ID: 915487814

View in Genome Browser
Species Human (GRCh38)
Location 1:156234256-156234278
Sequence GTTGTTGAGGGGATTAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 297}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915487801_915487814 10 Left 915487801 1:156234223-156234245 CCCTTCAGGGGAGGAGAGCCCCA 0: 1
1: 0
2: 0
3: 12
4: 206
Right 915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 297
915487799_915487814 20 Left 915487799 1:156234213-156234235 CCGCATAGTTCCCTTCAGGGGAG 0: 1
1: 0
2: 0
3: 13
4: 135
Right 915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 297
915487802_915487814 9 Left 915487802 1:156234224-156234246 CCTTCAGGGGAGGAGAGCCCCAG 0: 1
1: 0
2: 5
3: 29
4: 292
Right 915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 297
915487806_915487814 -10 Left 915487806 1:156234243-156234265 CCAGGTAAGCCATGTTGTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 297
915487804_915487814 -8 Left 915487804 1:156234241-156234263 CCCCAGGTAAGCCATGTTGTTGA 0: 1
1: 0
2: 1
3: 5
4: 112
Right 915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 297
915487805_915487814 -9 Left 915487805 1:156234242-156234264 CCCAGGTAAGCCATGTTGTTGAG 0: 1
1: 0
2: 0
3: 8
4: 136
Right 915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915487814 Original CRISPR GTTGTTGAGGGGATTAGGGA GGG Intronic
900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG + Intergenic
900805861 1:4767994-4768016 ATTGTTGGTGGGATTAGGGGTGG + Intronic
900901076 1:5516228-5516250 GTTGTTGCAGGGATTAAAGACGG + Intergenic
901000220 1:6145357-6145379 GTTTTTGAGGGGCTTAGGATCGG - Intronic
901929498 1:12587930-12587952 GTTGTTGAGTGAGTGAGGGAGGG + Intronic
902731399 1:18372230-18372252 GTTGTTGAGAAGATTAAGTAAGG + Intronic
902795011 1:18795443-18795465 TTAGATGATGGGATTAGGGAAGG - Intergenic
903160659 1:21486851-21486873 GATGTTGAGGGGAAAGGGGAGGG - Intergenic
903335768 1:22623476-22623498 CTTGTTGAGAGGACTAGGCACGG - Intergenic
905822723 1:41006361-41006383 GGAGTTGAGGGGAGTAGGGATGG - Intronic
906258444 1:44368089-44368111 GTGGTGGAGGGGAATAGGGGGGG + Intergenic
906459801 1:46028522-46028544 GGTGTTGAGGGCTTAAGGGATGG + Intronic
907404612 1:54246275-54246297 TTTGTAGAGGGGATTAGAAAGGG - Intronic
907629946 1:56070466-56070488 GTTGTTGAGTGGATAATTGATGG - Intergenic
907877952 1:58513056-58513078 GTTGTTGACGAGATTTGGGTGGG - Intronic
907902412 1:58752920-58752942 GTTGTTGAGAAGATTAAGCAGGG + Intergenic
910441802 1:87260664-87260686 GATGATGAGGAGAGTAGGGATGG + Intergenic
910986571 1:93010985-93011007 GTAGATTAGGGGATGAGGGAGGG + Intergenic
912600988 1:110933469-110933491 GCTGTTGGGGGGTTTGGGGAGGG - Intergenic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915063143 1:153203248-153203270 AATGTTGAGGGGTCTAGGGAGGG + Intergenic
915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG + Intronic
918133503 1:181649109-181649131 GTTGTTGAGGGTTTTAAGGGAGG - Intronic
919821808 1:201477830-201477852 TGTGTGGAGGGGCTTAGGGAGGG + Intergenic
920060289 1:203222576-203222598 TTTCTTGAGTGGAATAGGGAGGG - Intronic
921798802 1:219378556-219378578 GTAGTGGAGGTGAGTAGGGATGG + Intergenic
923662578 1:235971350-235971372 TTTGTTAAGGGGATCAGAGAAGG - Intergenic
923885450 1:238150294-238150316 ACTGTTGAGAGGATTGGGGAGGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
1063175370 10:3546093-3546115 TGTGGTGAGGGGAGTAGGGAGGG - Intergenic
1063902106 10:10744852-10744874 GGTGTAGAGGGGATTTGGGTGGG - Intergenic
1064828455 10:19433238-19433260 TTTGTTGAGGGGGTCAGTGAAGG + Intronic
1066045626 10:31593084-31593106 GATGTTGAGGGGATGTGGCAAGG + Intergenic
1066512205 10:36113785-36113807 GTTATTGAAGTGATTAGAGATGG - Intergenic
1067896264 10:50183167-50183189 ATTGTTCAGGGAATTAGAGAGGG - Exonic
1067952715 10:50758860-50758882 ATTGTTCAGGGAATTAGAGAGGG + Intronic
1070284161 10:75071448-75071470 GTAGATGAGGGGCTTAGGGGAGG - Intergenic
1071319116 10:84435021-84435043 CTAGTTGAGGGGATCAGGAAGGG + Intronic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1073508782 10:104028370-104028392 GTTGTTGACAGGACTAGGAAAGG - Exonic
1075523884 10:123165991-123166013 GTTTTTGAGGTGGTGAGGGAGGG + Exonic
1075660496 10:124192530-124192552 GTTATTAAGCGAATTAGGGAGGG - Intergenic
1075965885 10:126611140-126611162 GTGGCTGAGGGGGATAGGGAGGG - Intronic
1077388908 11:2290263-2290285 GTTGCTGAGGGGCTAATGGAAGG + Intergenic
1081341473 11:41933320-41933342 GTGGCTGAGAGGATTAAGGAAGG + Intergenic
1082138949 11:48584382-48584404 GTTGTTCAGGTAATTAAGGATGG + Intergenic
1082612894 11:55323547-55323569 GTTGTTCAGGAAATTAAGGATGG + Intergenic
1083315585 11:61813186-61813208 GTTGTTGAGGGGGACAGAGAGGG - Intronic
1084142351 11:67240958-67240980 ATTTTTGTGGGGAATAGGGAAGG - Intronic
1084364721 11:68690156-68690178 GTGGTGGAGGGGAGGAGGGATGG + Intronic
1085679535 11:78559729-78559751 AATATTTAGGGGATTAGGGAGGG - Intronic
1087434429 11:98095487-98095509 GGGGTTGAGGGGCTAAGGGAGGG + Intergenic
1089074914 11:115730080-115730102 GTTGTTGAGAGGATTAGATGAGG + Intergenic
1090730865 11:129572613-129572635 CTTGTTGAGGGGTGGAGGGAGGG - Intergenic
1091131743 11:133152513-133152535 GGAGTGGAGAGGATTAGGGAGGG - Intronic
1092286584 12:7132157-7132179 GTGGTTGAAGGGAAGAGGGATGG + Intronic
1092776026 12:11945923-11945945 GTTGTTGAAGAGAATAGGAAAGG + Intergenic
1094350652 12:29521224-29521246 GTTTTTGAGGGAAGTAGAGAGGG + Intronic
1095941076 12:47727266-47727288 GTTGTTTAGGGGACAAAGGAGGG + Intergenic
1097380280 12:58887054-58887076 GTTGTTGAGGGAATCAGGCAGGG - Intronic
1097438582 12:59581344-59581366 GTTGTTGAAGGGATCATGAACGG - Intergenic
1097569247 12:61311117-61311139 GCTGTTGTGGGGAGTGGGGATGG + Intergenic
1097988598 12:65810362-65810384 CATGTTGTGGGGATTAAGGAAGG - Intergenic
1098707498 12:73708884-73708906 GCTGTTGGGGGGCATAGGGAGGG + Intergenic
1099078309 12:78140753-78140775 ATTGTTGAGAGGATTATCGAAGG + Intronic
1100382519 12:94074872-94074894 GTTCTTGAAGGTATTAGGAAGGG - Intergenic
1102188096 12:110965385-110965407 GGTGTGGAGGGGAGTGGGGAAGG - Intergenic
1102596480 12:113996638-113996660 GTTAATGAGGTGATCAGGGAAGG + Intergenic
1103469486 12:121168606-121168628 GTTGTTGGGAGATTTAGGGATGG - Intronic
1103737606 12:123070461-123070483 GTTGGTGTGGGCATCAGGGAAGG + Intronic
1103930469 12:124448197-124448219 GTGGTTTAGGGGATGAGGGTGGG - Intronic
1104067428 12:125317217-125317239 GTTGTTGAGAGGATTAGCATGGG + Intronic
1105398004 13:20059152-20059174 GTTGTTGAGGAGAGTATGGTAGG + Intronic
1106725123 13:32476421-32476443 GATGCTGAGTGGATTAGGGTAGG + Intronic
1110108734 13:71715304-71715326 CTTCTTGAGGGTGTTAGGGAAGG - Intronic
1111630006 13:90838420-90838442 GGTGTTGAGGGCATGGGGGAAGG - Intergenic
1111730239 13:92065837-92065859 ATTTTTGAGGGGACTAGGGTAGG + Intronic
1112034396 13:95483967-95483989 GTGGTGGAAGGGATAAGGGAGGG - Intronic
1113274605 13:108714872-108714894 GCTGTCGAGGGGATGAGAGATGG - Intronic
1115251077 14:31348673-31348695 GTTGTTGAGAGGATTAAAGAAGG - Intronic
1116752632 14:48905801-48905823 GTTGTTAAGGGGAAACGGGAGGG + Intergenic
1117268518 14:54116366-54116388 GTTTTCTAGGGGAGTAGGGAGGG - Intergenic
1117284177 14:54270414-54270436 TTTTTTGGGGTGATTAGGGATGG + Intergenic
1118809959 14:69265967-69265989 GTTGTTGAGGGGATTCAGAGAGG - Intronic
1121112112 14:91319698-91319720 GCTGTTGTGGGGATTAGAGGTGG - Intronic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1125179800 15:36869798-36869820 ATTGTTGAGGGGAATAGGAGAGG - Intergenic
1125709409 15:41772816-41772838 GATCTGGAGAGGATTAGGGACGG + Intronic
1125922043 15:43530712-43530734 GTGGTTGAGGAGATGGGGGATGG - Exonic
1127767274 15:62198634-62198656 GTTGCTGAGGGGATTACATATGG - Intergenic
1128023472 15:64413940-64413962 GTTGGAGTGGGGAGTAGGGAAGG + Intronic
1128442928 15:67730217-67730239 TTTTTTGAGGGCATAAGGGAGGG - Intronic
1128559570 15:68655779-68655801 CCTGTTGAGGGGCTTGGGGATGG - Intronic
1129298450 15:74612418-74612440 GATGGTGAGGGGTGTAGGGATGG - Intronic
1129982217 15:79883702-79883724 GTTGTTGAGAGGATAAAGTAAGG - Intronic
1130552976 15:84903811-84903833 GTTGTTGAGAGGATTATATAAGG - Intronic
1132015631 15:98314029-98314051 GGGGTTGAGGGGAAAAGGGAGGG - Intergenic
1132744613 16:1431529-1431551 GGTGTTGCGGGGAGTAGGAAGGG - Intergenic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134905795 16:17978490-17978512 GGTCCTGAGGGGATGAGGGAGGG - Intergenic
1135665559 16:24332784-24332806 GGTGTGGAGTGGAGTAGGGAGGG - Intronic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1138322296 16:56126022-56126044 GTTGCTGTGGTGATTAGAGATGG - Intergenic
1139494237 16:67304379-67304401 GTTGGTGTGGGCTTTAGGGAGGG + Intronic
1141957571 16:87383192-87383214 GTATTTGAGGCGGTTAGGGAGGG - Intronic
1142534454 17:604852-604874 TTTGTTGAGTGGATGAGGGAAGG - Intronic
