ID: 915482001

View in Genome Browser
Species Human (GRCh38)
Location 1:156193302-156193324
Sequence GACTCAGTCTCCCGAAGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6815
Summary {0: 1, 1: 0, 2: 0, 3: 218, 4: 6596}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915482001_915482004 -1 Left 915482001 1:156193302-156193324 CCACCGCTTCGGGAGACTGAGTC 0: 1
1: 0
2: 0
3: 218
4: 6596
Right 915482004 1:156193324-156193346 CCGCAGCATCGCTTGAGCCCAGG 0: 1
1: 1
2: 140
3: 6001
4: 86780
915482001_915482005 7 Left 915482001 1:156193302-156193324 CCACCGCTTCGGGAGACTGAGTC 0: 1
1: 0
2: 0
3: 218
4: 6596
Right 915482005 1:156193332-156193354 TCGCTTGAGCCCAGGAGTTCAGG 0: 93
1: 788
2: 2191
3: 3791
4: 5806

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915482001 Original CRISPR GACTCAGTCTCCCGAAGCGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr