ID: 915482000

View in Genome Browser
Species Human (GRCh38)
Location 1:156193301-156193323
Sequence ACTCAGTCTCCCGAAGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11307
Summary {0: 1, 1: 0, 2: 4, 3: 382, 4: 10920}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915482000_915482005 8 Left 915482000 1:156193301-156193323 CCCACCGCTTCGGGAGACTGAGT 0: 1
1: 0
2: 4
3: 382
4: 10920
Right 915482005 1:156193332-156193354 TCGCTTGAGCCCAGGAGTTCAGG 0: 93
1: 788
2: 2191
3: 3791
4: 5806
915482000_915482004 0 Left 915482000 1:156193301-156193323 CCCACCGCTTCGGGAGACTGAGT 0: 1
1: 0
2: 4
3: 382
4: 10920
Right 915482004 1:156193324-156193346 CCGCAGCATCGCTTGAGCCCAGG 0: 1
1: 1
2: 140
3: 6001
4: 86780

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915482000 Original CRISPR ACTCAGTCTCCCGAAGCGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr