenic
1083723837 11:64618267-64618289 GTGCACACTGGATCCCACCTGGG - Intronic
1084275456 11:68049038-68049060 GTGCTCACTGGGGCCCACTCTGG - Intronic
1084370625 11:68740249-68740271 CTGGTCCATGGACCACACTTTGG + Intronic
1086446498 11:86876551-86876573 GTGGTCCATGGGCCACACTTTGG - Intronic
1087570326 11:99919086-99919108 GTGCTCTCATGACCAGACTTGGG + Intronic
1089329075 11:117677432-117677454 GGGCTCACAGGACCACAGATGGG - Intronic
1091750342 12:3018301-3018323 GTGCTGTGTGGACCACACCTGGG + Intronic
1093187741 12:16041060-16041082 GTGCTCCAGGAACCACACTTTGG + Intergenic
1094141958 12:27190563-27190585 GTGCTCACTGGAGCCCACATGGG - Intergenic
1095326543 12:40901346-40901368 GTGGACCCTGGACCACATTTTGG - Intronic
1099298455 12:80861211-80861233 GTGCTCCTTGCACAACACTTTGG + Intronic
1100295517 12:93257444-93257466 GTGCTCTTTGGATCTCACTTGGG - Intergenic
1101011850 12:100459004-100459026 GTGGTTTCTGCACCACACTTGGG + Intergenic
1102884457 12:116511108-116511130 TTGCTCTCTGGACCTCGCTTAGG + Intergenic
1104558286 12:129821822-129821844 CTGGTCACTGGACCACCCCTGGG + Intronic
1105753184 13:23440828-23440850 GTGCTCACTGAACGAGCCTTAGG + Intergenic
1106140643 13:27008101-27008123 GTGAGCTGTGGACCACACTTTGG + Intergenic
1111314546 13:86535839-86535861 GTGGCCACTGGAACACACTTTGG - Intergenic
1111674161 13:91366603-91366625 GTGCTAACTACCCCACACTTTGG + Intergenic
1112278771 13:98044650-98044672 CTGAACAGTGGACCACACTTGGG - Intergenic
1116624939 14:47252630-47252652 GTGCTTACAGGAGCACAGTTTGG + Intronic
1117437411 14:55729884-55729906 GTGTTCTATGGAACACACTTTGG - Intergenic
1119041197 14:71276282-71276304 GTTCTCAGTGGATAACACTTAGG - Intergenic
1120197180 14:81496900-81496922 GTGCTCATCGTACCAGACTTTGG + Intronic
1121203436 14:92140337-92140359 GTGGTCAATGGTCAACACTTTGG + Intronic
1121797158 14:96744646-96744668 GTGCTCCATGGAGCACGCTTTGG - Intergenic
1122034614 14:98938261-98938283 GGCCACACTGGACCACACTCAGG + Intergenic
1122599054 14:102912323-102912345 CTGCTCAGTGGGCCACACGTGGG - Intergenic
1122661845 14:103301320-103301342 GTGGTCATGGGGCCACACTTAGG + Intergenic
1124342538 15:28899466-28899488 GTGCTCACTCAAGCACACTGTGG - Intronic
1124638204 15:31378378-31378400 GTCCTCGCTGGAGCACACTTTGG - Intronic
1128338014 15:66800849-66800871 GTGCCCACTGGACCACAGGGAGG - Intergenic
1129186927 15:73913680-73913702 GTGTTCAATAGAACACACTTTGG + Intergenic
1129245971 15:74278890-74278912 GTGCCCACTGGCCCACACTGCGG + Intronic
1129888852 15:79057753-79057775 CTGCTTCATGGACCACACTTGGG + Intronic
1130879774 15:88045017-88045039 GTGCTCACTGGACCAGGTGTTGG + Intronic
1132502674 16:291533-291555 GAGTTCCCTGGACCGCACTTTGG + Intronic
1132989680 16:2786400-2786422 GGGCTCCCTGGAGCACTCTTGGG - Intronic