1142685276 17:1574101-1574123 GTTGTGGAAGGGTGTAGGGATGG + Intronic
1144777337 17:17791487-17791509 GTTGTTGAAGGGGTCAGGAAGGG - Intronic
1145833336 17:27935429-27935451 ATTAATGAGGGGATTAGGAAAGG + Intergenic
1145907836 17:28525985-28526007 GTTGTTGAGGGGATTAAATGGGG - Intronic
1146595783 17:34167308-34167330 GTTGTTGTGTGGTTTATGGAAGG - Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149305446 17:55342503-55342525 GTCGATGAGGGGAACAGGGAAGG + Intergenic
1149475886 17:56960665-56960687 GTAGTGGAGGGGATGGGGGATGG - Intronic
1149598509 17:57878089-57878111 GTTACTGAGGGGAGGAGGGAGGG - Intronic
1152589179 17:81203047-81203069 GGTCTTGCGGGGATTGGGGATGG - Intronic
1153115193 18:1646316-1646338 GTTGTGGCGGGGAGTGGGGAAGG + Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1156014465 18:32532472-32532494 GTGCTTGAGGGGATTGAGGAAGG + Intergenic
1156396370 18:36703661-36703683 GTTGGTGTTGGGATTTGGGAGGG + Intronic
1157221282 18:45829852-45829874 GATTTTGAGGGGGTAAGGGAAGG - Intronic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159181799 18:64916858-64916880 GTTGTTGAGGGGAAAGGGGAAGG + Intergenic
1161757609 19:6145808-6145830 GTTGTTGAGGGGGTTGTTGAGGG - Intronic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162821654 19:13226822-13226844 TGTCTTGGGGGGATTAGGGACGG + Intronic
1162966713 19:14159671-14159693 GCTGATGGGGGGATTAGGGGTGG - Intronic
1163809785 19:19423711-19423733 GTTGTAGAGGGGGTTGGGGATGG + Intronic
1165149835 19:33753904-33753926 GATGGTGAGGGGATGGGGGATGG - Intronic
1165375795 19:35440803-35440825 GGGGTTGAGGGGATTGAGGATGG - Intergenic
1166043381 19:40216025-40216047 GTTCTTGGGGGGACCAGGGAGGG - Intergenic
1166761176 19:45225128-45225150 GATGTTGGGGGGCTGAGGGATGG + Intronic
1167697617 19:51024534-51024556 GCTGGTAAGGGGATTAGAGATGG - Intronic
1168249122 19:55131462-55131484 GTTTTTGAGGGGCTAGGGGACGG - Intergenic
1168411061 19:56140836-56140858 GTTGTTGTGGAGATCAGGGGAGG - Intronic
927140464 2:20126799-20126821 GTTGTTGAGTGAATGAAGGACGG - Intergenic
927515909 2:23671656-23671678 GCTGTTGTGGGGTGTAGGGAGGG - Intronic
929088088 2:38188503-38188525 GTTTTTGAGGGTATTTGGAAAGG - Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930597469 2:53405929-53405951 TTTGTTGGGGGGAGTAGGGCAGG - Intergenic
932293816 2:70607897-70607919 GTTGTTGTGAAGATTAAGGAAGG - Intronic
932450248 2:71805259-71805281 GTTGTTAATGGGAGTAGGGGTGG - Intergenic
935626373 2:105175272-105175294 GATGTTGAGGGGAGAAGGGAGGG + Intergenic
936164051 2:110104812-110104834 GTCATTGAGGGGATAAGGTAAGG - Intronic
936342737 2:111650711-111650733 GTTATTGATGGGATTGGGGGAGG + Intergenic
937321665 2:120964568-120964590 GTGGTGGAGGGGAGGAGGGAAGG + Intronic
938018962 2:127890476-127890498 CTTTTGGAGGGGATTAGGAACGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
939258893 2:139781459-139781481 GTTGTTGGGGTGATCAAGGAAGG + Intergenic
939945420 2:148403894-148403916 GTTGTTGCAGGGGTTAGGAATGG - Intronic
941224286 2:162826969-162826991 GTTGATGAAGGGTTCAGGGAGGG + Intronic
941686495 2:168454028-168454050 GGTGCTGATGGGATTTGGGATGG + Intergenic
942490652 2:176486562-176486584 GTGGGTGAGGGGCTAAGGGAGGG - Intergenic
947191448 2:227510145-227510167 TGTGTTGAGGGGGGTAGGGAGGG + Intronic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
947548543 2:231029646-231029668 TTTGTTGAAGGGACTGGGGAGGG - Intergenic
948053310 2:234994136-234994158 GGTGTGGAGGGGAAGAGGGAGGG - Intronic
948132195 2:235608920-235608942 ATAGTTGGGGGTATTAGGGATGG - Intronic
948742358 2:240056293-240056315 GTTGTTGATGGAATTTGGGGTGG + Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1171341467 20:24432063-24432085 GTTGTTGAGGGGAGTCTGGGAGG - Intergenic
1173254932 20:41387538-41387560 GTTGCTGAGAGGAGTAGGGGAGG - Intergenic
1173383166 20:42564581-42564603 GTTGTTGGGGGGACAAGGGAAGG + Intronic
1174160653 20:48548059-48548081 GTTGCTGGGGGGATCAGAGAAGG - Intergenic
1174287840 20:49484486-49484508 GTTGTTGACGGGACGAAGGAAGG - Intergenic
1176188662 20:63795881-63795903 GTTGGAGAGAGGATTTGGGATGG - Intronic
1178297968 21:31426882-31426904 GTTTTTGAGGGGCTTGGGGTGGG + Intronic
1179361488 21:40713570-40713592 GTTGGTGTGGGGATGAGGAAGGG + Intronic
1182188588 22:28434724-28434746 ATGGTAGAGGGGAGTAGGGAAGG - Intronic
1183110280 22:35643772-35643794 TGTGTTGAGGGGATGGGGGATGG - Intergenic
1183245943 22:36693482-36693504 GTTGTTGAGGGCTTAATGGATGG - Intronic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1184021954 22:41826906-41826928 GGTGTCGAGGGGATCTGGGATGG - Intergenic
1184380180 22:44140453-44140475 GTGGTTGAGGGTAAAAGGGAGGG + Intronic
1185276017 22:49950481-49950503 GTTGTTGGGGGTAGTAGGGGTGG + Intergenic
949981288 3:9503262-9503284 GTTGTTAGGGGGCTTTGGGAAGG + Intronic
950225594 3:11231014-11231036 GTGGTTGCCGGGTTTAGGGATGG - Intronic
950933341 3:16812849-16812871 GTTGTTGAGGGGATTAAATTAGG + Intronic
953328623 3:42033677-42033699 GTGGTTGTGGGGATTAGATAAGG + Intronic
953790609 3:45945161-45945183 GTTTCTGAGTGGATTAGGAAAGG + Exonic
953901188 3:46845183-46845205 ACTGTTGTGGGGATTAGAGAGGG - Intergenic
956541565 3:70345643-70345665 GTTTTGGAGGGGATGAGGGGAGG - Intergenic
956755599 3:72383091-72383113 GTTGTTGAGGGGTTTGGGTGGGG - Intronic
958562399 3:95763931-95763953 GTTGTTTAGGGGAGTAGATACGG + Intergenic
959255348 3:104004212-104004234 ATTGTTGAGGGAGTTGGGGACGG - Intergenic
959309346 3:104713241-104713263 GTTGTTGAGGAGATTTTGGGGGG - Intergenic
959498372 3:107076957-107076979 GTTAATGAGGCCATTAGGGAGGG - Intergenic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
963433255 3:145236173-145236195 GGTGTTGGGAGGATGAGGGAGGG - Intergenic
963761768 3:149292157-149292179 TTTCTTGAGGGTTTTAGGGAAGG - Intergenic
963934129 3:151035083-151035105 GTGGCTGAGGCGATGAGGGAAGG - Intergenic
965525058 3:169707209-169707231 GGGGTTGAGGGGAGGAGGGAGGG + Intergenic
