ID: 915482005

View in Genome Browser
Species Human (GRCh38)
Location 1:156193332-156193354
Sequence TCGCTTGAGCCCAGGAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12669
Summary {0: 93, 1: 788, 2: 2191, 3: 3791, 4: 5806}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915482002_915482005 4 Left 915482002 1:156193305-156193327 CCGCTTCGGGAGACTGAGTCCGC 0: 1
1: 0
2: 0
3: 2
4: 151
Right 915482005 1:156193332-156193354 TCGCTTGAGCCCAGGAGTTCAGG 0: 93
1: 788
2: 2191
3: 3791
4: 5806
915482001_915482005 7 Left 915482001 1:156193302-156193324 CCACCGCTTCGGGAGACTGAGTC 0: 1
1: 0
2: 0
3: 218
4: 6596
Right 915482005 1:156193332-156193354 TCGCTTGAGCCCAGGAGTTCAGG 0: 93
1: 788
2: 2191
3: 3791
4: 5806
915482000_915482005 8 Left 915482000 1:156193301-156193323 CCCACCGCTTCGGGAGACTGAGT 0: 1
1: 0
2: 4
3: 382
4: 10920
Right 915482005 1:156193332-156193354 TCGCTTGAGCCCAGGAGTTCAGG 0: 93
1: 788
2: 2191
3: 3791
4: 5806
915481999_915482005 16 Left 915481999 1:156193293-156193315 CCTGTCATCCCACCGCTTCGGGA 0: 1
1: 4
2: 302
3: 15492
4: 342820
Right 915482005 1:156193332-156193354 TCGCTTGAGCCCAGGAGTTCAGG 0: 93
1: 788
2: 2191
3: 3791
4: 5806

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915482005 Original CRISPR TCGCTTGAGCCCAGGAGTTC AGG Intergenic
Too many off-targets to display for this crispr