1136453102 16:30365386-30365408 CTGCCCTCTGGACCACACTGGGG - Intronic
1137573095 16:49579331-49579353 GGGCCAACTGGACCACACTAGGG + Intronic
1140856961 16:78986464-78986486 GTGCTGATTGTACCACTCTTTGG + Intronic
1141424786 16:83937790-83937812 CTGCTCCCTGGAACACACTTTGG - Intronic
1142110872 16:88330547-88330569 GTTCTCACTGGCCCAGACTGTGG + Intergenic
1144024647 17:11267263-11267285 CTGGTCCATGGACCACACTTTGG - Intronic
1145059618 17:19724485-19724507 CTGCTCCCTGGACCGCACCTGGG - Intergenic
1146445522 17:32929664-32929686 GAGCTCACTGGACCACAAGAAGG - Intronic
1146937813 17:36823602-36823624 CTGGTCTGTGGACCACACTTTGG - Intergenic
1150340403 17:64362122-64362144 TTGGTCTCTGGACCACACTTTGG - Intronic
1150630054 17:66873997-66874019 TTGCTCCATGGACCCCACTTTGG + Intronic
1150692230 17:67376949-67376971 TTGCTTACTGGACCACACATAGG + Intergenic
1151540935 17:74764201-74764223 GTGCTCACTGGGCCATACTGAGG + Intronic
1153471804 18:5454526-5454548 ATGCTGCCTGGACCACATTTGGG - Intronic
1153764938 18:8366307-8366329 GTGGTCTCTGGACCACACTGTGG - Intronic
1158225080 18:55192430-55192452 CTGCTCCCTGCACCTCACTTTGG + Intergenic
1160233150 18:77064262-77064284 GTGCACTCTGGAGAACACTTAGG - Intronic
1160461324 18:79041145-79041167 GTGGTCACTGGAGAACACTAAGG + Intergenic
1163354177 19:16799035-16799057 GAGTTCCCTGGAACACACTTTGG + Intronic
1164603998 19:29582976-29582998 GTGCTCATTGGACCAGGTTTGGG + Intergenic
1166438284 19:42788194-42788216 GTGCTAACTGGCCCACATATTGG - Intronic
1166457233 19:42951986-42952008 GTGCTAACTGGCCCACATATTGG - Intronic
1166467177 19:43042842-43042864 GTGCTAACTGGCCCACATATTGG - Intronic
1166473314 19:43098928-43098950 GTGCTAACTGGCCCACATATTGG - Intronic
1166487260 19:43224042-43224064 GTGCTAACTGGACCACATATTGG - Intronic
925193253 2:1902522-1902544 GTGCTCCCTGCACGACACTACGG - Intronic
925262080 2:2537675-2537697 TTGCTCCATGGCCCACACTTTGG - Intergenic
928312140 2:30219996-30220018 GTTCTCACTGGACCAGGCATTGG - Intergenic
930273099 2:49279506-49279528 GTGGTCTAGGGACCACACTTTGG + Intergenic
933806080 2:85998747-85998769 TTGCTCCCTGTCCCACACTTAGG + Intergenic
944016187 2:195041956-195041978 GTGCTCACTGGTCAACAATGGGG - Intergenic
945511282 2:210706210-210706232 GTGCTCCATGGTGCACACTTTGG + Intergenic
948325826 2:237119948-237119970 GTGCTTCCTGGACCACAAGTTGG + Intergenic
1169097814 20:2918654-2918676 GTGCACATTGCACCATACTTAGG + Intronic
1169410128 20:5361749-5361771 GTGATCACTGGGGAACACTTTGG - Intergenic
1169850153 20:10039683-10039705 GTGGTCCATGGAACACACTTTGG - Intronic
1170938999 20:20833212-20833234 GTGCCCACTGGTCCACAGTGAGG + Intergenic
1171196655 20:23205178-23205200 TTGCTCCCTGAACCACATTTTGG - Intergenic
1173327011 20:42043113-42043135 GTGTTCTGTGGACCACACTCTGG - Intergenic