966374808 3:179285427-179285449 GTTGTTGGGGGGTGTAGGGCGGG + Intergenic
967337362 3:188359605-188359627 GTAGTTGAGGGGATTAAGGAAGG - Intronic
968171663 3:196515137-196515159 GTTGCTGAGGGCTATAGGGAGGG - Intronic
968550959 4:1223182-1223204 TTTGTTGAGGGGAGGAGGGAGGG - Intronic
968634640 4:1671690-1671712 GTGGTTGGTGGGATTAGGGAGGG - Intronic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
969424434 4:7115958-7115980 GATGTGGAGGGGATGAGGAAGGG + Intergenic
970421930 4:15913064-15913086 GTTGCTGAATGGATTAGAGAAGG - Intergenic
970829180 4:20315559-20315581 GTTGTTGAAGGGAGAAGGGAAGG + Intronic
971009455 4:22417462-22417484 GTTGTTGAGAGGATTAAGTGAGG - Intronic
971166518 4:24189563-24189585 GTAGTAGAGGTGATTAGGGAAGG - Intergenic
971375730 4:26054351-26054373 GATGGTGACGGGATCAGGGATGG + Intergenic
971403515 4:26298747-26298769 GTTGTTGGGGGGATGTGGAAAGG + Intronic
971442940 4:26709612-26709634 CCTGTTGAGGGGATTGGGGTGGG + Intronic
971631579 4:28999381-28999403 GTTAAAGAGGGGATTTGGGAGGG - Intergenic
972963485 4:44482059-44482081 GGTGTTGCGGGGATGAGGGGGGG - Intergenic
973553639 4:52060058-52060080 GATGCTGAGGGCATAAGGGATGG - Intronic
973616322 4:52681937-52681959 GTTGCTGAGGGGAAGAGAGATGG + Intergenic
974008127 4:56581089-56581111 GCTGTTGCAGGGAATAGGGAAGG + Intronic
974019729 4:56682193-56682215 GATTTTGAGGGAATGAGGGAAGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
976981071 4:91229834-91229856 GGGGTTGAGGGGAAAAGGGAGGG + Intronic
977642832 4:99376723-99376745 GTTGTGGAAGGGATAAGGTAGGG + Intergenic
977969791 4:103199590-103199612 GGTGGTGGGGGGATTAGGGTAGG + Intergenic
979084378 4:116388369-116388391 GGTATTGAAGGGTTTAGGGAGGG - Intergenic
979397761 4:120208710-120208732 GTTGTTGAAGGGATGAAGGAAGG + Intergenic
980867689 4:138572673-138572695 GTTGTTGAGGGGATTGAATAAGG + Intergenic
982315592 4:154028163-154028185 GTTGTTCAGGGGCTCAGGGAAGG - Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
984833445 4:183997688-183997710 ATTGCTGATGGGATTGGGGATGG + Intronic
987480069 5:18442156-18442178 GTTTGCCAGGGGATTAGGGAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
992297018 5:75336085-75336107 GTGTTTGAGGGAATTAGGAAAGG + Intergenic
992370201 5:76135817-76135839 GTTGTTGAGGGGGGCAGGTATGG + Intronic
992912547 5:81411372-81411394 GTTCTTGATGGGAATAGGGATGG - Intergenic
992931594 5:81653088-81653110 GTGGGTGAGGGGGTAAGGGAGGG - Intronic
993853091 5:93035566-93035588 ATTGCTGAGGGGACTGGGGAGGG + Intergenic
994105685 5:95945984-95946006 GTTAGGGAGGGGATTAGGGCAGG - Intronic
994457750 5:100034206-100034228 GTTGTAGGGGGAATTAGGGATGG + Intergenic
994784422 5:104138174-104138196 GTTTTTGGGGGGGTGAGGGAAGG - Intergenic
995097483 5:108255777-108255799 TTTGTTGAGGAAATTAGGGGAGG + Intronic
997860785 5:137413823-137413845 GTTGTTGATGGGAACAGGTAGGG - Intronic
999421160 5:151445166-151445188 GTTGGGGTGGGGGTTAGGGAAGG + Intronic
999575971 5:152977596-152977618 GGGGTTGAGGGGAGCAGGGAAGG + Intergenic
999678176 5:154028003-154028025 TTTTTTGGGGGGATCAGGGATGG - Intronic
1000185857 5:158857247-158857269 GTTGTTCAGGTGAGAAGGGATGG - Intronic
1000510266 5:162172509-162172531 GTTGTGGAGGAGAGCAGGGAGGG + Intergenic
1001259034 5:170210855-170210877 TTTGTTGAGGGAATTGGGGAAGG + Intergenic
1003234378 6:4282559-4282581 GGTGTTGAGGAGATTATGGGAGG - Intergenic
1003403264 6:5808446-5808468 GTTGTTAGGGGCATTAGAGAAGG - Intergenic
1004101947 6:12621671-12621693 GTTGTCGGGGGGAGTGGGGAGGG + Intergenic
1004128777 6:12899302-12899324 GTTGTTATGGGGAATAGTGATGG + Intronic
1006102192 6:31692577-31692599 GTTGCTGAGGAGATTAAGTAAGG - Intronic
1007589458 6:43012673-43012695 GTTGATTCGGGGATTGGGGAGGG - Intronic
1007625169 6:43242413-43242435 TTTGTTGAAGGCATTAAGGAAGG + Intergenic
1007662102 6:43492992-43493014 GTTGATGAGGGGCTTTAGGAAGG + Intronic
1008732489 6:54499810-54499832 GTTGTTGGGGGGAATGGGGGAGG - Intergenic
1010593868 6:77741493-77741515 GTAGTGGAAGGGACTAGGGAAGG + Intronic
1010682240 6:78810326-78810348 ATTGTTGAGGGGATGATGGCAGG - Intergenic
1010743648 6:79537014-79537036 GAAGATGAAGGGATTAGGGATGG - Intronic
1012503733 6:99920457-99920479 GTTGTTGAGGGTATTAGTATTGG + Exonic
1012826803 6:104156436-104156458 CCTGTTGTGGGGAGTAGGGAGGG - Intergenic
1013426341 6:110016279-110016301 GTGGTTCAGGGGAGTTGGGAAGG - Intergenic
1013566142 6:111365771-111365793 GTAGTCAAGGAGATTAGGGAAGG + Intronic
1014064458 6:117108769-117108791 GCAGTGGAGGGGATCAGGGATGG + Intergenic
1014581981 6:123149246-123149268 GTTCCTGAGAGGATTAGGAAAGG + Intergenic
1016789862 6:148056716-148056738 CTTGTTGTGGGGGTTGGGGAGGG - Intergenic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1018934528 6:168265146-168265168 ATTGATTAGGGGATTAGGGATGG + Intergenic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1021562730 7:21985284-21985306 GTCGTTGTGGGGACTGGGGAAGG + Intergenic
1021570896 7:22064146-22064168 GCTATTGAAGGAATTAGGGAGGG + Intergenic
1022010074 7:26301146-26301168 GTTTTTGGGGGGATTTGGGAAGG - Intronic
1023312623 7:38903238-38903260 GCTGATGGGAGGATTAGGGATGG - Intronic
1023467641 7:40474637-40474659 GTTGGTCAGGGGATGTGGGATGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027288200 7:76672315-76672337 TTTTTTGAGGGGGTGAGGGATGG - Intergenic
1028730589 7:94143684-94143706 GGGGTTGATGGGAGTAGGGAGGG - Intergenic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1031334132 7:120505269-120505291 GATGTTAAGGGGAAGAGGGAGGG - Intronic
1032407399 7:131666587-131666609 GCTGTTCAGGGGATTAGTGCCGG + Intergenic
1032794838 7:135269120-135269142 GTTGCTGTGGGGATGGGGGAAGG - Intergenic
1033026440 7:137777957-137777979 CTTGTTGAGGAAATAAGGGAAGG - Intronic
1033244881 7:139709510-139709532 GTTGATCAGGGGATCATGGAGGG + Intronic
1033454707 7:141492291-141492313 TTTGTTTGGGGGATCAGGGAAGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034105084 7:148483297-148483319 GCTGTTGATGGGGTAAGGGAGGG + Intergenic
