ID: 915482002

View in Genome Browser
Species Human (GRCh38)
Location 1:156193305-156193327
Sequence GCGGACTCAGTCTCCCGAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915482002_915482005 4 Left 915482002 1:156193305-156193327 CCGCTTCGGGAGACTGAGTCCGC 0: 1
1: 0
2: 0
3: 2
4: 151
Right 915482005 1:156193332-156193354 TCGCTTGAGCCCAGGAGTTCAGG 0: 93
1: 788
2: 2191
3: 3791
4: 5806
915482002_915482004 -4 Left 915482002 1:156193305-156193327 CCGCTTCGGGAGACTGAGTCCGC 0: 1
1: 0
2: 0
3: 2
4: 151
Right 915482004 1:156193324-156193346 CCGCAGCATCGCTTGAGCCCAGG 0: 1
1: 1
2: 140
3: 6001
4: 86780

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915482002 Original CRISPR GCGGACTCAGTCTCCCGAAG CGG (reversed) Intergenic
905082247 1:35334067-35334089 CCCACCTCAGTCTCCCGAAGTGG - Intronic
906266378 1:44433722-44433744 GAGGCCTCAGCCTCCCAAAGTGG - Intronic
907686756 1:56619420-56619442 GCGGACTCAGGCTCCAGCTGTGG - Intronic
913995684 1:143650537-143650559 GCGGAGACAGTCTCACGCAGAGG + Intergenic
915482002 1:156193305-156193327 GCGGACTCAGTCTCCCGAAGCGG - Intergenic
916028887 1:160859658-160859680 CCTGCCTCAGTCTCCCAAAGTGG - Intronic
918300139 1:183196381-183196403 CCGGCCTCAGCCTCCCAAAGTGG + Intronic
918337603 1:183534753-183534775 CCTGTCTCAGCCTCCCGAAGTGG - Intronic
924387396 1:243511432-243511454 GTGGACTCAGTGTCCGGGAGAGG - Intronic
1064014635 10:11762751-11762773 GCAGACCCAGCCTCCCGGAGAGG - Intronic
1064078155 10:12286872-12286894 CCGGTCTCAGCCTCCCAAAGTGG + Intergenic
1064669572 10:17697173-17697195 CCCGCCTCAGTCTCCCAAAGTGG + Intronic
1066193508 10:33077201-33077223 CCTGCCTCAGTCTCCCGAATAGG - Intergenic
1066412936 10:35191652-35191674 GAGGACACAGTCTCAGGAAGTGG - Intronic
1069432372 10:68349267-68349289 TCCGTCTCAGTCTCCCAAAGTGG - Intronic
1070022421 10:72600043-72600065 CCGGCCTCAGCCTCCCAAAGTGG - Intronic
1086834958 11:91609398-91609420 TGGGACTCAGTCTCCTGAGGAGG + Intergenic
1091272843 11:134330103-134330125 CCTGCCTCAGTCTCCCGAATAGG - Intergenic
1094381270 12:29845797-29845819 CCTGCCTCAGTCTCCCAAAGTGG + Intergenic
1095324952 12:40878240-40878262 CCGGCCTCAGCCTCCCAAAGTGG + Intronic
1097206076 12:57322102-57322124 GCTGCCTCAGCCTCCCGAACAGG - Intronic
1098036278 12:66305493-66305515 CCTGCCTCAGTCTCCCAAAGTGG - Intronic
1100220704 12:92502010-92502032 CCTGCCTCAGTCTCCCAAAGTGG - Intergenic
1108317682 13:49253791-49253813 CCCGCCTCAGCCTCCCGAAGTGG + Intronic
1109711254 13:66163693-66163715 ACCGCCTCAGTCTCCCGAATAGG + Intergenic
1112796014 13:103057630-103057652 CCGGCCTCAGCCTCCCAAAGTGG - Intronic
1118607048 14:67512208-67512230 TGGGACTCAGTTTCCCTAAGGGG + Intronic
1122359375 14:101150553-101150575 GGGGCCTCAGTCTCCCTGAGGGG + Intergenic
1124241567 15:28032537-28032559 CCCGCCTCAGTCTCCCAAAGTGG - Intronic
1125259724 15:37809213-37809235 CCTGCCTCAGTCTCCCAAAGTGG - Intergenic
1125493208 15:40164472-40164494 CCTGACTCAGCCTCCCAAAGTGG + Intronic
1130536173 15:84786560-84786582 GAGGACTCAGCCCCCCAAAGGGG + Intronic
1130575144 15:85085451-85085473 CCCGCCTCAGTCTCCCAAAGTGG - Intronic
1132837583 16:1962109-1962131 GCGGACTCAGGCTCCAGCTGTGG - Exonic
1134475545 16:14570404-14570426 GCCGCCTCGGTCTCCCAAAGTGG - Intronic
1135746698 16:25023069-25023091 TCTGCCTCAGCCTCCCGAAGTGG - Intergenic
1135957926 16:26971838-26971860 CCTGCCTCAGTCTCCCAAAGTGG - Intergenic
1138954375 16:61953035-61953057 GCTGACTCACTCTCCTGAATGGG + Intronic
1139599952 16:67980456-67980478 GACGACCCAGCCTCCCGAAGAGG + Exonic
1140690107 16:77474439-77474461 CCCGCCTCAGTCTCCCAAAGTGG - Intergenic
1143348264 17:6266467-6266489 GGGGCCTCAGTCTCCTGATGGGG - Intergenic
1143450532 17:7034074-7034096 CCTGCCTCAGTCTCCCGAATAGG - Intergenic
1145022867 17:19445981-19446003 GCGGACTCAGGCTCCAGCTGTGG - Intergenic
1147115789 17:38298449-38298471 GCGGACTGAGTCACCAGAACTGG - Exonic
1147246078 17:39121848-39121870 CCGGCCTCAGCCTCCCAAAGGGG - Intronic
1148413886 17:47491170-47491192 GCGGACTGAGTCACCAGAACTGG + Intergenic
1149983190 17:61327754-61327776 GCTGCCTCAGCCTCCCAAAGTGG + Intronic
1152008978 17:77699116-77699138 GAGGACCCAGCCTCCAGAAGAGG - Intergenic
1152522918 17:80870579-80870601 GATGACTCAGTCTCACCAAGGGG + Intronic
1152853167 17:82649089-82649111 GGGGTCTCTGTCTCCTGAAGGGG - Intergenic
1153024434 18:659827-659849 TCTGACTCAGCCTCCCAAAGTGG - Intronic
1154421482 18:14233193-14233215 CCTGACTCAGCCTCCCAAAGTGG + Intergenic
1158062778 18:53366292-53366314 CCCGACTCAGCCTCCCAAAGTGG + Intronic
1159596245 18:70385305-70385327 CCTGCCTCAGCCTCCCGAAGTGG + Intergenic
1162294859 19:9806359-9806381 CCTGCCTCAGCCTCCCGAAGTGG - Intergenic
1164095689 19:22008056-22008078 GCTGCCTCAGCCTCCCAAAGTGG - Intronic
1164226207 19:23248746-23248768 CCGGCCTCAGCCTCCCTAAGTGG - Intronic
1164241120 19:23390068-23390090 CCTGTCTCAGCCTCCCGAAGTGG - Intronic
1164649149 19:29879586-29879608 CCGGGCTCAGTCTCCCAGAGAGG + Intergenic
1165392248 19:35545442-35545464 GCGGTCCCGGTCTCCTGAAGTGG - Intergenic
1165456104 19:35911625-35911647 CCCGCCTCAGTCTCCCAAAGTGG - Intergenic
1166392741 19:42419030-42419052 CCGGCCTCAGCCTCCCAAAGTGG - Intronic
1167138484 19:47632914-47632936 GCAGAGTCTGCCTCCCGAAGTGG + Intronic
925368106 2:3324792-3324814 GCGCGCTCAGACTTCCGAAGTGG + Intronic
927067338 2:19486634-19486656 GCGGACTCTCACTCCCAAAGAGG + Intergenic
927863249 2:26573548-26573570 GAAGACTCTGTCTCCTGAAGCGG + Intronic
928528782 2:32169421-32169443 CCTGACTCAGTCACCCAAAGTGG + Intronic
930047830 2:47188874-47188896 CCCGCCTCAGCCTCCCGAAGTGG - Intergenic
931228205 2:60352019-60352041 GCGGACGCGGCCTCCAGAAGGGG - Intergenic
934481874 2:94656857-94656879 CCTGCCTCAGCCTCCCGAAGTGG + Intergenic
936847518 2:116854474-116854496 GTGTACACAGTCTCCAGAAGGGG + Intergenic
937608162 2:123826806-123826828 GCGGCCTGAGCCTCCCCAAGGGG - Intergenic
938485856 2:131707298-131707320 CCTGCCTCAGTCTCCCTAAGTGG + Intergenic
938851403 2:135264358-135264380 CCTGCCTCAGTCTCCCGAATAGG - Intronic
939261496 2:139816426-139816448 GAGGACTCAGTCTCCTGTAGAGG - Intergenic
945583018 2:211620857-211620879 CCTGCCTCAGTCTCCCAAAGTGG - Intronic
947862624 2:233372265-233372287 CCCGCCTCAGTCTCCCAAAGTGG + Intronic
1170198279 20:13713649-13713671 CCTGCCTCAGTCTCCCAAAGTGG + Intergenic
1172690937 20:36789413-36789435 CCTGCCTCAGTCTCCCAAAGTGG - Intronic
1173235800 20:41244422-41244444 GCTGGCTCAGCCTCCCAAAGTGG - Intronic
1173768875 20:45640500-45640522 GCGGACTCAGGCTCCAGCTGTGG - Intergenic
1176851992 21:13926759-13926781 CCTGACTCAGCCTCCCAAAGTGG - Intergenic
1181746843 22:24961239-24961261 GCTGCCTCAGCCTCCCAAAGTGG + Intronic
1182624749 22:31637724-31637746 GCTGACTCAGTCTGGGGAAGAGG + Intronic
1184597574 22:45523454-45523476 CCCGCCTCAGCCTCCCGAAGTGG - Intronic
1185044526 22:48522520-48522542 GCAGCCTCAGTTTCCAGAAGCGG - Intronic
951537575 3:23753607-23753629 CCGGCCTCAGCCTCCCAAAGTGG + Intergenic
954768395 3:52942759-52942781 GCCGCCTCAGCCTCCCAAAGTGG + Intronic
955306316 3:57836582-57836604 CCTGCCTCAGTCTCCCAAAGTGG + Intronic
962768944 3:138594379-138594401 GCGGACCCAGCTTCCCGGAGAGG - Intronic
963805293 3:149715533-149715555 CCTGACTCAGTCTCCCTTAGAGG + Intronic
965001353 3:162958248-162958270 CCTGCCTCAGTCTCCCAAAGTGG - Intergenic
965638942 3:170812841-170812863 GCAGACTCAGTCCCCAGAGGAGG + Intronic
967075608 3:185999426-185999448 CCAGCCTCAGCCTCCCGAAGTGG - Intergenic
967613983 3:191542912-191542934 CCTGCCTCAGTCTCCTGAAGTGG + Intergenic
968646318 4:1742552-1742574 CCCGTCTCGGTCTCCCGAAGGGG - Intronic
971315593 4:25565128-25565150 CCCGTCTCAGTCTCCCAAAGTGG - Intergenic
972432909 4:39001122-39001144 CCCGCCTCAGCCTCCCGAAGTGG - Intronic
972751121 4:41990408-41990430 GGGGACCCAGACTCCCAAAGTGG - Intergenic
980329376 4:131390522-131390544 CCTGACTCAGCCTCCCAAAGTGG + Intergenic
980595685 4:134952200-134952222 GCGGACTCAGGCTCCAGCTGTGG - Intergenic
981316880 4:143349286-143349308 GCGGACTCAGGCTCCAGCTGTGG - Intronic
984401206 4:179267358-179267380 GAGGCCTCAGCCTCCCAAAGTGG + Intergenic
985500163 5:238614-238636 CCTGTCTCAGCCTCCCGAAGTGG + Intronic
988548696 5:32180931-32180953 GCCTACTCAGTCTCCCAAAGTGG + Intergenic
992108095 5:73467073-73467095 CCTGCCTCAGTCTCCCAAAGTGG - Intergenic
993386824 5:87270591-87270613 CCGGCCTCAGCCTCCCAAAGTGG + Intronic
996309851 5:122092445-122092467 GCTGACTCAGGCTCTTGAAGTGG + Intergenic
1005686222 6:28255380-28255402 GCAGACTCAGACTCCCAAAAAGG - Intergenic
1006148670 6:31974469-31974491 CCTGCCTCAGTCTCCCAAAGTGG - Intronic
1007015711 6:38464740-38464762 CCTGCCTCAGTCTCCCAAAGTGG + Intronic
1009424261 6:63497215-63497237 GAGGCCTCAGCCTCCCAAAGTGG + Intergenic
1015407930 6:132857982-132858004 GAGGGCTCTGTCTCCAGAAGTGG + Intergenic
1016856918 6:148679775-148679797 GCTGCCTCAGCCTCCCAAAGTGG - Intergenic
1018968011 6:168503737-168503759 GCCGGCTCAGTGTCCCGCAGAGG + Intronic
1020077895 7:5270554-5270576 GCCGCCTCAGCCTCCCAAAGTGG - Intergenic
1022153120 7:27630385-27630407 CCTGCCTCAGTCTCCCAAAGTGG + Intronic
1023917702 7:44602685-44602707 CCTGACTCAGCCTCCCAAAGTGG + Intergenic
1026489562 7:70851066-70851088 GCAGACTCAGTTTCCCAGAGAGG + Intergenic
1028809950 7:95074584-95074606 GCTGCCTCAGCCTCCCGAATAGG + Intronic
1029456587 7:100675104-100675126 AAGGACTCAGGCTCCCGGAGCGG + Intronic
1029633994 7:101771702-101771724 GCCCACTCAGCCTCCCAAAGTGG + Intergenic
1029639944 7:101814547-101814569 GGGGCCTCAGTTTCCCCAAGGGG - Intergenic
1031097264 7:117435128-117435150 CCTGCCTCAGCCTCCCGAAGTGG + Intergenic
1031720737 7:125172548-125172570 CCGGCCTCAGCCTCCCAAAGTGG + Intergenic
1032197206 7:129796362-129796384 GAGGACTCAGGCTCCCCAAAGGG + Intergenic
1032469795 7:132170003-132170025 GAGGGCTCTGTCTCCCCAAGGGG + Intronic
1033308877 7:140244965-140244987 CCTGTCTCAGTCTCCAGAAGTGG - Intergenic
1034278946 7:149838513-149838535 GGGGACCCAGGCTCCCGGAGGGG - Exonic
1034655000 7:152722258-152722280 GCGCACTCAGGCTGCTGAAGAGG + Intergenic
1035447488 7:158952708-158952730 GCGGACTCTGTCTTACGATGCGG - Intronic
1038038528 8:23705747-23705769 GGCGATTGAGTCTCCCGAAGTGG - Intronic
1039877759 8:41602199-41602221 TCCGACTCAGTCTTCCAAAGTGG + Intronic
1040598121 8:48859729-48859751 GAGGCCTCAGTCTCCCTAACTGG + Intergenic
1046924434 8:119770825-119770847 CCGCCCTCAGTCTCCCAAAGTGG - Intronic
1049873833 8:145002695-145002717 GCGGCCTCAGTGACCCGTAGAGG - Intergenic
1050371019 9:4921435-4921457 CCGGCCTCAGCCTCCCAAAGTGG + Intergenic
1050517876 9:6463715-6463737 CCTGCCTCAGTCTCCCAAAGTGG + Intronic
1052300917 9:26951650-26951672 CCTGCCTCAGTCTCCCAAAGTGG - Intronic
1053675959 9:40428077-40428099 CCTGCCTCAGCCTCCCGAAGTGG - Intergenic
1053925737 9:43054196-43054218 CCTGCCTCAGCCTCCCGAAGTGG - Intergenic
1054287757 9:63196816-63196838 CCTGCCTCAGCCTCCCGAAGTGG + Intergenic
1054289033 9:63263592-63263614 CCTGCCTCAGCCTCCCGAAGTGG - Intergenic
1054387063 9:64568143-64568165 CCTGCCTCAGCCTCCCGAAGTGG - Intergenic
1054508663 9:65948215-65948237 CCTGCCTCAGCCTCCCGAAGTGG + Intergenic
1055898059 9:81202338-81202360 CCCACCTCAGTCTCCCGAAGTGG + Intergenic
1058023541 9:100116766-100116788 GCGGACTCAGGCTCCAGCTGTGG - Intronic
1061032071 9:128091273-128091295 GCGGACTCAAGCTCCAGATGAGG - Intronic
1061352352 9:130075490-130075512 CCCGCCTCAGTCTCCCAAAGTGG + Intronic
1188415298 X:29925784-29925806 CCTGTCTCAGTCTCCCAAAGTGG + Intronic
1189429580 X:40934993-40935015 GCGGACTCAGGCTCCAGCTGTGG - Intergenic
1196660304 X:118262519-118262541 CCTGCCTCAGTCTCCCAAAGTGG - Intergenic
1201606631 Y:15792816-15792838 CCTGCCTCAGTCTCCCAAAGTGG + Intergenic
1202106054 Y:21367234-21367256 CCTGCCTCAGTCTCCCAAAGTGG + Intergenic