1173906295 20:46632096-46632118 GAGCTGGCTGGCCCACACTTTGG + Intronic
1175815332 20:61880604-61880626 CTGCTCAGTGCCCCACACTTGGG - Intronic
1177333356 21:19690925-19690947 GTACTCACTGGAAAACACATGGG - Intergenic
1178904567 21:36625727-36625749 GTGTTCCCAGGAACACACTTTGG + Intergenic
1179115457 21:38487578-38487600 GTGCTGCCTGAACCACATTTGGG - Intronic
1182371376 22:29813492-29813514 GTGATACCTGCACCACACTTTGG - Exonic
1182717379 22:32368515-32368537 GTCCTCACTTGCCCACTCTTTGG + Exonic
1185231332 22:49685920-49685942 GTGCTCACTGGACCACTGCCGGG - Intergenic
952175649 3:30859717-30859739 GTGATCACTGCACCAAGCTTGGG + Intronic
953044129 3:39280392-39280414 GTACTCACTGGACCACACTGGGG + Intronic
953128763 3:40117162-40117184 TAGCTCACTGCACCACCCTTTGG + Intronic
954554255 3:51505790-51505812 GGGCTCACTGGACCAGTCTCAGG + Intergenic
961927577 3:130497602-130497624 GAGTTAACTGGACCACACATAGG + Intergenic
964771130 3:160225472-160225494 GTCCTCACTTGGCCACGCTTGGG - Intergenic
964848926 3:161073079-161073101 GTGTTCTTTGGAACACACTTTGG - Exonic
967451560 3:189629593-189629615 CTGGTCCTTGGACCACACTTTGG - Intergenic
967873114 3:194248649-194248671 GTGTTCTGTGGAACACACTTGGG + Intergenic
967939381 3:194754525-194754547 GTGGTCTCTGGACCACACTTGGG + Intergenic
967952508 3:194852099-194852121 AGGCTCACTGGCCCACACTTAGG - Intergenic
972449107 4:39179286-39179308 GTGCTCAATAAACCACACCTAGG - Intergenic
973841320 4:54863999-54864021 ATGCTCAATGGAACATACTTTGG + Intergenic
975826413 4:78324014-78324036 CTGATCCCTGGACCACAGTTTGG + Intronic
976501113 4:85790158-85790180 GTGGTCCATGGACCACACTTTGG + Intronic
977321218 4:95519048-95519070 GTGTTCCATGGACCATACTTTGG + Intronic
981619095 4:146673513-146673535 GTGTTCTGTGGAACACACTTTGG + Intergenic
988822628 5:34902506-34902528 GTGCTTACAGAACCACATTTTGG + Intergenic
988828004 5:34959418-34959440 CTGCTCTGTGGCCCACACTTTGG - Intergenic
998658686 5:144210889-144210911 GTGATAACGTGACCACACTTAGG + Intronic
998740364 5:145193945-145193967 CTGCCCCCTGGACCACAGTTTGG + Intergenic
998952839 5:147409273-147409295 GTGATGAGTGGCCCACACTTCGG - Intronic
1000045390 5:157518007-157518029 GTGCTCTGGGGACCACATTTTGG + Intronic
1000054544 5:157593320-157593342 CTGGTCTGTGGACCACACTTGGG - Intergenic
1001838529 5:174853150-174853172 GTGCTTAATGGACCTCACTGTGG - Intergenic
1004429193 6:15528800-15528822 ATGCTGAGGGGACCACACTTTGG - Intronic
1004671928 6:17805538-17805560 CTTCTCAATGGTCCACACTTGGG + Exonic
1004735528 6:18402426-18402448 GTGGTCCGTGGAACACACTTGGG - Intronic
1012647942 6:101712238-101712260 CTGCTCAGTGGACCACACACAGG - Intronic
1014259539 6:119200303-119200325 GTGATCTGTTGACCACACTTAGG + Intronic
1015470363 6:133598594-133598616 GGAGTCTCTGGACCACACTTTGG + Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1021908624 7:25361880-25361902 GTGTCCACTGGAACACAATTTGG - Intergenic
1024279239 7:47705803-47705825 CAGCTGACTGGACCACACCTCGG - Intronic
1029116677 7:98241227-98241249 GTCCTCTCTGTACCACACCTGGG + Exonic
1030225597 7:107146829-107146851 GTGTTCAGGGGACCACACTCTGG - Intronic
1031753817 7:125612741-125612763 GTGCCAGCTGGACCACAGTTGGG + Intergenic
1032075800 7:128835572-128835594 GTGCTCACTGGCCCACTCACCGG - Exonic
1032505924 7:132434732-132434754 GAGCTCACCGTTCCACACTTAGG - Intronic
1032539816 7:132693708-132693730 TTGGTCCCTGGACCACTCTTTGG + Intronic
1032568508 7:132973903-132973925 GTCCTCATTGGAGCACAGTTGGG - Intronic
1036207092 8:6813558-6813580 GTGCTCCTTGGACTACAATTTGG + Intronic
1039328470 8:36510781-36510803 CTGGTCTGTGGACCACACTTTGG - Intergenic
1040058699 8:43085648-43085670 CTGCTTACTGAACCAAACTTCGG - Exonic
1040684706 8:49857833-49857855 GTCTTCACTGTACCACTCTTTGG + Intergenic
1042036006 8:64534493-64534515 GTTCTCACTGGTCAACATTTTGG + Intergenic
1049497936 8:142945421-142945443 GTGCTCCGTGGTGCACACTTAGG + Intergenic
1050106762 9:2173851-2173873 GTGTTCTGTGGAGCACACTTTGG + Intronic
1050436556 9:5616700-5616722 CAGATGACTGGACCACACTTTGG + Intergenic
1050702452 9:8355857-8355879 CTGGTCGCTGGGCCACACTTTGG + Intronic
1052637798 9:31125236-31125258 CTGCTAACTGCACCACACCTAGG + Intergenic
1052984429 9:34476183-34476205 GTGCTCACTAGATTACAGTTAGG + Intronic
1055498429 9:76879070-76879092 GTGCTCACTGGAACACACTTTGG - Intronic
1055748989 9:79483680-79483702 GTGCTCACCACAGCACACTTTGG + Intergenic
1056758227 9:89396177-89396199 TTGCTCACTGAACCACTCCTGGG - Intronic
1057641481 9:96827279-96827301 GTGCTCACTGGACCTTCCTTGGG + Intronic
1057894155 9:98893682-98893704 CTGGTCCCTGGATCACACTTTGG - Intergenic
1059239548 9:112792162-112792184 GTGCTCACTGTGAAACACTTGGG + Intronic
1059945088 9:119401442-119401464 GTGGTCTGTGGACCACACCTTGG + Intergenic
1060444490 9:123675262-123675284 GTGTTTCCTGGAACACACTTTGG - Intronic
1060851011 9:126875896-126875918 GTGTTCCCTGGAGCACACTTTGG - Intronic
1186553768 X:10535200-10535222 CTGCTCCCTGGACCTCACTCAGG - Intronic
1189178148 X:38978676-38978698 CTGGTTACTGGGCCACACTTTGG + Intergenic
1195673966 X:107492804-107492826 GTGTTCCCTGGAACACACTTTGG + Intergenic
1196097131 X:111812410-111812432 GTGCTCACGTGACCTCACGTTGG + Intronic
1199694459 X:150334195-150334217 ATTATCACTGAACCACACTTTGG - Intergenic
1199864661 X:151831932-151831954 GCACTCTCTGGACCACACTTAGG + Intergenic
1200712058 Y:6494386-6494408 AGGCTCACTGGCCCACACTGTGG + Intergenic
1201021872 Y:9667585-9667607 AGGCTCACTGGCCCACACTGTGG - Intergenic