1036187612 8:6637811-6637833 GTGGTTCAGGTGATTAGTGATGG + Intronic
1036612578 8:10362900-10362922 GCAGTTGAGTGTATTAGGGAGGG - Intronic
1036972539 8:13370877-13370899 GTTGTGGTGGGGAGTAGGGAAGG - Intronic
1038404865 8:27313990-27314012 TTGCTTGAGGGGATTGGGGAGGG + Intronic
1038597601 8:28903253-28903275 ATTTGTGAGGGGATCAGGGAGGG + Intronic
1039231979 8:35458468-35458490 TTTGTTGAAGGGAAAAGGGACGG - Intronic
1039854721 8:41402383-41402405 GTTCTTGAGGGGTGTGGGGATGG + Intergenic
1040038120 8:42890699-42890721 GGTGTTGAGAGGAAAAGGGAAGG + Intronic
1041129013 8:54676612-54676634 GTTCCTGCAGGGATTAGGGACGG - Intergenic
1041284559 8:56246629-56246651 GATATTTAGGGGAATAGGGATGG - Intergenic
1041712443 8:60906630-60906652 GGTGGAGAGGGGACTAGGGAAGG + Intergenic
1041722954 8:60992883-60992905 GGTCTGGAGGGCATTAGGGAAGG + Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1041945385 8:63434833-63434855 GTTATTGATGGGAGAAGGGACGG + Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1047607782 8:126491777-126491799 TTTGTAGAAGGGATTGGGGAAGG + Intergenic
1047676627 8:127209546-127209568 GTGGTTGAGGGGCTGTGGGAGGG + Intergenic
1047695210 8:127396510-127396532 GTGGTTGTGAGGATTAAGGAAGG + Intergenic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1055702795 9:78964215-78964237 GTTGTTGAGGGGATTAATGGAGG - Intergenic
1056465420 9:86848915-86848937 GGTGGTGAGGGGCTAAGGGAGGG - Intergenic
1057578003 9:96259393-96259415 GTTGTTGTGGGGATCATAGAAGG + Intronic
1059125687 9:111682651-111682673 ATTGTTGAGGGGAGGAAGGAAGG + Intergenic
1059281921 9:113141753-113141775 GTTGTAGAGGGGAGGAGGGGTGG + Intergenic
1060689975 9:125649164-125649186 GGTATGGAGGGGACTAGGGATGG - Intronic
1060781540 9:126416766-126416788 GTTGTTGAGGTGATGAGGCCGGG + Intronic
1062166675 9:135111288-135111310 GTTGGGGAGGGGATTTGGGCAGG + Intronic
1186154128 X:6708063-6708085 TTTTTTGAGGGGGTTAGGGTGGG - Intergenic
1187478562 X:19633929-19633951 GTTGGTGACTGGTTTAGGGATGG + Intronic
1187490170 X:19744060-19744082 GTTGTTGTGGCTATTAGGGAAGG - Intronic
1187889951 X:23924657-23924679 TTTGTTGTGGGGATGAGGGAGGG + Intronic
1189655918 X:43244994-43245016 GTTGTTGAGGGAATTTGTGGAGG + Intergenic
1189875829 X:45434744-45434766 CTTGTTGGGGGGATTATGGCTGG + Intergenic
1190049953 X:47142175-47142197 GTTGTGAAGGGGATATGGGATGG - Intergenic
1190390961 X:49931160-49931182 GTTGTTGAGGTGATTGTTGAAGG + Intronic
1191027141 X:55925775-55925797 ATTTTTGTGGGGATAAGGGATGG + Intergenic
1192158654 X:68766567-68766589 GTTGTTGTGAGGATTATGGGGGG + Intergenic
1194795317 X:98204361-98204383 GTTTTGGAGGGGAGTAGGAAAGG - Intergenic
1198394958 X:136211621-136211643 TTTGGCCAGGGGATTAGGGAGGG + Intergenic
1198499124 X:137225176-137225198 GTTGAAGAGAGGATGAGGGAAGG - Intergenic
1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG + Intergenic