ID: 915481999

View in Genome Browser
Species Human (GRCh38)
Location 1:156193293-156193315
Sequence TCCCGAAGCGGTGGGATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358619
Summary {0: 1, 1: 4, 2: 302, 3: 15492, 4: 342820}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915481999_915482004 8 Left 915481999 1:156193293-156193315 CCTGTCATCCCACCGCTTCGGGA 0: 1
1: 4
2: 302
3: 15492
4: 342820
Right 915482004 1:156193324-156193346 CCGCAGCATCGCTTGAGCCCAGG 0: 1
1: 1
2: 140
3: 6001
4: 86780
915481999_915482005 16 Left 915481999 1:156193293-156193315 CCTGTCATCCCACCGCTTCGGGA 0: 1
1: 4
2: 302
3: 15492
4: 342820
Right 915482005 1:156193332-156193354 TCGCTTGAGCCCAGGAGTTCAGG 0: 93
1: 788
2: 2191
3: 3791
4: 5806

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915481999 Original CRISPR TCCCGAAGCGGTGGGATGAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr