ID: 915482004

View in Genome Browser
Species Human (GRCh38)
Location 1:156193324-156193346
Sequence CCGCAGCATCGCTTGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92923
Summary {0: 1, 1: 1, 2: 140, 3: 6001, 4: 86780}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915482002_915482004 -4 Left 915482002 1:156193305-156193327 CCGCTTCGGGAGACTGAGTCCGC 0: 1
1: 0
2: 0
3: 2
4: 151
Right 915482004 1:156193324-156193346 CCGCAGCATCGCTTGAGCCCAGG 0: 1
1: 1
2: 140
3: 6001
4: 86780
915482001_915482004 -1 Left 915482001 1:156193302-156193324 CCACCGCTTCGGGAGACTGAGTC 0: 1
1: 0
2: 0
3: 218
4: 6596
Right 915482004 1:156193324-156193346 CCGCAGCATCGCTTGAGCCCAGG 0: 1
1: 1
2: 140
3: 6001
4: 86780
915482000_915482004 0 Left 915482000 1:156193301-156193323 CCCACCGCTTCGGGAGACTGAGT 0: 1
1: 0
2: 4
3: 382
4: 10920
Right 915482004 1:156193324-156193346 CCGCAGCATCGCTTGAGCCCAGG 0: 1
1: 1
2: 140
3: 6001
4: 86780
915481999_915482004 8 Left 915481999 1:156193293-156193315 CCTGTCATCCCACCGCTTCGGGA 0: 1
1: 4
2: 302
3: 15492
4: 342820
Right 915482004 1:156193324-156193346 CCGCAGCATCGCTTGAGCCCAGG 0: 1
1: 1
2: 140
3: 6001
4: 86780

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915482004 Original CRISPR CCGCAGCATCGCTTGAGCCC AGG Intergenic
Too many off-targets to display for this crispr